This work was supported by the National Institutes of Health (NIH) Grants: RO1 EY012085 (to J.X.J) and F32DK134051 (to F.M.A), and Welch Foundation grant: AQ-1507 (to J.X.J.). The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. The figures were partially created with Biorender.com.

This study was conducted in compliance with the Animal Welfare Act and the Implementing Animal Welfare Regulations in accordance with the principles of the Guide for the Care and Use of Laboratory Animals. All animal procedures were approved by the Institutional Animal Care and Use Committee at the University of Texas Health Science Center at San Antonio. For an overview of the protocol, see Figure 1; see the Table of Materials for details on all materials, reagents, and instruments used in this protocol.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/65727/65727fig01.jpg" /> 
Figure 1: Experimental outline. 1. The first step of the protocol is the determination of a specific target protein(s), the identification of the associated gene sequence(s), and DNA fragment generation. 2. Cloning of the gene sequence(s) into a retroviral vector by initial cloning into an adaptor vector, 3. followed by a viral vector. 4. Preparation of high-titer viral particles using packaging cells to harvest and concentrate. 5. The final step, and the focus of this protocol, is the chicken lens microinjection of the RCAS(A) viral particles into the lens lumen. <a href="https://www.jove.com/files/ftp_upload/65727/65727fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
1. Preparation of high-titer recombinant retroviruses
<ol>
	<li>Polymerase chain reaction (PCR) to make target protein DNA fragments 
	NOTE: This section aims to amplify the DNA sequence corresponding to the target lens protein. For more detail, see7,8.
	<ol>
		<li>Design primers for PCR, corresponding to the protein of interest, to make DNA fragments with their carboxyl termini in-frame with or without a FLAG epitope sequence (5&#39;-GACTACAAGGACGACGATGACAAG-3&#39;), a stop codon, and a restriction enzyme site (i.e., EcoRI) present inside the polylinker region of CLa12NCO)) according to the specifications noted in previously published protocols, with sequences for adequate restriction enzymes1,7,8,10,11.</li>
		<li>Perform the PCR reaction10. Combine 100 pmol of sense and antisense of the designed primers with 0.5 &#181;g of connexin cDNA (such as Cx50, Cx43, or chimeric Cx50*43L combinations), to the PCR reaction buffer of choice. Perform 30 cycles each consisting of 94 &#176;C for 1 min, 58 &#176;C for 1 min, and 72 &#176;C for 1 min, followed by a final extension for 10 min at 72 &#176;C.</li>
		<li>Isolate and purify PCR products with a gel purification kit.</li>
		<li>Digest the purified PCR products using restriction enzymes of choice according to the manufacturer&#39;s instructions.</li>
	</ol>
	</li>
	<li>Cloning of DNA inserts into adaptor plasmid 
	NOTE: Insertion of DNA fragments into an adaptor vector eliminates the need for helper cells/viruses to increase RCAS(A) vector stability14. For more detail, see7,8.
	<ol>
		<li>Subclone DNA fragments into an adapter plasmid, Cla12NCO using a sticky-end ligation reaction. Mix the PCR fragments with restriction enzymes and Cla12NCO at a 2-5:1 ratio. Perform ligation and DNA transformation using competent cells.</li>
		<li>Isolate DNA using a DNA isolation kit.</li>
		<li>Sequence the DNA to ensure accuracy.</li>
	</ol>
	</li>
	<li>Cloning into the RCAS(A) viral vector 
	NOTE: DNA fragments are inserted into a vehicle (RCAS(A) retrovirus) for the stable transduction of a gene into cells in the developing chick embryo14,15. For more detail, see7,8,15.
	<ol>
		<li>Digest the Cla12NCO-DNA fragment of interest-containing vector with ClaI (1 unit per 1 &#181;g of DNA) and gel-isolate the fragments.</li>
		<li>Subclone the DNA fragments into a ClaI-linearized RCAS(A) plasmid. Use the restriction enzyme SalI to distinguish the ClaI site on the RCAS(A) plasmid.</li>
		<li>Confirm the correct orientation of the inserted fragments on the constructs by digestion with ClaI and SalI restriction enzymes.</li>
		<li>Isolate DNA using a DNA isolation kit.</li>
		<li>Determine the DNA concentration.</li>
	</ol>
	</li>
	<li>Transfection of chick embryonic fibroblast (CEF) cells and RCAS(A) harvest 
	NOTE: Virus packaging cells, CEFs, are used to obtain/harvest cell culture media containing viral particles15,16. For more detail, see7,8,15.
	<ol>
		<li>Transfect CEF cells with recombinant retroviral DNA constructs using the transfection agent according to the manufacturer&#39;s instructions.</li>
		<li>Perform western blotting of the transfected cells to examine their expression of the protein of interest.</li>
		<li>When the transfected cells reach confluency, begin collecting the supernatant medium, processing/filtering it appropriately (to remove any cellular debris using a 0.22&#181;m filter), and store at -80 &#176;C until ready for concentration.</li>
	</ol>
	</li>
	<li>Concentration and titering of viral stocks 
	&#8203;NOTE: The pellet and large volumes of media derived from the cells containing the viral particles must be filtered. Additionally, a viral titer assay must be performed to establish the strength of the virus against the host cells. For more detail, see6,7,8,15.
	<ol>
		<li>Thaw the culture media containing the virions.</li>
		<li>Spin the culture media at 72,000 &#215; g for 2 h at 4 &#176;C.</li>
		<li>Decant the supernatant and resuspend the viral pellet with the residual (~50 &#181;L) medium and store at -80 &#176;C until use, in ~10 &#181;L viral stocks.</li>
		<li>For titering, using either QT-6 or CEF cells, transfect the cells with a serial dilution of the viral stocks.</li>
		<li>Post confluency, fix the cells using 4% formaldehyde.</li>
		<li>Immunostain for viral gag proteins or process for alkaline phosphatase histochemically to obtain the titer, defined as (colony-forming units) CFU per milliliter (CFU/mL).</li>
	</ol>
	</li>
</ol>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65727/65727fig02.jpg" /> 
