This work was funded by NIAID 1K22AI118929-01. EBP was supported by a Summer Research Fellowship Program Grant from the Office of Research at Old Dominion University, Norfolk, Virginia, USA.

1. Inducible Overexpression of a Histidine-tagged Protein
<ol>
	<li>Amplify rsh from C. difficile R20291 genomic DNA.
	<ol>
		<li>Use a high-fidelity polymerase and follow the manufacturer&#8217;s instructions.</li>
		<li>Amplify C. difficile rsh using primers 
		rsh_F(CAGGTACCGGTTATATGCATGATAAAGAATTACAAG) and 
		rsh_R(CCCTGCAGCTAATGGTGATGGTGATGGTGATTTGTCATTCTATAAATAC), which introduces a C-terminal hexahistidine tag. 
		NOTE: The KpnI and PstI...

<ol>
	<li>Cheek, S., Ginalski, K., Zhang, H., Grishin, N. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+update+of+the+sequence+and+structure+classification+of+kinases.">A comprehensive update of the sequence and structure classification of kinases.</a> BMC Structural Biology. 5 (1), 6 (2005).</li><li>Porath, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilized+metal+ion+affinity+chromatography.">Immobilized metal ion affinity chromatography.</a> Protein Expression and Purification. 3 (4), 263-281 (1992).</li><li>Arnau, J., Lauritzen, C., Pedersen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+strategy,+production+and+purification+of+proteins+with+exopeptidase-cleavable+His-tags.">Cloning strategy, production and purification of proteins with exopeptidase-cleavable His-tags.</a> Nature Protocols. 1 (5), 2326-2333 (2006).</li><li>Porath, J., Carlsson, J., Olsson, I., Belfrage, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metal+chelate+affinity+chromatography,+a+new+approach+to+protein+fractionation.">Metal chelate affinity chromatography, a new approach to protein fractionation.</a> Nature. 258 (5536), 598-599 (1975).</li><li>Smith, M. C., Furman, T. C., Ingolia, T. D., Pidgeon, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chelating+peptide-immobilized+metal+ion+affinity+chromatography.+A+new+concept+in+affinity+chromatography+for+recombinant+proteins.">Chelating peptide-immobilized metal ion affinity chromatography. A new concept in affinity chromatography for recombinant proteins.</a> Journal of Biological Chemistry. 263 (15), 7211-7215 (1988).</li><li>Graslund, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+and+purification.">Protein production and purification.</a> Nature Methods. 5 (2), 135-146 (2008).</li><li>Booth, W. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+an+N-terminal+Polyhistidine+Tag+on+Protein+Thermal+Stability.">Impact of an N-terminal Polyhistidine Tag on Protein Thermal Stability.</a> ACS Omega. 3 (1), 760-768 (2018).</li><li>Thielges, M. C., Chung, J. K., Axup, J. Y., Fayer, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+histidine+tag+attachment+on+picosecond+protein+dynamics.">Influence of histidine tag attachment on picosecond protein dynamics.</a> Biochemistry. 50 (25), 5799-5805 (2011).</li><li>Chaga, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Twenty-five+years+of+immobilized+metal+ion+affinity+chromatography:+past,+present+and+future.">Twenty-five years of immobilized metal ion affinity chromatography: past, present and future.</a> Journal of Biochemical and Biophysical Methods. 49 (1-3), 313-334 (2001).</li><li>Ma, H., Deacon, S., Horiuchi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+challenge+of+selecting+protein+kinase+assays+for+lead+discovery+optimization.">The challenge of selecting protein kinase assays for lead discovery optimization.</a> Expert opinion on drug discovery. 3 (6), 607-621 (2008).</li><li>Tamayo, R., Tischler, A. D., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+EAL+domain+protein+VieA+is+a+cyclic+diguanylate+phosphodiesterase.">The EAL domain protein VieA is a cyclic diguanylate phosphodiesterase.</a> Journal of Biological Chemistry. 280 (39), 33324-33330 (2005).