This work was supported through grants from K12CA090628 (SSK), the National Comprehensive Cancer Network (SSK), the Mayo Clinic Center for Individualized Medicine (SSK), the Predolin Foundation (SSK), the Mayo Clinic Office of Translation to Practice (SSK), and the Mayo Clinic Medical Scientist Training Program Robert L. Howell Physician-Scientist Scholarship (RMS).

This protocol follows the guidelines of Mayo Clinic&#39;s Institutional Review Board (IRB) and Institutional Biosafety Committee (IBC).
1. CART19 cell production
<ol>
	<li>T cell isolation, stimulation, and ex-vivo culture
	<ol>
		<li>Carry out all cell culture work in a cell culture hood utilizing appropriate personal protective equipment. Harvest peripheral blood mononuclear cells (PBMCs) from de-identified normal donor blood cones collected during apheresis as these are known to be a viable source of PBMCs.13</li>
		<li>To isolate PBMCs, add 15 mL of a density gradient medium to a 50 mL density gradient separation tube. Dilute the donor blood with an equal volume of phosphate-buffered saline (PBS) containing 2% fetal bovine serum (FBS) to avoid cell trapping.
		<ol>
			<li>Add the diluted donor blood from the cone into the separation tube, careful not to disturb the interface between the blood and the density gradient medium. Centrifuge at 1,200 x g for 10 min at RT.</li>
			<li>Decant the supernatant into a new 50 mL conical, wash with PBS + 2% FBS by bringing up to 40 mL, centrifuge at 300 x g for 8 min at RT, aspirate supernatant, resuspend in 40 mL of buffer, and count cells.</li>
		</ol>
		</li>
		<li>Isolate T cells from PBMCs via a negative selection magnetic bead kit using a fully automated cell separator according to the manufacturer&#39;s protocol.</li>
		<li>To culture the isolated T cells, prepare T cell medium&#160;(TCM) that consists of 10% human AB serum (v/v), 1% penicillin-streptomycin-glutamine (v/v), and serum-free hematopoietic cell medium. Sterilize the medium&#160;by filtering through a 0.45 &#181;m sterile vacuum filter and then with a 0.22 &#181;m sterile vacuum filter.</li>
		<li>On Day 0 (the day of T cell stimulation), wash CD3/CD28 beads prior to stimulation of T cells. To wash, place the required volume of beads (use enough CD3/CD28 beads for a ratio of 3:1 beads:T cells;&#160;note the concentration of beads can be variable) in a sterile 1.5 mL microcentrifuge tube and resuspend in 1 mL of TCM.</li>
		<li>Place in contact with a magnet.</li>
		<li>After 1 min, aspirate the TCM and resuspend in 1 mL of fresh TCM to wash the beads.</li>
		<li>Repeat this procedure for a total of three washes.</li>
		<li>After the third wash, resuspend the beads in 1 mL of TCM.</li>
		<li>Count the T cells.</li>
		<li>Transfer beads to the T cells at a ratio of 3:1 beads:cells.</li>
		<li>Dilute cells to a final concentration of 1 x 106 cells/mL.</li>
		<li>Incubate at 37 &#176;C, 5% CO2 for 24 h.</li>
	</ol>
	</li>
	<li>T cell transfection and transduction
	<ol>
		<li>Carry out lentiviral work using BSL-2+ precautions, including cell culture hoods, personal protective equipment, and disinfection of used materials with bleach before disposal.</li>
		<li>Acquire a CART19 construct in a lentiviral vector. 
		NOTE: The CART19 construct utilized here was designed and then synthesized de novo using a commercially available protein synthesis vendor. The CAR construct was subsequently cloned into a third generation lentivirus under control of an EF-1&#945; promoter. The single chain variable region fragment is derived from the FMC63 clone and recognizes human CD19. The CAR19 construct possesses a second generation 4-1BB costimulatory domain and CD3&#950; stimulation (FMC63-41BBz).12</li>
		<li>Perform lentiviral production as previously described.12
		<ol>
			<li>In brief, to produce lentivirus, utilize 293T cells that have reached 70-90% confluency.</li>
			<li>Allow incubation for 30 min at room temperature of transfection reagents including 15 &#181;g of the lentiviral plasmid of interest, 18&#160;&#181;g of a gag/pol/tat/rev packaging vector, 7 &#181;g of a VSV-G envelope vector, 111 &#181;L of the pre-complexing reagent, 129 &#181;L of the transfection reagent, and 9.0 mL of the transfection medium&#160;before adding to the 293T cells. Then culture the transfected cells at 37 &#176;C, 5% CO2.</li>
			<li>Harvest,&#160;centrifuge (900 x g for 10 min), filter (0.45 &#181;M nylon filter), and concentrate supernatant at 24 and 48 h&#160;by ultracentrifugation at either 13,028 x g for 18 h&#160;or 112,700 x g for 2 h.</li>
			<li>Freeze at -80 &#176;C for future use.</li>
		</ol>
		</li>
		<li>On Day 1, gently resuspend T cells to break up the rosettes of T cells that had been stimulated at 1 x 106/mL on Day 0.</li>
		<li>Under appropriate BSL-2+ precautions for all lentiviral work, add fresh or frozen harvested virus to the stimulated T cells at a multiplicity of infection (MOI) of 3.0.</li>
	</ol>
	</li>
	<li>CAR-T cell expansion
	<ol>
		<li>During the phase of expansion, continue to incubate the transduced T cells at 37 &#176;C, 5% CO2. Count CAR-T cells on days 3 and 5, and add fresh, pre-warmed TCM to the culture to maintain a CAR-T cell concentration of 1 x 106/mL.</li>