Figure 2: Instruments and setup for chick lens microinjection. (A)&#160;P-30 manual vertical microelectrode micropipette puller. (1) inset showing a glass micropipette being pulled. (B)&#160;(2) Egg Incubator. Incubate chicken egg for ~65-68 h in a 37 &#176;C incubator to reach stage 18 (with a sealed, empty central lumen) for injection of retrovirus. (C) Microinjection setup. (3) lighting equipment, (4) Pico-Injector, (5) dissecting microscope, (6) Drummond micromanipulator, (7) computer/camera for visualization. <a href="https://www.jove.com/files/ftp_upload/65727/65727fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
2. Chick lens microinjection
<ol>
	<li>Preparation of supplies
	<ol>
		<li>Preparation of glass micropipettes for microinjection17 
		&#8203;NOTE: Glass capillaries are used to make glass micropipettes with a tip point and an outer diameter (OD) of ~11 &#181;m for microinjection. The setup is shown in Figure 2A.
		<ol>
			<li>Attach the borosilicate glass capillary to the rubber cushioned clips in the manual vertical micropipette puller.</li>
			<li>Set heat temperature (HEAT 1) to 950 &#176;C and perform prepulling to obtain a thinner and softer glass capillary.</li>
			<li>Set heat temperature (HEAT 2) to 790 &#176;C and perform a secondary pulling to produce final micropipettes.</li>
			<li>With a micropipette grinder, sharpen the tip opening to an OD of ~11 &#181;m.</li>
			<li>For future experiments, keep the glass micropipettes in a sponge clamping pad inside a glass jar.</li>
		</ol>
		</li>
		<li>Incubation of fertilized eggs until development stage 18 
		NOTE: During lens development, at ~65-68 h of embryonic development, the lens separates from the ectoderm and forms a sealed vesicle with a central lumen; injection into this empty lens lumen primes for restricted expression to proliferative lens cells7,8,18.
		<ol>
			<li>Incubate fertilized chicken eggs for ~65-68 h in a 37 &#176;C humidified rocking incubator (Figure 2B).</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Opening of the chicken egg 
	NOTE: This step describes the identification and exposure of the embryo for microinjection. For more detail, see7,8.
	<ol>
		<li>Wipe down the work area thoroughly with 70% ethanol.</li>
		<li>Remove the eggs from the incubator, spray them down heavily with 70% ethanol, and let them air-dry.</li>
		<li>Place the egg, with the larger end of the egg facing upwards, on an egg holder.</li>
		<li>Using a pair of sharp-toothed forceps, produce a hole of ~2 cm diameter on the larger end of the egg by carefully tapping on the eggshell and removing fragments of the eggshell (Figure 3A).</li>
		<li>Using a dissecting microscope, locate the embryo.</li>
		<li>Once the embryo and chick lens are located, use the dissecting microscope and fine dissecting forceps and scissors to cut off the amnionic membrane immediately covering the top of the embryo (Figure 3B). 
		NOTE: Do not cut too widely (only enough to expose the embryo ~0.5 cm x 0.5 cm), or else the embryos might sink into the yolk mass; also avoid touching blood vessels, if possible.</li>
		<li>Cover the opening of the egg with a 60 mm Petri dish in preparation for the next steps.</li>
	</ol>
	</li>
	<li>Microinjection of concentrated viral stock 
	NOTE: Viral particles containing target protein DNA fragments for transduction are inserted into cells inside the lens lumen. The setup is shown in Figure 2C. For more detail, see6,7,8.
	<ol>
		<li>Thaw the viral stock stocks on ice.</li>
		<li>For visualization of the viral stock during injection, dilute 1 &#181;L of 10x Fast green into one vial of viral stock containing 10 &#181;L.</li>
		<li>To ensure there are no large chunks of undissolved material that could clog the glass micropipette, centrifuge the solutions for 10 s at 10,000 &#215; g at 4 &#176;C to pellet &#34;large chunks&#34; and transfer the supernatants into new tubes, all while keeping the solutions on ice.</li>
		<li>On a 35 mm x 10 mm culture dish, place a stretched laboratory parafilm and add 1 &#181;L of sterile saline (PBS) on top of the film (non-sterilized, with the covered side considered &#34;clean&#34;).</li>
		<li>Connect a prepared glass micropipette to an automatic pico-injector.</li>
		<li>Press the fill mode to fill the sterile saline (PBS) into a glass micropipette, and then use the inject mode to test the allocated 1 &#181;L of liquid.</li>
		<li>Place a second stretched laboratory parafilm on the surface of a new 35 mm x 10 mm cell culture dish and add 1 &#181;L of Fast green-stained viral stocks on top of the film.</li>
		<li>Lower the tip of the micropipette into the viral stock and press the fill-model to fill the glass micropipette with ~1 &#181;L of viral stock. 
		NOTE: To avoid drying out, put the tip of the filled micropipette in sterile saline (PBS) whenever there is a pause in the procedure.</li>
		<li>Lower the filled glass micropipette, connected to an automatic injector, into the target region of the embryo lens lumen with the assistance of a dissecting microscope.</li>
		<li>Adjust the light source to ensure clear visualization of the outline of the lens vesicle. 
		NOTE: The lumen of the right lens (facing up) is typically used for injection and the left (facing down) is kept intact as a contralateral control.</li>
		<li>Once sure that the placement of the micropipette is within the correct location inside the lens lumen, inject 5-40 nL of the viral stock (Figure 3C). 
		NOTE: Practice is very necessary for optimal injection placement.</li>
		<li>Wait for ~45 s and then gently remove the glass micropipette.</li>
		<li>Check for the successful microinjection into the lens lumen using the dissecting microscope by examining Fast Green dye that should stay in the empty lumen of the lens without any leakage.</li>
		<li>After the injection procedure, seal the eggshell opening with scotch tape.</li>
		<li>Return the embryo to the 37 &#176;C humidified incubator, without any rotating motion, until the desired embryonic age has been reached for lens dissection.</li>
	</ol>
	</li>
</ol>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/65727/65727fig03.jpg" /> 
Figure 3: Microinjection chick prep and schematic. (A) Opening of a chicken egg. (B) Cutting of the amniotic membrane. (C) Chicken lens lumen microinjection schematic. <a href="https://www.jove.com/files/ftp_upload/65727/65727fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Studying Protein Expression During Chicken Lens Development