</li><li>Purcell, E. B., McKee, R. W., McBride, S. M., Waters, C. M., Tamayo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+Diguanylate+Inversely+Regulates+Motility+and+Aggregation+in+Clostridium+difficile.">Cyclic Diguanylate Inversely Regulates Motility and Aggregation in Clostridium difficile.</a> Journal of Bacteriology. 194 (13), 3307-3316 (2012).</li><li>Purcell, E. B., Tamayo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+cyclic+nucleotide+phosphodiesterases.">Identification and characterization of cyclic nucleotide phosphodiesterases.</a> Methods in Molecular Biology. 1016, 235-243 (2013).</li><li>Ross, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+cellulose+synthesis+Acetobacter+xylinum.+A+unique+guanyl+oligonucleotide+is+the+immediate+activator+of+the+cellulose+synthase.">Control of cellulose synthesis Acetobacter xylinum. A unique guanyl oligonucleotide is the immediate activator of the cellulose synthase.</a> Carbohydrate Research. 149 (1), 101-117 (1986).</li><li>Potrykus, K., Cashel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=(p)ppGpp:+still+magical?.">(p)ppGpp: still magical?.</a> Annual Review of Microbiology. 62, 35-51 (2008).</li><li>Boutte, C. C., Crosson, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+lifestyle+shapes+stringent+response+activation.">Bacterial lifestyle shapes stringent response activation.</a> Trends in Microbiology. 21 (4), 174-180 (2013).</li><li>Nanamiya, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+functional+analysis+of+novel+(p)ppGpp+synthetase+genes+in+Bacillus+subtilis.">Identification and functional analysis of novel (p)ppGpp synthetase genes in Bacillus subtilis.</a> Molecular Microbiology. 67 (2), 291-304 (2008).</li><li>Gaca, A. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basal+Levels+of+(p)ppGpp+in+Enterococcus+faecalis:+the+Magic+beyond+the+Stringent+Response.">Basal Levels of (p)ppGpp in Enterococcus faecalis: the Magic beyond the Stringent Response.</a> mBio. 4 (5), (2013).</li><li>Sebaihia, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+multidrug-resistant+human+pathogen+Clostridium+difficile+has+a+highly+mobile,+mosaic+genome.">The multidrug-resistant human pathogen Clostridium difficile has a highly mobile, mosaic genome.</a> Nature Genetics. 38 (7), 779-786 (2006).</li><li>Gasteiger, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ExPASy:+The+proteomics+server+for+in-depth+protein+knowledge+and+analysis.">ExPASy: The proteomics server for in-depth protein knowledge and analysis.</a> Nucleic Acids Research. 31 (13), 3784-3788 (2003).</li><li>Purcell, E. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nutrient-regulated+cyclic+diguanylate+phosphodiesterase+controls+Clostridium+difficile+biofilm+and+toxin+production+during+stationary+phase.">A nutrient-regulated cyclic diguanylate phosphodiesterase controls Clostridium difficile biofilm and toxin production during stationary phase.</a> Infection and Immunity. , (2017).</li><li>Mechold, U., Murphy, H., Brown, L., Cashel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intramolecular+Regulation+of+the+Opposing+(p)ppGpp+Catalytic+Activities+of+RelSeq,+the+Rel/Spo+Enzyme+from+Streptococcus+equisimilis.">Intramolecular Regulation of the Opposing (p)ppGpp Catalytic Activities of RelSeq, the Rel/Spo Enzyme from Streptococcus equisimilis.</a> Journal of Bacteriology. 184 (11), 2878-2888 (2002).</li><li>Dalebroux, Z. D., Svensson, S. L., Gaynor, E. C., Swanson, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ppGpp+Conjures+Bacterial+Virulence.">ppGpp Conjures Bacterial Virulence.</a> Microbiology and Molecular Biology Reviews. 74 (2), 171-199 (2010).</li><li>Bartlett, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clostridium+difficile:+progress+and+challenges.">Clostridium difficile: progress and challenges.</a> Annals of the New York Academy of Sciences. 1213, 62-69 (2010).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> US Department of Health and Human Services. , (2013).</li></ol>

The authors declare no competing financial interests or other conflicts of interest.