		<li>Remove beads from the transduced T cells 6 days after stimulation (Day 6) using a magnet. Harvest, resuspend, and place T cells in 50 mL conical tubes in a magnet for 1 min. Then collect the supernatant (contains the CAR-T cells), and discard the beads.</li>
		<li>Place the collected CAR-T cells back in culture at a concentration of 1 x 106 cells/mL to resume expansion.</li>
		<li>On Day 6, assess surface expression of the CAR by flow cytometry. 
		NOTE: Several methods can be used to detect the surface expression of CAR, such as staining with a goat anti-mouse IgG (H+L) cross-adsorbed secondary antibody or by staining with a CD19 specific peptide, conjugated to a fluorochrome. Here, take an aliquot (about 100,000 T cells) from the culture and wash with flow buffer prepared with Dulbecco&#39;s phosphate-buffered saline, 2% fetal bovine serum, and 1% sodium azide. Stain the cells with the anti-CAR antibody and wash twice. Stain the cells with live/dead stain and CD3 monoclonal antibody (OKT3). Wash the cells and resuspend in flow buffer. Acquire on a cytometer to determine transduction efficiency.</li>
	</ol>
	</li>
	<li>CAR-T cell cryopreservation
	<ol>
		<li>To harvest and cryopreserve CAR-T cells 8 days after stimulation (Day 8 of T cell expansion), harvest the cells from culture.</li>
		<li>Spin down for 5 min at 300 x g.</li>
		<li>Resuspend in freezing medium at 10 million cells per mL per vial in freezing medium consisting of 10% dimethyl sulfoxide and 90% fetal bovine serum.</li>
		<li>Freeze in a freezing container to achieve a rate of cooling of -1 &#176;C/min&#160;in a -80 &#176;C freezer and then transfer to liquid nitrogen after 48 h.</li>
		<li>Prior to their use for in vitro or in vivo experiments, thaw CAR-T cells in warm TCM.</li>
		<li>Wash the cells to dilute and remove the dimethyl sulfoxide and resuspend to a concentration of 2 x 106 cells/mL in warm TCM. Rest overnight at 37 &#176;C, 5% CO2.</li>
	</ol>
	</li>
</ol>
2.&#160;GM-CSF k/o CART19 production
<ol>
	<li>To disrupt GM-CSF, utilize a guide RNA (gRNA) targeting exon 3 of human GM-CSF (CSF2) selected via screening gRNAs previously reported to have high efficiency for the CSF2 gene that encodes for the human cytokine GM-CSF.14 
	NOTE: A commercially synthesized research grade Cas9 third generation lentiviral construct containing this gRNA (under a U6 promoter) was used. The construct contains a puromycin resistance gene. The sequence of the gRNA is GACCTGCCTACAGACCCGCC.12</li>
	<li>To produce lentivirus, utilize 293T cells that have reached 70-90% confluency.</li>
	<li>Allow 15 &#181;g of the lentiviral plasmid of interest, 18 &#181;g of a gag/pol/tat/rev packaging vector, 7 &#181;g of a VSV-G envelope vector, 111 &#181;L of the pre-complexing reagent, 129 &#181;L of the transfection reagent, and 9.0 mL of the transfection medium&#160;to incubate for 30 min&#160;at room temperature.</li>
	<li>Add transfection reagents to the 293T cells. Then culture at 37 &#176;C, 5% CO2.</li>
	<li>Harvest, centrifuge (900 x g for 10 min), filter (0.45 &#181;M nylon filter) and concentrate supernatant at 24 and 48 h&#160;by ultracentrifugation at either 13,028 x g for 18 h&#160;or 112,700 x g for 2 h&#160;and freeze at -80 &#176;C for future use.</li>
	<li>On Day 1, gently resuspend the T cells to break up rosettes.</li>
	<li>In a BSL-2+ approved laboratory, add frozen or freshly harvested virus to the stimulated T cells to generate CAR-T cells. Transduce T cells with both the CAR19 lentivirus and GM-CSF targeting CRISPR lentivirus. Add CAR19 lentivirus at a MOI of 3. Since titration of the CRISPR lentivirus was not feasible, use virus particles generated from a 15 ug plasmid preparation to transduce 10&#160;x 106 T cells.</li>
	<li>See the remaining steps of T cell stimulation, expansion, and cryopreservation as discussed in step 1.</li>
	<li>For lentiCRISPR-edited T cells carrying puromycin resistance, treat cells with puromycin dihydrochloride at a concentration of 1 &#181;g of puromycin per 1 mL on Day 3 and Day 5 .</li>
</ol>
3.&#160;GM-CSF disruption efficiency and functional assessment of GM-CSF k/o CART19
<ol>
	<li>GM-CSF disruption efficiency: tracking of indels by decomposition (TIDE) sequencing and analysis
	<ol>
		<li>To sequence the exon of interest in GM-CSF gene, use the following primers. Use a forward primer sequence for GM-CSF (CSF2) of TGACTACAGAGAGGCACAGA, and a reverse primer sequence of TCACCTCTGACCTCATTAACC.</li>
		<li>Extract DNA from up to 5 million CAR-T cells with a genomic extraction kit. For the PCR reaction, use 25 &#181;L of a Taq mastermix per reaction with a final concentration of each primer in the PCR reaction of&#160;&#181;M, 0.1-0.5 &#181;g of template DNA, and a total volume of the PCR reaction brought up to 50 &#181;L with nuclease free water.</li>
		<li>See the PCR cycling conditions described in Table 1.</li>
		<li>Run PCR samples on a 1-2% agarose gel at 100 V for 30 min&#160;and extract using a gel extraction kit.</li>
		<li>Sequence PCR amplicons. Calculate allele modification frequency by uploading raw data into an appropriate TIDE software.15</li>
	</ol>
	</li>
	<li>GM-CSF production and functional assessment of GM-CSFk/o CART19
	<ol>