<ol>
	<li>Li, Z., Gu, S., Quan, Y., Varadaraj, K., Jiang, J. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+potent+embryonic+chick+lens+model+for+studying+congenital+cataracts+in+vivo.">Development of a potent embryonic chick lens model for studying congenital cataracts in vivo.</a> Communications Biology. 4 (1), 325 (2021).</li><li>Chen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=&#947;-Crystallins+of+the+chicken+lens:+remnants+of+an+ancient+vertebrate+gene+family+in+birds.">&#947;-Crystallins of the chicken lens: remnants of an ancient vertebrate gene family in birds.</a> The FEBS Journal. 283 (8), 1516-1530 (2016).</li><li>Coulombre, A. J., Coulombre, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lens+development.+I.+Role+of+the+lens+in+eye+growth.">Lens development. I. Role of the lens in eye growth.</a> Journal of Experimental Zoology. 156 (1), 39-47 (1964).</li><li>McKeehan, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+portions+of+the+chick+lens+without+contact+with+the+optic+cup.">Induction of portions of the chick lens without contact with the optic cup.</a> The Anatomical Record. 132 (3), 297-305 (1958).</li><li>Kothlow, S., Schenk-Weibhauser, K., Ratcliffe, M. J., Kaspers, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prolonged+effect+of+BAFF+on+chicken+B+cell+development+revealed+by+RCAS+retroviral+gene+transfer+in+vivo.">Prolonged effect of BAFF on chicken B cell development revealed by RCAS retroviral gene transfer in vivo.</a> Molecular immunology. 47 (7-8), 1619-1628 (2010).</li><li>Fekete, D. M., Cepko, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication-competent+retroviral+vectors+encoding+alkaline+phosphatase+reveal+spatial+restriction+of+viral+gene+expression/transduction+in+the+chick+embryo.">Replication-competent retroviral vectors encoding alkaline phosphatase reveal spatial restriction of viral gene expression/transduction in the chick embryo.</a> Molecular and Cellular Biology. 13 (4), 2604-2613 (1993).</li><li>Jiang, J. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+retroviruses+to+express+connexins.">Use of retroviruses to express connexins.</a> Methods in Molecular Biology. , 159-174 (2001).</li><li>Jiang, J. X., Goodenough, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+expression+of+connexins+in+embryonic+chick+lens.">Retroviral expression of connexins in embryonic chick lens.</a> Investigative Ophthalmology &amp; Visual Science. 39 (3), 537-543 (1998).</li><li>Shestopalov, V. I., Bassnett, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+autofluorescent+proteins+reveals+a+novel+protein+permeable+pathway+between+cells+in+the+lens+core.">Expression of autofluorescent proteins reveals a novel protein permeable pathway between cells in the lens core.</a> Journal of Cell Science. 113 (11), 1913-1921 (2000).</li><li>Liu, J., Xu, J., Gu, S., Nicholson, B. J., Jiang, J. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aquaporin+0+enhances+gap+junction+coupling+via+its+cell+adhesion+function+and+interaction+with+connexin+50.">Aquaporin 0 enhances gap junction coupling via its cell adhesion function and interaction with connexin 50.</a> Journal of Cell Science. 124 (2), 198-206 (2011).</li><li>Li, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+second+extracellular+domain+of+connexin+50+is+important+for+in+cell+adhesion,+lens+differentiation,+and+adhesion+molecule+expression.">The second extracellular domain of connexin 50 is important for in cell adhesion, lens differentiation, and adhesion molecule expression.</a> Journal of Biological Chemistry. 299 (3), 102965 (2023).</li><li>Shestopalov, V. I., Bassnett, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exogenous+gene+expression+and+protein+targeting+in+lens+fiber+cells.">Exogenous gene expression and protein targeting in lens fiber cells.</a> Investigative Ophthalmology &amp; Visual Science. 40 (7), 1435-1443 (1999).</li><li>Shestopalov, V. I., Bassnett, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+organization+of+primary+lens+fiber+cells.">Three-dimensional organization of primary lens fiber cells.</a> Investigative Ophthalmology &amp; Visual Science. 41 (3), 859-863 (2000).</li><li>Hughes, S. H., Greenhouse, J. J., Petropoulos, C. J., Sutrave, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adaptor+plasmids+simplify+the+insertion+of+foreign+DNA+into+helper-independent+retroviral+vectors.">Adaptor plasmids simplify the insertion of foreign DNA into helper-independent retroviral vectors.</a> Journal of Virology. 61 (10), 3004-3012 (1987).</li><li>Yan, R. T., Wang, S. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+high-titer+RCAS+retrovirus.">Production of high-titer RCAS retrovirus.