Here we report the purification of His-tagged RSH from C. difficile and present a method for activity quantification using radiolabeled thin layer chromatography. This method has previously been used to assess the activity of diguanylate cyclase enzymes from C. difficile, as well as (p)ppGpp synthetase, nucleotide cyclase, kinase and phosphodiesterase enzymes from other organisms11,12,13,<sup class="...

Kinase and pyrophosphokinase (or diphospho-kinase) enzymes transfer phosphates from nucleotide triphosphate (NTP) precursors to substrate molecules. The substrates can include other nucleotides, amino acids or proteins, carbohydrates, and lipids1. Bioinformatic analyses can sometimes predict an enzyme&#39;s cognate substrate or substrates based on the similarity to characterized enzymes, but experimental validation is still necessary. Similarly, the affinity of an enzyme for its substrate(s) and the rate at which it catalyzes the phosphor-transfer reaction, and the effects of co-factors, inhibitors, or other enzyme effectors must be determined experimentally. To avoid depletion of the ATP precursor by other ATP-consuming enzymes present in bacterial cytoplasm, quantitative activity assays require purified protein.
Protein purification by metal affinity chromatography has been covered thoroughly in the literature2,3. Histidine tags consisting of six consecutive histidine residues appended to the N- or C-terminus of a recombinant protein allow rapid purification by metal affinity chromatography4,5,6. These sequences are small compared to the proteins they modify and typically have a minimal effect on protein function, although they can sometimes alter protein stability and/or enzyme kinetics7,8. Histidine tags at the N- and C-termini of the same protein can have different effects, which are difficult to predict without knowing the structure of the protein in question. Histidine tags are typically incorporated during the cloning of a recombinant protein by designing primers that encode six histidine residues, either immediately 3&#39; to the ATG start codon or immediately 5&#39; to the stop codon of the open reading frame. After amplification, the hexahistidine-containing gene is ligated into a vector under the control of an inducible promoter and expressed, typically in a laboratory strain of E. coli. The recombination protein can then be isolated on an affinity resin containing immobilized divalent cations (typically nickel or cobalt)9. Contaminating native metal-binding proteins can be removed by titration with imidazole, which competitively displaces bound protein2. Finally, the target protein is eluted from the column with higher concentrations of imidazole. There are several commercial sources for immobilized metal cation resins, and the manufacturers provide recommendations for the buffer conditions and imidazole concentrations. After elution, protein may be analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), dialyzed, or used immediately in functional assays.
There are several methods to indirectly monitor kinase activity by coupling ATP phosphate bond hydrolysis to a second reaction that releases or excites a fluorophore or generates chemiluminescence, but these reactions have multiple moving parts and can be logistically challenging10. The most straightforward way to specifically measure phosphor-transfer activity is to directly monitor the transfer of a radiolabeled phosphate group from a commercially available &#947;-32-P NTP precursor to a non-radiolabeled substrate11,12,13. Mixtures of radiolabeled substrates and products can be separated and quantified by thin layer chromatography (TLC). TLC utilizes the differential mobility of solutes in a given solvent by allowing the solvent (liquid phase) to migrate by capillary action across a surface (solid phase) upon which a mixture of solutes has been adsorbed14. Solutes that are small and/or lack favorable interactions with the solid phase will migrate longer distances from their initial location than solutes with higher molecular weights or great affinities for the solid. For examination of phosphor-transfer, phosphate moieties increase the molecular weight of molecules they are added to, and add negative ionic charge at neutral or acidic pH11,12,14. This decreases their mobility on a basic surface such as PEI-cellulose. When developed in acidic potassium phosphate buffer, mixtures of mono-, di-, tri-, tetra-, and pentaphosphate species can be readily separated on PEI-cellulose, allowing quantification of each species (Figure 2, Figure 3). Such assays can be performed using cell lysates containing the enzyme of interest, but this includes the potential for the activity of other kinases, phosphatases, and general ATPases to deplete the substrate and/or product. For a quantitative in vitro assessment of enzyme activity, it is necessary to purify the enzyme of interest.
Guanosine tetraphosphate (ppGpp) and guanosine pentaphosphate (pppGpp) are ribonucleotide signaling molecules formed by the transfer of a pyrophosphate group from an adenosine triphosphate (ATP) precursor to, respectively, a guanosine diphosphate (GDP) or guanosine tetraphosphate (GTP) substrate15. These single ribonucleotide signals, collectively known as (p)ppGpp, mediate a cell-wide response to environmental stress known as the stringent response in diverse bacterial species15,16. Two conserved classes of enzymes catalyze the formation of (p)ppGpp15,17 Rel/Spo homolog (RSH) enzymes are &#39;long&#39; bifunctional (p)ppGpp synthetase/hydrolases named for their similarity to the RelA and SpoT (p)ppGpp metabolic enzymes from Escherichia coli which contain synthetase, hydrolase, and regulatory domains, while small alarmone synthetase (SAS) enzymes are short monofunctional synthetases found exclusively in Gram positive bacteria15,17,18. The spore-forming Gram-positive bacterium Clostridium difficile encodes putative RSH and SAS genes19. Here, we present initial activity assays that confirm that the C. difficile RSH enzyme is a catalytically active (p)ppGpp synthetase.