		<li>To determine the cytokine production of CAR-T cells, incubate wild type CART19 cells and GM-CSFk/o CART19 with the CD19 expressing acute lymphoblastic leukemia cell line NALM6 at a 1:5 ratio for 4 h&#160;at 37 &#176;C, 5% CO2 in the presence of monensin solution, anti-human CD49d, anti-human CD28, and anti-human CD107a.</li>
		<li>Harvest cells from culture for flow cytometry. Wash the cells with flow cytometry buffer. Stain the cells with a live/dead staining kit. Incubate in the dark at room temperature for 15 min. Fix the cells with a fixation medium and incubate in the dark at room temperature for 15 min.</li>
		<li>After washing, stain the cells intracellularly with permeabilization medium in combination with anti-human IFN&#947; monoclonal antibody, anti-human GM-CSF, anti-human MIP-1&#946;, anti-human IL-2, and anti-human CD3 and incubate in the dark at room temperature for 30 min. Wash and resuspend the samples. Acquire samples on a flow cytometer and analyzed for percentage of intracellular GM-CSF expression.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Kenderian, S. S., Ruella, M., Gill, S., Kalos, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+antigen+receptor+T-cell+therapy+to+target+hematologic+malignancies.">Chimeric antigen receptor T-cell therapy to target hematologic malignancies.</a> Cancer Research. 74 (22), 6383-6389 (2014).</li><li>Lim, W. A., June, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Principles+of+Engineering+Immune+Cells+to+Treat+Cancer.">The Principles of Engineering Immune Cells to Treat Cancer.</a> Cell. 168 (4), 724-740 (2017).</li><li>Neelapu, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Axicabtagene+Ciloleucel+CAR+T-Cell+Therapy+in+Refractory+Large+B-Cell+Lymphoma.">Axicabtagene Ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma.</a> The New England Journal of Medicine. 377 (26), 2531-2544 (2017).</li><li>Maude, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tisagenlecleucel+in+Children+and+Young+Adults+with+B-Cell+Lymphoblastic+Leukemia.">Tisagenlecleucel in Children and Young Adults with B-Cell Lymphoblastic Leukemia.</a> The New England Journal of Medicine. 378 (5), 439-448 (2018).</li><li>Schuster, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+Antigen+Receptor+T+Cells+in+Refractory+B-Cell+Lymphomas.">Chimeric Antigen Receptor T Cells in Refractory B-Cell Lymphomas.</a> The New England Journal of Medicine. 377 (26), 2545-2554 (2017).</li><li>Grupp, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+antigen+receptor-modified+T+cells+for+acute+lymphoid+leukemia.">Chimeric antigen receptor-modified T cells for acute lymphoid leukemia.</a> The New England Journal of Medicine. 368 (16), 1509-1518 (2013).</li><li>Porter, D. L., Levine, B. L., Kalos, M., Bagg, A., June, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+antigen+receptor-modified+T+cells+in+chronic+lymphoid+leukemia.">Chimeric antigen receptor-modified T cells in chronic lymphoid leukemia.</a> The New England Journal of Medicine. 365 (8), 725-733 (2011).</li><li>Gust, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endothelial+Activation+and+Blood-Brain+Barrier+Disruption+in+Neurotoxicity+after+Adoptive+Immunotherapy+with+CD19+CAR-T+Cells.">Endothelial Activation and Blood-Brain Barrier Disruption in Neurotoxicity after Adoptive Immunotherapy with CD19 CAR-T Cells.</a> Cancer Discovery. 7 (12), 1404-1419 (2017).</li><li>Fitzgerald, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytokine+Release+Syndrome+After+Chimeric+Antigen+Receptor+T+Cell+Therapy+for+Acute+Lymphoblastic+Leukemia.">Cytokine Release Syndrome After Chimeric Antigen Receptor T Cell Therapy for Acute Lymphoblastic Leukemia.</a> Critical Care Medicine. 45 (2), e124-e131 (2017).</li><li>Liu, X., Zhao, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9+genome+editing:+Fueling+the+revolution+in+cancer+immunotherapy.">CRISPR/Cas9 genome editing: Fueling the revolution in cancer immunotherapy.</a> Current Research in Translational Medicine. 66 (2), 39-42 (2018).</li><li>Ren, J., Zhao, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advancing+chimeric+antigen+receptor+T+cell+therapy+with+CRISPR/Cas9.">Advancing chimeric antigen receptor T cell therapy with CRISPR/Cas9.</a> Protein Cell. 8 (9), 634-643 (2017).</li><li>Sterner, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GM-CSF+inhibition+reduces+cytokine+release+syndrome+and+neuroinflammation+but+enhances+CAR-T+cell+function+in+xenografts.">GM-CSF inhibition reduces cytokine release syndrome and neuroinflammation but enhances CAR-T cell function in xenografts.</a> Blood. , (2018).</li><li>Dietz, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+source+of+viable+peripheral+blood+mononuclear+cells+from+leukoreduction+system+chambers.">A novel source of viable peripheral blood mononuclear cells from leukoreduction system chambers.</a> Transfusion. 46 (12), 2083-2089 (2006).</li><li>Sanjana, N. E., Shalem, O., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+vectors+and+genome-wide+libraries+for+CRISPR+screening.">Improved vectors and genome-wide libraries for CRISPR screening.</a> Nature Methods. 11 (8), 783-784 (2014).</li><li>Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Easy+quantitative+assessment+of+genome+editing+by+sequence+trace+decomposition.">Easy quantitative assessment of genome editing by sequence trace decomposition.</a> Nucleic Acids Research. 42 (22), e168 (2014).</li></ol>