</a> Methods in Molecular Biology. 884, 193-199 (2012).</li><li>Kingston, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Introduction+of+DNA+into+mammalian+cells.">Introduction of DNA into mammalian cells.</a> Current Protocols in Molecular Biology. 64 (1), 1-95 (2003).</li><li>Li, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studying+macrophage+activation+in+immune-privileged+lens+through+CSF-1+protein+intravitreal+injection+in+mouse+model.">Studying macrophage activation in immune-privileged lens through CSF-1 protein intravitreal injection in mouse model.</a> STAR Protocols. 3 (1), 101060 (2022).</li><li>Hamburger, V., Hamilton, H. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+series+of+normal+stages+in+the+development+of+the+chick+embryo.">A series of normal stages in the development of the chick embryo.</a> Developmental Dynamics. 195 (4), 231-272 (1992).</li><li>Hallagan, J. B., Allen, D. C., Borzelleca, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+safety+and+regulatory+status+of+food,+drug+and+cosmetics+colour+additives+exempt+from+certification.">The safety and regulatory status of food, drug and cosmetics colour additives exempt from certification.</a> Food and Chemical Toxicology. 33 (6), 515-528 (1995).</li><li>Okada, T. S., Eguchi, G., Takeichi, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+expression+of+differentiation+by+chicken+lens+epithelium+in+in+vitro+cell+culture.">The expression of differentiation by chicken lens epithelium in in vitro cell culture.</a> Development, Growth &amp; Differentiation. 13 (4), 323-336 (1971).</li><li>Menko, A. S., Klukas, K. A., Johnson, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chicken+embryo+lens+cultures+mimic+differentiation+in+the+lens.">Chicken embryo lens cultures mimic differentiation in the lens.</a> Developmental Biology. 103 (1), 129-141 (1984).</li><li>Parreno, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methodologies+to+unlock+the+molecular+expression+and+cellular+structure+of+ocular+lens+epithelial+cells.">Methodologies to unlock the molecular expression and cellular structure of ocular lens epithelial cells.</a> Frontiers in Cell and Developmental Biology. 10, 983178 (2022).</li><li>Edwards, A., Gupta, J. D., Harley, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photomicrographic+evaluation+of+drug-induced+cataracts+in+cultured+embryonic+chick+lens.">Photomicrographic evaluation of drug-induced cataracts in cultured embryonic chick lens.</a> Experimental Eye Research. 15 (4), 495-498 (1973).</li><li>Musil, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primary+cultures+of+embryonic+chick+lens+cells+as+a+model+system+to+study+lens+gap+junctions+and+fiber+cell+differentiation.">Primary cultures of embryonic chick lens cells as a model system to study lens gap junctions and fiber cell differentiation.</a> Journal of Membrane Biology. 245 (7), 357-368 (2012).</li><li>West-Mays, J. A., Pino, G., Lovicu, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+use+of+the+lens+epithelial+explant+system+to+study+lens+differentiation+and+cataractogenesis.">Development and use of the lens epithelial explant system to study lens differentiation and cataractogenesis.</a> Progress in Retinal and Eye Research. 29 (2), 135-143 (2010).</li><li>Upreti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lens+epithelial+explants+treated+with+vitreous+humor+undergo+alterations+in+chromatin+landscape+with+concurrent+activation+of+genes+associated+with+fiber+cell+differentiation+and+innate+immune+response.">Lens epithelial explants treated with vitreous humor undergo alterations in chromatin landscape with concurrent activation of genes associated with fiber cell differentiation and innate immune response.</a> Cells. 12 (3), 501 (2023).</li><li>Walker, J. L., Wolff, I. M., Zhang, L., Menko, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+SRC+kinases+signals+induction+of+posterior+capsule+opacification.">Activation of SRC kinases signals induction of posterior capsule opacification.</a> Investigative Ophthalmology &amp; Visual Science. 48 (5), 2214-2223 (2007).</li><li>Briskin, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heritable+retroviral+transgenes+are+highly+expressed+in+chickens.">Heritable retroviral transgenes are highly expressed in chickens.</a> Proceedings of the National Academy of Sciences of the United States of America. 88 (5), 1736-1740 (1991).</li><li>Hughes, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RCAS+vector+system.">The RCAS vector system.</a> Folia Biologica. 50 (3-4), 107-119 (2004).</li></ol>