<table>
	<tbody>
		<tr>
			<td>Inducible overexpression of a histidine-tagged protein</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Phusion polymerase</td>
			<td>New England Biolabs (NEB)</td>
			<td>M0530L</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAEX II DNA Gel Extraction Kit</td>
			<td>Qiagen</td>
			<td>20021</td>
			<td></td>
		</tr>
		<tr>
			<td>KpnI restriction enzyme</td>
			<td>NEB</td>
			<td>R0142S</td>
			<td></td>
		</tr>
		<tr>
			<td>PstI restriction enzyme</td>
			<td>NEB</td>
			<td>R0140S</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>NEB</td>
			<td>M0202</td>
			<td></td>
		</tr>
		<tr>
			<td>NEB&#174; 5-alpha Competent&#160;E. coli&#160;(High Efficiency)</td>
			<td>NEB</td>
			<td>C2987I</td>
			<td></td>
		</tr>
		<tr>
			<td>BL21 (DE3) Competent E. coli</td>
			<td>NEB</td>
			<td>C2527I</td>
			<td></td>
		</tr>
		<tr>
			<td>IPTG</td>
			<td>Sigma-Aldrich</td>
			<td>10724815001</td>
			<td></td>
		</tr>
		<tr>
			<td>JXN-26 centrifuge with JLA 10.500 rotor</td>
			<td>Beckman Coulter Avanti</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge with D3024/D3024R rotor</td>
			<td>Scilogex</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>MaxQ SHKE6000 Incubator</td>
			<td>Thermo Scientific</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultrasonic processor</td>
			<td>Sonics</td>
			<td>VC-750</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein purification by nickel affinity chromatography</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ni-NTA resin</td>
			<td>G Biosciences</td>
			<td>786-940/941</td>
			<td></td>
		</tr>
		<tr>
			<td>Pierce Disposable Gravity columns, 10 mL</td>
			<td>Thermo Scientific</td>
			<td>29924</td>
			<td></td>
		</tr>
		<tr>
			<td>1 mL Spectra/ Por float-A-lyzer G2 dialysis device (MWCO: 20-kD)</td>
			<td>Spectrum</td>
			<td>G235033</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini-Protean Electrophoresis Cell</td>
			<td>BioRad</td>
			<td>1658004</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein activity assay by thin layer chromatography</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Thin layer chromatograph (TLC) development tank</td>
			<td>General Glass Blowing Company</td>
			<td>80-3</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyethylenimine (PEI)-cellulose plates (20 cm x 20 cm, 100 um thickness) with polyester support</td>
			<td>Sigma-Aldrich</td>
			<td>Z122882-25EA</td>
			<td></td>
		</tr>
		<tr>
			<td>ATP, [&#947;-32P]- 3000 Ci/mmol 10mCi/ml lead, 100 &#956;Ci</td>
			<td>Perkin Elmer</td>
			<td>NEG002A</td>
			<td></td>
		</tr>
		<tr>
			<td>Adenosine 5&#8217;-triphosphate (ATP) 100 mM</td>
			<td>Bio Basic Canada</td>
			<td>AB0311</td>
			<td></td>
		</tr>
		<tr>
			<td>Guanosine-5&#8217;-diphosphate disodium salt (GDP)</td>
			<td>Alfa Aesar</td>
			<td>AAJ61646MC/E</td>
			<td></td>
		</tr>
		<tr>
			<td>Storage phosphor screen</td>
			<td>GE Healthcare Life Sciences</td>
			<td>BAS-IP TR 2040 E Tritium Screen</td>
			<td></td>
		</tr>
		<tr>
			<td>Storm 860 phosphorimager</td>
			<td>GE Healthcare Life Sciences</td>
			<td>-</td>
			<td></td>
		</tr>
	</tbody>
</table>