SSK is an inventor on patents in the field of CAR T-cell therapy that are licensed to Novartis (under an agreement between Mayo Clinic, University of Pennsylvania, and Novartis). These studies were funded in part by a grant from Humanigen (SSK). RMS, MJC, RS, and SSK are inventors on patents related to this work. The laboratory (SSK) receives funding from Tolero, Humanigen, Kite, Lentigen, Morphosys, and Actinium.

In this report, we describe a methodology to utilize CRISPR/Cas9 technology to induce secondary modifications in CAR-T cells. Specifically, this&#160;is demonstrated using lentiviral transduction with a viral vector that contains gRNA targeting the gene of interest and Cas9 to generate GM-CSFk/o CART19 cells. We had previously shown that GM-CSF neutralization ameliorates CRS and NT in a xenograft model.12&#160;As previously described, GM-CSFk/o CAR-T cells allow for the inhib...

Chimeric antigen receptor T (CAR-T) cell therapy exhibits great promise in the treatment of cancer.1,2&#160;Two CAR-T cell therapies targeting CD19 (CART19) were recently approved in the United Stated and in Europe for the use in B cell malignancies after demonstrating striking results in multicenter clinical trials.3,4,5&#160;Barriers to more widespread use of CAR-T cells are limited activity in solid tumors and associated toxicities including cytokine release syndrome (CRS) and neurotoxicity (NT).3,5,6,7,8,9&#160;To enhance the therapeutic index of CAR-T cell therapy, genome engineering tools such as zinc finger nucleases, TALENs, and CRISPR are employed to further modify CAR-T cells in an attempt to generate less toxic or more effective CAR-T cells.10,11
In this article, we describe a method to generate CRISPR/Cas9 edited CAR-T cells. The specific goal of this method is to genetically modify CAR-T cells during CAR-T cell manufacturing via CRISPR/Cas9 to generate less toxic or more effective CAR-T cells. The rationale for developing this methodology is built on lessons learned from clinical experience of CAR-T cell therapy, which indicates an urgent need for novel strategies to increase the therapeutic window of CAR-T cell therapy and to extend the application into other tumors and is supported by the recent advances in synthetic biology allowing multiple modifications of CAR-T cells that have started to enter the clinic. While several genome engineering tools are being developed and applied in different settings, such as zinc finger nucleases, TALENs, and CRISPR, our methodology describes CRISPR/Cas9 modification of CAR-T cells.10,11&#160;CRISPR/Cas9 is an RNA-based bacterial defense mechanism that is designed to eliminate foreign DNA. CRISPR relies on endonucleases to cleave a target sequence identified through a guide RNA (gRNA). CRISPR editing of CAR-T cells offers several advantages over other genome engineering tools. These include precision of the gRNA sequence, simplicity to design a gRNA targeting the gene of interest, high gene editing efficiency, and the ability to target multiple genes since multiple gRNAs can be used at the same time.
Specifically in the methods described here, we used a lentivirus encoding CRISPR guide RNA and Cas9 to disrupt a gene during CAR transduction of T cells. In selecting an appropriate technique to edit CAR-T cells, we suggest the technique described here is an efficient mechanism to generate research grade CAR-T cells, but because the long term effect of permanent integration of Cas9 into the genome is unknown, we propose this methodology to develop proof of concept research grade CAR-T cells but not for producing good manufacturing practice grade CAR-T cells.
In particular, here we describe the generation of granulocyte macrophage colony stimulating factor (GM-CSF) knockout CAR-T cells targeting human CD19. These CAR-T cells were generated by transduction with lentiviral particles encoding a guide RNA specific to GM-CSF (gene name CSF2) and Cas9. We previously found that GM-CSF neutralization ameliorates CRS and NT in a xenograft model.12&#160;GM-CSFk/o CAR-T cells allow for the inhibition of GM-CSF during the manufacturing process, effectively reducing production of GM-CSF while enhancing CAR-T cell anti-tumor activity and survival in vivo compared to wildtype CAR-T cells.12&#160;Thus, here we provide a methodology to generate CRISPR/Cas9 edited CAR-T cells.