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

This experimental model offers the opportunity to express the protein(s) of interest in the intact lens leading to the study of the functional relevance of these proteins in lens structure and function. The embryonic chick microinjection model is based partially on the work of Fekete et. al.6 and was further developed by Jiang et. al.8 and has been utilized as a means of inserting both viral plasmids and agents such as agonists, small interfering RNA (siRNA), and peptides i...

The goal of this protocol is to describe the methodology of embryonic chicken lens microinjection of an RCAS(A) (replication-competent avian sarcoma/leukosis retrovirus A). Effective retroviral delivery in an embryonic chicken lens has been demonstrated to be a promising tool for the in vivo study of the molecular mechanism and structure-function of lens proteins in normal lens physiology, pathological conditions, and development. Moreover, this experimental model could be used for the identification of therapeutic targets and drug screening for conditions such as human congenital cataracts. In all, this protocol aims to lay out the necessary steps for the development of a customizable platform for the study of lens proteins.
Embryonic chicks (Gallus domesticus), owing to their similarity in lens structure and function with the human lens, are a well-established animal model for the study of lens development and physiology1,2,3,4. The use of an RCAS(A) replication-competent avian retrovirus has been regarded as a highly effective, rapid, and customizable system to express exogenous proteins in chick embryos. Notably, it has a unique ability to confine the target gene transfer to proliferative lens fiber cells without the need for tissue-specific promoters, using the unique embryonic development time frame in which the presence of empty lens lumen permits in situ RCAS(A) microinjection into the restricted site for the expression of exogenous proteins within proliferative lens fiber cells5,6,7,8.
The chick embryo microinjection procedure, described in-depth here, is based originally partially on the work of Fekete et. al.6 and further developed by Jiang et. al.8 and has been utilized as a means of introducing both viral and nonviral plasmids into the lens of embryonic chicks1,9,10,11,12,13. Overall, the previous work demonstrates the potential of utilizing this methodology to study lens development, differentiation, cellular communication, and disease progression, and for the discovery and testing of therapeutic targets for lens pathological conditions such as cataracts.