a purification and in vitro activity assay for a (p)ppgpp synthetase from clostridium difficile

Kinase and pyrophosphokinase enzymes transfer the gamma phosphate or the beta-gamma pyrophosphate moiety from nucleotide triphosphate precursors to substrates to create phosphorylated products. The use of &#947;-32-P labeled NTP precursors allows simultaneous monitoring of substrate utilization and product formation by radiography. Thin layer chromatography (TLC) on cellulose plates allows rapid separation and sensitive quantification of substrate and product. We present a method for utilizing the thin-layer chromatography to assay the pyrophosphokinase activity of a purified (p)ppGpp synthetase. This method has previously been used to characterize the activity of cyclic nucleotide and dinucleotide synthetases and is broadly suitable for characterizing the activity of any enzyme that hydrolyzes a nucleotide triphosphate bond or transfers a terminal phosphate from a phosphate donor to another molecule.

We present a method for the affinity purification of a (p)ppGpp synthetase from Clostridium difficile and the assessment of its enzymatic activity. Figure 1 demonstrates the protein purification achieved by metal affinity chromatography. The second elution (E2) fraction from this purification was dialyzed and used for the enzymatic activity assay. Figure 2 details the necessary steps to prepare for and carry out pyrophos...

Watch this Scientific Journal Video about A Purification and In Vitro Activity Assay for a pppGpp Synthetase from Clostridium difficile at JoVE.com

A Purification and In Vitro Activity Assay for a pppGpp Synthetase from Clostridium difficile

Here, we describe a method for purifying histidine-tagged pyrophosphokinase enzymes and utilizing thin layer chromatography of radiolabelled substrates and products to assay for the enzymatic activity in vitro. The enzyme activity assay is broadly applicable to any kinase, nucleotide cyclase, or phosphor-transfer reaction whose mechanism includes nucleotide triphosphate hydrolysis.

A Purification and In Vitro Activity Assay for a (p)ppGpp Synthetase from Clostridium difficile

Kinase and pyrophosphokinase enzymes transfer the gamma phosphate or the beta-gamma pyrophosphate moiety from nucleotide triphosphate precursors to ...