<table border="0" cellpadding="0" cellspacing="0" style="width:1377px;" width="1377">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:557px;">CD3 Monoclonal Antibody (OKT3), PE, eBioscience</td>
			<td style="width:217px;">Invitrogen</td>
			<td style="width:123px;">12-0037-42</td>
			<td style="width:480px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD3 Monoclonal Antibody (UCHT1), APC, eBioscience</td>
			<td>Invitrogen</td>
			<td style="width:123px;">17-0038-42</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Choice Taq Blue Mastermix</td>
			<td>Denville Scientific</td>
			<td style="width:123px;">C775Y51</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CTS (Cell Therapy Systems) Dynabeads CD3/CD28</td>
			<td>Gibco</td>
			<td style="width:123px;">40203D</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:557px;">CytoFLEX System B4-R2-V2</td>
			<td style="width:217px;">Beckman Coulter</td>
			<td style="width:123px;">C10343</td>
			<td>flow cytometer</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:557px;">dimethyl sulfoxide</td>
			<td style="width:217px;">Millipore Sigma</td>
			<td style="width:123px;">D2650-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:557px;">Dulbecco&#39;s Phosphate-Buffered Saline</td>
			<td style="width:217px;">Gibco</td>
			<td style="width:123px;">14190-144&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dynabeads MPC-S (Magnetic Particle Concentrator)</td>
			<td>Applied Biosystems</td>
			<td style="width:123px;">A13346</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Easy 50 EasySep Magnet</td>
			<td>STEMCELL Technologies</td>
			<td style="width:123px;">18002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EasySep Human T Cell Isolation Kit&#160;</td>
			<td>STEMCELL Technologies</td>
			<td style="width:123px;">17951</td>
			<td>negative selection magnetic beads; 17951RF includes tips and buffer</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:557px;">Fetal bovine serum</td>
			<td style="width:217px;">Millipore Sigma</td>
			<td style="width:123px;">F8067</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FITC Mouse Anti-Human CD107a&#160;</td>
			<td>BD Pharmingen</td>
			<td style="width:123px;">555800</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:557px;">Fixation Medium (Medium A)</td>
			<td style="width:217px;">Invitrogen</td>
			<td style="width:123px;">GAS001S100</td>
			<td></td>
		</tr>
		<tr height="104">
			<td height="104" style="height:104px;width:557px;">GenCRISPR gRNA Construct: Name: CSF2 
			CRISPR guide RNA 1; Species: Human, Vector: 
			pLentiCRISPR v2; Resistance: Ampicillin; Copy number: 
			High; Plasmid preparation: Standard delivery: 4 &#956;g (Free 
			of charge)</td>
			<td style="width:217px;">GenScript</td>
			<td style="width:123px;">N/A</td>
			<td>custom order</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647</td>
			<td>Invitrogen</td>
			<td style="width:123px;">A-21235</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">https://tide.nki.nl.</td>
			<td style="width:217px;">Desktop Genetics</td>
			<td style="width:123px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Human AB Serum; Male Donors; type AB; US</td>
			<td>Corning</td>
			<td style="width:123px;">35-060-CI</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">IFN gamma Monoclonal Antibody (4S.B3), APC-eFluor 780, eBioscience</td>
			<td>Invitrogen</td>
			<td style="width:123px;">47-7319-42</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Lipofectamine 3000 Transfection Reagent</td>
			<td>Invitrogen</td>
			<td style="width:123px;">L3000075</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LIVE/DEAD Fixable Aqua Dead Cell Stain Kit, for 405 nm excitation</td>
			<td>Invitrogen</td>
			<td style="width:123px;">L34966</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Lymphoprep</td>
			<td>STEMCELL Technologies</td>
			<td style="width:123px;">07851</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Monensin Solution, 1000X</td>
			<td>BioLegend</td>
			<td style="width:123px;">420701</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mouse Anti-Human CD28 Clone CD28.2</td>
			<td>BD Pharmingen</td>
			<td style="width:123px;">559770</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mouse Anti-Human CD49d Clone 9F10</td>
			<td>BD Pharmingen</td>
			<td style="width:123px;">561892</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mouse Anti-Human MIP-1&#946; PE-Cy7</td>
			<td>BD Pharmingen</td>
			<td style="width:123px;">560687</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:557px;">Mr. Frosty Freezing Container</td>
			<td style="width:217px;">Thermo Scientific</td>
			<td style="width:123px;">5100-0001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NALM6, clone G5&#160;</td>
			<td>ATCC</td>
			<td style="width:123px;">CRL-3273</td>
			<td>acute lymphoblastic leukemia cell line</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nuclease Free Water</td>
			<td>Promega</td>
			<td style="width:123px;">P119C</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Olympus Vacuum Filter Systems, 500 mL, PES Membrane, 0.22uM, sterile</td>
			<td>Genesee Scientific</td>
			<td style="width:123px;">25-227</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Olympus Vacuum Filter Systems, 500 mL, PES Membrane, 0.45uM, sterile</td>
			<td>Genesee Scientific</td>
			<td style="width:123px;">25-228</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:557px;">Opti-MEM I Reduced-Serum Medium (1X), Liquid</td>
			<td style="width:217px;">Gibco</td>
			<td style="width:123px;">31985-070</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PE-CF594 Mouse Anti-Human IL-2</td>
			<td>BD Horizon</td>
			<td style="width:123px;">562384</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Penicillin-Streptomycin-Glutamine (100X), Liquid</td>
			<td>Gibco</td>
			<td style="width:123px;">10378-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:557px;">Permeabilization Medium (Medium B)</td>
			<td style="width:217px;">Invitrogen</td>
			<td style="width:123px;">GAS002S100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PureLink Genomic DNA Mini Kit</td>
			<td>Invitrogen</td>
			<td style="width:123px;">K182001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Puromycin Dihydrochloride</td>
			<td>MP Biomedicals, Inc.</td>
			<td style="width:123px;">0210055210</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAquick Gel Extraction Kit</td>
			<td>QIAGEN</td>
			<td style="width:123px;">28704</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rat Anti-Human GM-CSF BV421</td>
			<td>BD Horizon</td>
			<td style="width:123px;">562930</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RoboSep-S</td>
			<td style="width:217px;">STEMCELL Technologies</td>
			<td style="width:123px;">21000</td>
			<td>Fully Automated Cell Separator</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SepMate-50 (IVD)</td>
			<td>STEMCELL Technologies</td>
			<td style="width:123px;">85450</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:557px;">Sodium Azide, 5% (w/v)</td>
			<td style="width:217px;">Ricca Chemical</td>
			<td style="width:123px;">7144.8-16</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">X-VIVO 15 Serum-free Hematopoietic Cell Medium</td>
			<td>Lonza</td>
			<td style="width:123px;">04-418Q</td>
			<td></td>
		</tr>
	</tbody>
</table>

using crispr/cas9 to knock out gm-csf in car-t cells

Chimeric antigen receptor T (CAR-T) cell therapy is a cutting edge and potentially revolutionary new treatment option for cancer. However, there are significant limitations to its widespread use in the treatment of cancer. These limitations include the development of unique toxicities such as cytokine release syndrome (CRS) and neurotoxicity (NT) and limited expansion, effector functions, and anti-tumor activity in solid tumors. One strategy to enhance CAR-T efficacy and/or control toxicities of CAR-T cells is to edit the genome of the CAR-T cells themselves during CAR-T cell manufacturing. Here, we describe the use of CRISPR/Cas9 gene editing in CAR-T cells via transduction with a lentiviral construct containing a guide RNA to granulocyte macrophage colony-stimulating factor (GM-CSF) and Cas9. As an example, we describe CRISPR/Cas9 mediated knockout of GM-CSF. We have shown that these GM-CSFk/o CAR-T cells effectively produce less GM-CSF while maintaining critical T cell function and result in enhanced anti-tumor activity in vivo compared to wild type CAR-T cells.