<table><tbody><tr><td>0.22 &amp;micro;m Filter</td><td>Corning</td><td>431118</td><td>For removing cellular debris from media</td></tr><tr><td>35 mm x 10 mm Culture Dish</td><td>FisherScientific</td><td>50-202-030</td><td>For using during microinjection</td></tr><tr><td>Centrifuge</td><td>Fisherbrand</td><td>13-100-676</td><td>Spinning down solution</td></tr><tr><td>Constructs</td><td>GENEWIZ</td><td>-</td><td>For generation of constructs</td></tr><tr><td>Dissecting microscope</td><td>AmScope</td><td>SM-4TZ-144A</td><td>Visualization of lens for microinjection</td></tr><tr><td>DNA PCR primers</td><td>Integrated DNA Technologies</td><td>-</td><td>Generation of primers:&lt;br/&gt; &lt;br/&gt; Intracellular loop (IL)-deleted Cx50 (residues 1&amp;ndash;97 and 149&amp;ndash;400) as well as the Cla12NCO vector were obtained with the following pair of primers: sense, CTCCTGAGAACCTACATCCT; antisense, CACCGCATGCCCAAAGTACAC&lt;br/&gt; &lt;br/&gt; ILs of Cx43 (residues 98&amp;ndash;150) and Cx46 (residues 98&amp;ndash;166) were&amp;nbsp; obtained with the following pairs of primers: sense, TACGTGATGAGGAAAGAAGAG; antisense, TCCTCCACGCATCTTTACCTTG; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCC AT ACGGATTC, respectively&lt;br/&gt; &lt;br/&gt; Cla12NCO-Cx43 construct template was obtained with the following pair of primers: sense, CTGCTTCGTACTTACATCATC; antisense, GAACAC GTGCGCCAGGTAC&lt;br/&gt; &lt;br/&gt; ILs of Cx50 (residues 98&amp;ndash;148) or Cx46 (residues 98&amp;ndash;166) were cloned by using Cla12NCO-Cx50 and Cla12NCO-Cx46 constructs as the templates with the following pair of primers: sense, CACCATGTCCGCATGGAGGAGA; antisense, GGTCCCC TC CAGGCGAAAC; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCCATACGGATTC, respectively</td></tr><tr><td>Drummond Nanoject II Automatic Nanoliter Injector</td><td>Drummond Scientific</td><td>3-000-204</td><td>Microinjection Pipet</td></tr><tr><td>Dual Gooseneck Lights Microscope Illuminator</td><td>AmScope</td><td>LED-50WY</td><td>Lighting for visualization</td></tr><tr><td>Dulbecco&amp;rsquo;s Modified Eagle Medium (DMEM)</td><td>Invitrogen</td><td></td><td>For cell culture</td></tr><tr><td>Egg Holder</td><td>-</td><td>-</td><td>Homemade styrofoam rings with 2-inch diameter and one-half inch height</td></tr><tr><td>Egg Incubator</td><td>GQF Manufacturing Company Inc.</td><td>1502</td><td>For incubation of fertilized eggs</td></tr><tr><td>Fast Green</td><td>Fisher scientific</td><td>F99-10</td><td>For visualization of viral stock injection</td></tr><tr><td>Fertilized white leghorn chicken eggs</td><td>Texas A&amp;amp;M University</td><td>N/A</td><td>Animal model of choice for microinjection (https://posc.tamu.edu/fertile-egg-orders/)</td></tr><tr><td>Fetal Bovine Serum (FBS)</td><td>Hyclone Laboratories</td><td></td><td>For cell culture</td></tr><tr><td>Fluorescein-conjugated anti-mouse IgG</td><td>Jackson ImmunoResearch</td><td>115-095-003</td><td>For anti-FLAG&amp;nbsp; 1:500</td></tr><tr><td>Forceps</td><td>FisherScientific</td><td>22-327379</td><td>For moving things around and isolation</td></tr><tr><td>Glass capillaries</td><td>Sutter Instruments</td><td>B100-75-10</td><td>Glass micropipette for microinjection (O.D. 1.0 mm, I.D. 0.75 mm, 10 cm length)</td></tr><tr><td>Lipofectamine</td><td>Invitrogen</td><td>L3000001</td><td>For transfection</td></tr><tr><td>Manual vertical micropipette puller</td><td>Sutter Instruments</td><td>P-30</td><td>To obtain glass micropipette of the correct size</td></tr><tr><td>Microcentrifuge Tubes</td><td>FisherScientific</td><td>02-682-004</td><td>Dissolving solution</td></tr><tr><td>Microscope</td><td>Keyence</td><td>BZ-X710</td><td>For imaging staining</td></tr><tr><td>Parafilm</td><td>FisherScientific</td><td>03-448-254</td><td>Placing solution</td></tr><tr><td>Penicillin/Streptomycin</td><td>Invitrogen</td><td></td><td>For cell culture</td></tr><tr><td>Pico-Injector</td><td>Harvard Apparatus</td><td>PLI-100</td><td>For delivering small liquid volumes precisely through micropipettes by applying a regulated pressure for a digitally set period of time</td></tr><tr><td>rabbit anti-chick AQP0</td><td>Self generated</td><td>-</td><td>Jiang JX, White TW, Goodenough DA, Paul DL. Molecular cloning and functional characterization of chick lens fiber connexin 45.6. Mol Biol Cell. 1994 Mar;5(3):363-73. doi: 10.1091/mbc.5.3.363.</td></tr><tr><td>rabbit anti-FLAG antibody</td><td>Rockland Immunichemicals</td><td>600-401-383</td><td>For staining FLAG</td></tr><tr><td>Rhodamine-conjugated anti-rabbit IgG&amp;nbsp;</td><td>Jackson ImmunoResearch</td><td>111-295-003</td><td>For anti-AQP0&amp;nbsp; 1:500</td></tr><tr><td>Sponge clamping pad</td><td>Sutter Instruments</td><td>BX10</td><td>For storage of glass micropipette</td></tr></tbody></table>