This method can help answer key questions about phosphotransfer enzymes including enzyme substrate specificity and reaction kinetics. The main advantage of this technique is that it allows for rapid collection of multiple data sets that are very consistent, enabling statistically robust quantification of enzyme activity. Visual demonstration of this method is critical because spotting the reactions onto the TLC plates and quantifying the radioactive species in the reactions is much easier to demonstrate than to explain.In addition to Astha, demonstrating the procedure will be Asia Poudel, another graduate student from my laboratory. Begin this protocol with inducible overexpression of a histidine-tagged protein as described in the text protocol. Prepare one milliliter of nickel nitriloacetic acid resin in a gravity column to purify the protein.The day before use, equilibrate the column overnight at four degrees Celsius with two milliliters of equilibration buffer. The following day bring the column from four degrees Celsius to room temperature prior to loading the clarified lysate and let it stand for approximately two to three hours. Then resuspend the pellet in the lysis buffer.Sonicate the cells on ice for 10 times 10-second intervals, pausing 30 seconds between pulses. Clarify the lysate by centrifugation at 3, 080 times g for 30 minutes at four degrees Celsius using a microcentrifuge. Prepare the clarified lysate with equal volumes of lysis buffer, then apply the prepped, clarified lysate to the column and collect the flow-through.Reapply the clarified lysate flow-through to the column and collect the secondary flow-through. Then wash the column with five milliliters of wash buffer one and collect the flow-through. Wash the column again with five milliliters of wash buffer two and collect the flow-through.Now apply two milliliters of elution buffer. Collect flow-through in two fractions of one milliliter each. During protein purification, inclusion of magnesium chloride in the purification buffers, a modification to the manufacturer's protocol, is essential for enzymatic activity.To qualitatively assess protein purification by SDS-PAGE, run 20 microliter aliquots of all column fractions on a 4%stacking, 10%running polyacrylamide gel for 60 minutes at 170 volts. Stain the gel with 0.1%Coomassie blue at room temperature for five hours, rocking gently on a benchtop rocker. Then destain the gel in 40%methanol-10%glacial acetic acid overnight at room temperature, rocking on the benchtop rocker.Dialyze the eluted fraction two against dialysis buffer at a 200:1 ratio using a one-milliliter dialysis device with a 20-kilodalton molecular weight cutoff overnight at four degrees Celsius. Determine the concentration of dialyzed protein sample by measuring absorbance at 280 nanometers and using the calculated molar extinction coefficient. Store 100-microliter aliquots of the dialyzed protein sample at minus 80 degrees Celsius until use.Prior to performing the reaction, prepare PEI cellulose thin layer chromatography plates by washing them in deionized water. Place the plates in a glass chamber with double-distilled water to a depth of approximately 0.5 centimeters. After allowing the water to migrate to the top of the plate, bring the plates out of the glass chamber and leave on a benchtop rack to dry overnight.Mark the dried plates two centimeters from one edge with a soft pencil to indicate where the samples will be applied for TLC. For two-microliter samples, apply samples no less than one centimeter apart. When planning experiments, always leave one spot on each plate unused to serve as a blank lane for sample quantification.To perform the enzyme activity assay, prepare individual reactions using gamma P32 ATP as described in the text protocol. Add the RSH after the other components have been mixed, as the addition of RSH to the nucleotide-containing mix initiates the enzymatic activity assay. To control for ATP hydrolysis from contaminating nuclease activity, assemble a 10-microliter reaction containing no protein and incubate it in parallel.Spot two-microliter samples at T equal zero and at the end of the experiment to ensure that ATP was not hydrolyzed in the absence of protein. Immediately upon addition of RSH, remove two microliters and spot it onto the labeled PEI-cellulose plate as the T equals zero minute sample. Incubate the reaction at 37 degrees