Figure 1&#160;shows reduction of GM-CSF in GM-CSFk/o CART19 cells. To verify that the genome of the T cells was altered to knockout GM-CSF, TIDE sequencing was used in the GM-CSFk/o CART19 cells (Figure 1A). CAR-T cell surface staining verifies that the T cells successfully express the CAR surface receptor in vitro by gating on live CD3+ cells (Figure 1B). Intracellular staining...

Watch this Scientific Journal Video about Using CRISPR/Cas9 to Knock Out GM-CSF in CAR-T Cells at JoVE.com

Using CRISPR/Cas9 to Knock Out GM-CSF in CAR-T Cells

Here, we present a protocol to genetically edit CAR-T cells via a CRISPR/Cas9 system.

Chimeric antigen receptor T (CAR-T) cell therapy is a cutting edge and potentially revolutionary new treatment option for cancer. However, there are ...

using-crisprcas9-to-knock-out-gm-csf-in-car-t-cells

Research

JoVE Journal

Cancer Research

11.0K Views.  Mayo Clinic College of Medicine and Science. Here, we present a protocol to genetically edit CAR-T cells via a CRISPR/Cas9 system.

Video: Using CRISPR/Cas9 to Knock Out GM-CSF in CAR-T Cells

The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics

Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the context of a whole organism. Sophisticated techniques to generate genetic mosaics facilitate induction of visually marked, genetically defined clones surrounded by normal tissue. The clones can be analyzed through diverse molecular, cellular and omics approaches. This study describes how to generate fluorescently labeled clonal tumors of varying malignancy in the eye/antennal imaginal discs (EAD) of Drosophila larvae using the Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. It describes procedures how to recover the mosaic EAD and brain from the larvae and how to process them for simultaneous imaging of fluorescent transgenic reporters and antibody staining. To facilitate molecular characterization of the mosaic tissue, we describe a protocol for isolation of total RNA from the EAD. The dissection procedure is suitable to recover EAD and brains from any larval stage. The fixation and staining protocol for imaginal discs works with a number of transgenic reporters and antibodies that recognize Drosophila proteins. The protocol for RNA isolation can be applied to various larval organs, whole larvae, and adult flies. Total RNA can be used for profiling of gene expression changes using candidate or genome-wide approaches. Finally, we detail a method for quantifying invasiveness of the clonal tumors. Although this method has limited use, its underlying concept is broadly applicable to other quantitative studies where cognitive bias must be avoided.

The Drosophila Imaginal Disc Tumor Model: Visualization and Quantification of Gene Expression and Tumor Invasiveness Using Genetic Mosaics

This protocol demonstrates how to generate fluorescently marked, genetically defined clonal tumors in the Drosophila eye/antennal imaginal discs (EAD). It describes how to dissect the EAD and brain from the third instar larvae and how to process them to visualize and quantify gene expression changes and tumor invasiveness.

Drosophila melanogaster has emerged as a powerful experimental system for functional and mechanistic studies of tumor development and progression in the ...

Using RNA-sequencing to Detect Novel Splice Variants Related to Drug Resistance in In Vitro Cancer Models

Drug resistance remains a major problem in the treatment of cancer for both hematological malignancies and solid tumors. Intrinsic or acquired resistance can be caused by a range of mechanisms, including increased drug elimination, decreased drug uptake, drug inactivation and alterations of drug targets. Recent data showed that other than by well-known genetic (mutation, amplification) and epigenetic (DNA hypermethylation, histone post-translational modification) modifications, drug resistance mechanisms might also be regulated by splicing aberrations. This is a rapidly growing field of investigation that deserves future attention in order to plan more effective therapeutic approaches. The protocol described in this paper is aimed at investigating the impact of aberrant splicing on drug resistance in solid tumors and hematological malignancies. To this goal, we analyzed the transcriptomic profiles of several in vitro models through RNA-seq and established a qRT-PCR based method to validate candidate genes. In particular, we evaluated the differential splicing of DDX5 and PKM transcripts. The aberrant splicing detected by the computational tool MATS was validated in leukemic cells, showing that different DDX5 splice variants are expressed in the parental vs. resistant cells. In these cells, we also observed a higher PKM2/PKM1 ratio, which was not detected in the Panc-1 gemcitabine-resistant counterpart compared to parental Panc-1 cells, suggesting a different mechanism of drug-resistance induced by gemcitabine exposure.

Using RNA-sequencing to Detect Novel Splice Variants Related to Drug Resistance in In Vitro Cancer Models

Here we describe a protocol aimed at investigating the impact of aberrant splicing on drug resistance in solid tumors and hematological malignancies. To this goal, we analyzed the transcriptomic profiles of parental and resistant in vitro models through RNA-seq and established a qRT-PCR based method to validate candidate genes.

Drug resistance remains a major problem in the treatment of cancer for both hematological malignancies and solid tumors. Intrinsic or acquired resistance ...

Looking for Driver Pathways of Acquired Resistance to Targeted Therapy: Drug Resistant Subclone Generation and Sensitivity Restoring by Gene Knock-down

The past two decades have seen a shift from cytotoxic drugs to targeted therapy in medical oncology. Although targeted therapeutic agents have shown more impressive clinical efficacy and minimized adverse effects than traditional treatments, drug resistance has become the main limitation to their benefits. Several preclinical in vitro/in vivo models of acquired resistance to targeted agents in clinical practice have been developed mainly by using two strategies: i) genetic manipulation for modeling genotypes of acquired resistance, and ii) in vitro/in vivo selection of resistant models. In the present work, we propose a unifying framework, for investigating the underlying mechanisms responsible for acquired resistance to targeted therapeutic agents, starting from the generation of drug-resistant cellular subclones to the description of silencing procedures used for restoring the sensitivity to the inhibitor. This simple time- and cost-effective approach is widely applicable, and could be easily extended to investigate resistance mechanisms to other targeted therapeutic drugs in different tumor histotypes.