microinjection of recombinant rcas(a) retrovirus into embryonic chicken lens

Embryonic chicken (Gallus domesticus) is a well-established animal model for the study of lens development and physiology, given its high degree of similarity with the human lens. RCAS(A) is a replication-competent chicken retrovirus that infects dividing cells, which serves as a powerful tool to study the in situ expression and function of wild-type and mutant proteins during lens development by microinjection into the empty lumen of lens vesicle at early developmental stages, restricting its action to surrounding proliferating lens cells. Compared to other approaches, such as transgenic models and ex vivo cultures, the use of an RCAS(A) replication-competent avian retrovirus provides a highly effective, rapid, and customizable system to express exogenous proteins in chick embryos. Specifically, targeted gene transfer can be confined to proliferative lens fiber cells without the need for tissue-specific promoters. In this article, we will briefly overview the steps needed for recombinant retrovirus RCAS(A) preparation, provide a detailed, comprehensive overview of the microinjection procedure, and provide sample results of the technique.

After the determination of a specific target protein(s) and the identification of the associated gene sequence(s), the overall experimental approach involves the cloning of the gene sequence(s) into a retroviral RCAS(A) vector by the initial cloning into an adaptor vector, followed by a viral vector. Second, high-titer viral particles are prepared using packaging cells to harvest and concentrate the virions. These first two major steps have been largely described and representative results presented elsewhere<sup class="...

Watch this Scientific Journal Video about Investigating Lens Development and Function Through Microinjection of RCASA Retrovirus in Embryonic Chicken Lens at JoVE.com

Author Spotlight: Investigating Lens Development and Function Through Microinjection of RCAS(A) Retrovirus in Embryonic Chicken Lens 

This protocol paper describes the methodology of embryonic chicken lens microinjection of an RCAS(A) retrovirus as a tool for studying in situ function and expression of proteins during lens development.

Microinjection of Recombinant RCAS(A) Retrovirus into Embryonic Chicken Lens

Embryonic chicken (Gallus domesticus) is a well-established animal model for the study of lens development and physiology, given its high degree of ...

microinjection-recombinant-rcas-retrovirus-into-embryonic-chicken

Research

JoVE Journal

Biology

905 Views.  University of Texas Health Science Center, San Antonio. This protocol paper describes the methodology of embryonic chicken lens microinjection of an RCAS(A) retrovirus as a tool for studying in situ function and expression of proteins during lens development.

Video: Author Spotlight: Investigating Lens Development and Function Through Microinjection of RCAS(A) Retrovirus in Embryonic Chicken Lens 

Efficient Gene Transfer in Chick Retinas for Primary Cell Culture Studies: An Ex-ovo Electroporation Approach

The cone photoreceptor-enriched cultures derived from embryonic chick retinas have become an indispensable tool for researchers around the world studying the biology of retinal neurons, particularly photoreceptors. The applications of this system go beyond basic research, as they can easily be adapted to high throughput technologies for drug development. However, genetic manipulation of retinal photoreceptors in these cultures has proven to be very challenging, posing an important limitation to the usefulness of the system. We have recently developed and validated an ex&#160;ovo plasmid electroporation technique that increases the rate of transfection of retinal cells in these cultures by five-fold compared to other currently available protocols1. In this method embryonic chick eyes are enucleated at stage 27, the RPE is removed, and the retinal cup is placed in a plasmid-containing solution and electroporated using easily constructed custom-made electrodes. The retinas are then dissociated and cultured using standard procedures. This technique can be applied to overexpression studies as well as to the downregulation of gene expression, for example via the use of plasmid-driven RNAi technology, commonly achieving transgene expression in 25% of the photoreceptor population. The video format of the present publication will make this technology easily accessible to researchers in the field, enabling the study of gene function in primary retinal cultures. We have also included detailed explanations of the critical steps of this procedure for a successful outcome and reproducibility.

Efficient Gene Transfer in Chick Retinas for Primary Cell Culture Studies: An Ex-ovo Electroporation Approach

Embryonic chick retinal cell cultures constitute valuable tools for the study of photoreceptor biology. We have developed an efficient gene transfer technique based on ex&#160;ovo plasmid electroporation of the retinas prior to culture. This technique considerably increases transfection efficiencies over currently available protocols, making genetic manipulation feasible for this system.