Celsius, removing two-microliter aliquots at desired time points.After all aliquots have been collected, perform thin layer chromatography by filling the chromatography chamber with 1.5-molar monobasic potassium phosphate to a depth of 0.5 centimeters. Immerse the bottom edge of the plate in solvent and allow the solvent to migrate to the top of the plate over approximately 90 minutes. Remove the plate from the chromatography tank and place it on a benchtop drying rack to air dry overnight.After the plate is dry, wrap the plate in plastic film to avoid transfer of radioactive material to the imaging cassette and analyze by autoradiography. Expose the PEI-cellulose plate containing separated reactions to a phosphorimager cassette for four hours at room temperature. Following exposure, image the cassette on a phosphorimager.Using imaging software with a graphical user interface, draw regions of interest or ROIs by first selecting Draw a Rectangle, then use the mouse to draw rectangular ROIs around one entire lane and the ATP and guanosine-tetraphosphate spots contained within that lane. Use the Select, Copy, and Paste commands to draw identical ROIs within the other lanes to ensure that the ROIs are measuring signal within identical areas in each lane. Include ROIs from an unused lane to be used as blanks.Using the Analyze, Tools, ROI Manager, Add commands of the imaging software, select all of the ROIs drawn on the PEI-cellulose plate. Now use the Analyze, Set Measurements, Measure commands to quantify the signal intensity within each ROI and export the measurements as a spreadsheeet. In the spreadsheet, subtract blank ROI values from experimental signals.Converting the data to the percent guanosine-tetraphosphate synthetized is critical, because it ensures that data sets collected on different days with different batches of protein or different gamma P32 ATP are consistent and can be pooled for statistical rigor. This cartoon demonstrates how regions of interest are used to define a lane that contains the total radioactive signal in a sample and the component radioactive ATP and guanosine tetraphosphate regions of interest. ATP and guanosine tetraphosphate signals are normalized to the total signal rather than reporting the absolute values because pipetting error or decay of the radioactive substrate can affect the total signal in the sample but do not affect enzyme activity.Shown here is an actual TLC plate of a reaction carried out using purified C.difficile RSH. A control reaction containing no protein allows quantification of uncatalyzed ATP hydrolysis while a blank lane allows accurate signal quantification. In the ATP and guanosine-tetraphosphate spots, the enzyme transfers the radioactive phosphate from ATP substrate to GDP precursor, creating radioactive guanosine tetraphosphate.This confirms that the putative guanosine tetraphosphate synthetase from C.difficile is an active enzyme. By sampling the reaction at intervals, the progress can be observed. Here the raw signal is observed at each time point.ATP is decreasing and guanosine tetraphosphate is increasing. Shown here is the normalized data. The error bars are much smaller because normalization accounts for any pipetting error.While attempting this procedure, it's important to be careful not to scratch the resin on the TLC plate, as this can interfere with solvent migration. This is a very accessible technique with straightforward data analysis that can quickly provide robust quantification of enzyme activity. We've used it to confirm that Clostridium difficile synthesizes guanosine tetraphosphate, which has never previously been reported.Don't forget that working with radioactivity can be extremely hazardous and you must follow your institution's rules for the storage and use of radioactive materials while performing this procedure. This method can provide insight into guanosine tetraphosphate synthesis but it can also be applied to other phosphotransfer reactions, including protein kinase activity and cyclic diguanylate synthesis.

a-purification-vitro-activity-assay-for-pppgpp-synthetase-from

Research

JoVE Journal

Immunology and Infection

8.2K 조회수.  Old Dominion University. 이 방법은 효소 기판 특이성 및 반응 운동제를 포함하여 인전달 효소에 대한 주요 질문에 대답하는 데 도움이 될 수 있습니다. 이 기술의 주요 장점은 매우 일관된 여러 데이터 세트를 신속하게 수집하여 효소 활성의 통계적으로 강력한 정량화를 가능하게 한다는 것입니다. 이 방법의 시각적 데모는 TLC 플레이트에 대한 반응을 발견하고 반응에서 방사성 종을 정량화하는 것?...