This is a time- and cost-effective in vitro protocol investigating the mechanisms of acquired resistance to targeted therapeutic agents, which is a highly unmet medical need in cancer management.

The past two decades have seen a shift from cytotoxic drugs to targeted therapy in medical oncology. Although targeted therapeutic agents have shown more ...

Using CRISPR/Cas9 Gene Editing to Investigate the Oncogenic Activity of Mutant Calreticulin in Cytokine Dependent Hematopoietic Cells

Clustered regularly interspaced short palindromic repeats (CRISPR) is an adaptive immunity system in prokaryotes that has been repurposed by scientists to generate RNA-guided nucleases, such as CRISPR-associated (Cas) 9 for site-specific eukaryotic genome editing. Genome engineering by Cas9 is used to efficiently, easily and robustly modify endogenous genes in many biomedically-relevant mammalian cell lines and organisms. Here we show an example of how to utilize the CRISPR/Cas9 methodology to understand the biological function of specific genetic mutations. We model calreticulin (CALR) mutations in murine interleukin-3 (mIL-3) dependent pro-B (Ba/F3) cells by delivery of single guide RNAs (sgRNAs) targeting the endogenous Calr locus in the specific region where insertion and/or deletion (indel) CALR mutations occur in patients with myeloproliferative neoplasms (MPN), a type of blood cancer. The sgRNAs create double strand breaks (DSBs) in the targeted region that are repaired by non-homologous end joining (NHEJ) to give indels of various sizes. We then employ the standard Ba/F3 cellular transformation assay to understand the effect of physiological level expression of Calr mutations on hematopoietic cellular transformation. This approach can be applied to other genes to study their biological function in various mammalian cell lines.

Targeted gene editing using CRISPR/Cas9 has greatly facilitated the understanding of the biological functions of genes. Here, we utilize the CRISPR/Cas9 methodology to model calreticulin mutations in cytokine-dependent hematopoietic cells in order to study their oncogenic activity.

Clustered regularly interspaced short palindromic repeats (CRISPR) is an adaptive immunity system in prokaryotes that has been repurposed by scientists to ...

A Syngeneic Mouse B-Cell Lymphoma Model for Pre-Clinical Evaluation of CD19 CAR T Cells

The astonishing clinical success of CD19 chimeric antigen receptor (CAR) T-cell therapy has led to the approval of two second generation chimeric antigen receptors (CARs) for acute lymphoblastic leukemia (ALL) andnon-Hodgkin lymphoma (NHL). The focus of the field is now on emulating these successes in other hematological malignancies where less impressive complete response rates are observed. Further engineering of CAR T cells or co-administration of other treatment modalities may successfully overcome obstacles to successful therapy in other cancer settings.
We therefore present a model in which others can conduct pre-clinical testing of CD19 CAR T cells. Results in this well tested B-cell lymphoma model are likely to be informative CAR T-cell therapy in general.
This protocol allows the reproducible production of mouse CAR T cells through calcium phosphate transfection of Plat-E producer cells with MP71 retroviral constructs and pCL-Eco packaging plasmid followed by collection of secreted retroviral particles and transduction using recombinant human fibronectin fragment and centrifugation. Validation of retroviral transduction, and confirmation of the ability of CAR T cells to kill target lymphoma cells ex vivo, through the use of flow cytometry, luminometry and enzyme-linked immunosorbent assay (ELISA), is also described.
Protocols for testing CAR T cells in vivo in lymphoreplete and lymphodepleted syngeneic mice, bearing established, systemic lymphoma are described. Anti-cancer activity is monitored by in vivo bioluminescence and disease progression. We show typical results of eradication of established B-cell lymphoma when utilizing 1st or 2nd generation CARs in combination with lymphodepleting pre-conditioning and a minority of mice achieving long term remissions when utilizing CAR T cells expressing IL-12 in lymphoreplete mice.
These protocols can be used to evaluate CD19 CAR T cells with different additional modification, combinations of CAR T cells and other therapeutic agents or adapted for the use of CAR T cells against different target antigens.

Here, we present a protocol for the production and pre-clinical testing of murine CD19 CAR T cells by retroviral transduction and utilization as a therapy against established syngeneic A20 B-cell lymphoma in BALB/c mice with or without lymphodepleting pre-conditioning.

The astonishing clinical success of CD19 chimeric antigen receptor (CAR) T-cell therapy has led to the approval of two second generation chimeric antigen ...

Investigation of Genetic Dependencies Using CRISPR-Cas9-based Competition Assays

Gene perturbation studies have been extensively used to investigate the role of individual genes in AML pathogenesis. For achieving complete gene disruption, many of these studies have made use of complex gene knockout models. While these studies with knockout mice offer an elegant and time-tested system for investigating genotype-to-phenotype relationships, a rapid and scalable method for assessing candidate genes that play a role in AML cell proliferation or survival in AML models will help accelerate the parallel interrogation of multiple candidate genes. Recent advances in genome-editing technologies have dramatically enhanced our ability to perform genetic perturbations at an unprecedented scale. One such system of genome editing is the CRISPR-Cas9-based method that can be used to make rapid and efficacious alterations in the target cell genome. The ease and scalability of CRISPR/Cas9-mediated gene-deletion makes it one of the most attractive techniques for the interrogation of a large number of genes in phenotypic assays. Here, we present a simple assay using CRISPR/Cas9 mediated gene-disruption combined with high-throughput flow-cytometry-based competition assays to investigate the role of genes that may play an important role in the proliferation or survival of human and murine AML cell lines.

This manuscript describes a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) CRISPR-Cas9-based method for simple and expeditious investigation of the role of multiple candidate genes in Acute Myeloid Leukemia (AML) cell proliferation in parallel. This technique is scalable and can be applied in other cancer cell lines as well.

Gene perturbation studies have been extensively used to investigate the role of individual genes in AML pathogenesis. For achieving complete gene ...

A Spheroid Killing Assay by CAR T Cells

Immunotherapy has become a field of growing interest in the fight against cancer otherwise untreatable. Among all immunotherapeutic methods, chimeric antigen receptor (CAR) redirected T cells obtained the most spectacular results, in particular with pediatric B-acute lymphoblastic leukemia (B-ALL). Classical validation methods of CAR T cells rely on the use of specificity and functionality assays of the CAR T cells against target cells in suspension and in xenograft models. Unfortunately, observations made in vitro are often decoupled from results obtained in vivo and a lot of effort and animals could be spared by adding another step: the use of 3D culture. The production of spheroids out of potential target cells that mimic the 3D structure of the tumor cells when they are engrafted into the animal model represents an ideal alternative. Here, we report an affordable, reliable and easy method to produce spheroids from a transduced colorectal cell line as a validation tool for adoptive cell therapy (exemplified here by CD19 CAR T cells). This method is coupled with an advanced live imaging system that can follow spheroid growth, effector cells cytotoxicity and tumor cell apoptosis.

This protocol is designed to assess immunotherapeutic redirected T-cell (CAR T-cell) cytotoxicity against 3D structured cancerous cells (spheroids) in real time.

Immunotherapy has become a field of growing interest in the fight against cancer otherwise untreatable. Among all immunotherapeutic methods, chimeric ...

Manufacturing Chimeric Antigen Receptor (CAR) T Cells for Adoptive Immunotherapy

Adoptive immunotherapy holds promise for the treatment of cancer and infectious disease. We describe a simple approach to transduce primary human T cells with chimeric antigen receptor (CAR) and expand their progeny ex vivo. We include assays to measure CAR expression as well as differentiation, proliferative capacity and cytolytic activity. We describe assays to measure effector cytokine production and inflammatory cytokine secretion in CAR T cells. Our approach provides a reliable and comprehensive method to culture CAR T cells for preclinical models of adoptive immunotherapy.

Manufacturing Chimeric Antigen Receptor CAR T Cells for Adoptive Immunotherapy

We describe an approach to reliably generate chimeric antigen receptor (CAR) T cells and test their differentiation and function in vitro and in vivo.

Adoptive immunotherapy holds promise for the treatment of cancer and infectious disease. We describe a simple approach to transduce primary human T cells ...

In Vitro Evaluation of Oncogenic Transformation in Human Mammary Epithelial Cells

Tumorigenesis is a multi-step process in which cells acquire capabilities&#160;that allow their growth, survival, and dissemination under hostile conditions. Different tests seek to identify and quantify these hallmarks of cancerous cells; however, they often focus on a single aspect of cellular transformation and, in fact, multiple tests are required for their proper characterization. The purpose of this work is to provide researchers with a set of tools to assess cellular transformation in vitro from a broad perspective, thereby making it possible to draw sound conclusions.
A sustained proliferative signaling activation is the major feature of tumoral tissues and can be easily monitored under in vitro conditions by calculating the number of population doublings achieved over time. Besides, the growth of cells in 3D cultures allows their interaction with surrounding cells, resembling what occurs in vivo. This enables the evaluation of cellular aggregation and, together with immunofluorescent labeling of distinctive cellular markers, to obtain information on another relevant feature of tumoral transformation: the loss of proper organization. Another remarkable characteristic of transformed cells is their capacity to grow without attachment to other cells and to the extracellular matrix, which can be evaluated with the anchorage assay.
Detailed experimental procedures to evaluate cell growth rate, to perform immunofluorescent labeling of cell lineage markers in 3D cultures, and to test anchorage-independent cell growth in soft agar are provided. These methodologies are optimized for Breast Primary Epithelial Cells (BPEC) due to its relevance in breast cancer; however, procedures can be applied to other cell types after some adjustments.

This protocol provides experimental in vitro tools to evaluate the transformation of human mammary cells. Detailed steps to follow-up cell proliferation rate, anchorage-independent growth capacity, and distribution of cell lineages in 3D cultures with basement membrane matrix are described.

Tumorigenesis is a multi-step process in which cells acquire capabilities&#160;that allow their growth, survival, and dissemination under hostile ...

Using Computer-based Image Analysis to Improve Quantification of Lung Metastasis in the 4T1 Breast Cancer Model

Breast cancer is a devastating malignancy, accounting for 40,000 female deaths and 30% of new female cancer diagnoses in the United States in 2019 alone. The leading cause of breast cancer related deaths is the metastatic burden. Therefore, preclinical models for breast cancer need to analyze metastatic burden to be clinically relevant. The 4T1 breast cancer model provides a spontaneously-metastasizing, quantifiable mouse model for stage IV human breast cancer. However, most 4T1 protocols quantify the metastatic burden by manually counting stained colonies on tissue culture plates. While this is sufficient for tissues with lower metastatic burden, human error in manual counting causes inconsistent and variable results when plates are confluent and difficult to count. This method offers a computer-based solution to human counting error. Here, we evaluate the protocol using the lung, a highly metastatic tissue in the 4T1 model. Images of methylene blue-stained plates are acquired and uploaded for analysis in Fiji-ImageJ. Fiji-ImageJ then determines the percentage of the selected area of the image that is blue, representing the percentage of the plate with metastatic burden. This computer-based approach offers more consistent and expeditious results than manual counting or histopathological evaluation for highly metastatic tissues. The consistency of Fiji-ImageJ results depends on the quality of the image. Slight variations in results between images can occur, thus it is recommended that multiple images are taken and results averaged. Despite its minimal limitations, this method is an improvement to quantifying metastatic burden in the lung by offering consistent and rapid results.

We describe a more consistent and expeditious method to quantify lung metastasis in the 4T1 breast cancer model by using Fiji-ImageJ.

Breast cancer is a devastating malignancy, accounting for 40,000 female deaths and 30% of new female cancer diagnoses in the United States in 2019 alone. ...