The cone photoreceptor-enriched cultures derived from embryonic chick retinas have become an indispensable tool for researchers around the world studying ...

Developmental Biology

Identification and Characterization of Metastatic Factors by Gene Transfer into the Novel RIP-Tag; RIP-tva Murine Model

Metastatic cancer accounts for 90% of deaths in patients with solid tumors. There is an urgent need to better understand the drivers of cancer metastasis and to identify novel therapeutic targets. To investigate molecular events that drive the progression from primary cancer to metastasis, we have developed a bitransgenic mouse model, RIP-Tag; RIP-tva. In this mouse model, the rat insulin promoter (RIP) drives the expression of the SV40 T antigen (Tag) and the receptor for subgroup A avian leukosis virus (tva) in pancreatic &#946; cells. The mice develop pancreatic neuroendocrine tumors with 100% penetrance through well-defined stages that are similar to human tumorigenesis, with stages including hyperplasia, angiogenesis, adenoma, and invasive carcinoma. Because RIP-Tag; RIP-tva mice do not develop metastatic disease, genetic alterations that promote metastasis can be identified easily. Somatic gene transfer into tva-expressing, proliferating pancreatic &#946; premalignant lesions is achieved through intracardiac injection of avian retroviruses harboring the desired genetic alteration. A titer of &#62;1 x 108 infectious units per ml is considered appropriate for in vivo infection. In addition, avian retroviruses can infect cell lines derived from tumors in RIP-Tag; RIP-tva mice with high efficiency. The cell lines can also be used to characterize the metastatic factors. Here we demonstrate how to utilize this mouse model and cell lines to assess the functions of candidate genes in tumor metastasis.

Identification and Characterization of Metastatic Factors by Gene Transfer into the Novel RIP-Tag; RIP-tva Murine Model

We present a protocol to demonstrate a novel somatic gene transfer system utilizing RIP-Tag; RIP-tva mouse model to study the function of genes in metastasis. The avian retroviruses are delivered intracardiacally to ensure gene transfer into pre-malignant, noninvasive lesions of pancreatic &#946; cells in adult mice.

Metastatic cancer accounts for 90% of deaths in patients with solid tumors. There is an urgent need to better understand the drivers of cancer metastasis ...

Cancer Research

Whole Retinal Explants from Chicken Embryos for Electroporation and Chemical Reagent Treatments

The retina is a good model for the developing central nervous system. The large size of the eye and most importantly the accessibility for experimental manipulations in ovo/in vivo makes the chicken embryonic retina a versatile and very efficient experimental model. Although the chicken retina is easy to target in ovo by intraocular injections or electroporation, the effective and exact concentration of the reagents within the retina may be difficult to fully control. This may be due to variations of the exact injection site, leakage from the eye or uneven diffusion of the substances. Furthermore, the frequency of malformations and mortality after invasive manipulations such as electroporation is rather high.
This protocol describes an ex ovo technique for culturing whole retinal explants from chicken embryos and provides a method for controlled exposure of the retina to reagents. The protocol describes how to dissect, experimentally manipulate, and culture whole retinal explants from chicken embryos. The explants can be cultured for approximately 24 hr and be subjected to different manipulations such as electroporation. The major advantages are that the experiment is not dependent on the survival of the embryo and that the concentration of the introduced reagent can be varied and controlled in order to determine and optimize the effective concentration. Furthermore, the technique is rapid, cheap and together with its high experimental success rate, it ensures reproducible results. It should be emphasized that it serves as an excellent complement to experiments performed in ovo.

This protocol describes a method to dissect, experimentally manipulate and culture whole retinal explants from chicken embryos. The explant cultures are useful when high success rate, efficacy and reproducibility are needed to test the effects of plasmids for electroporation and/or reagent substances, i.e., enzymatic inhibitors.

The retina is a good model for the developing central nervous system. The large size of the eye and most importantly the accessibility for experimental ...

Subretinal Injection of Gene Therapy Vectors and Stem Cells in the Perinatal Mouse Eye

The loss of sight affects approximately 3.4 million people in the United States and is expected to increase in the upcoming years.1 Recently, gene therapy and stem cell transplantations have become key therapeutic tools for treating blindness resulting from retinal degenerative diseases. Several forms of autologous transplantation for age-related macular degeneration (AMD), such as iris pigment epithelial cell transplantation, have generated encouraging results, and human clinical trials have begun for other forms of gene and stem cell therapies.2 These include RPE65 gene replacement therapy in patients with Leber's congenital amaurosis and an RPE cell transplantation using human embryonic stem (ES) cells in Stargardt's disease.3-4 Now that there are gene therapy vectors and stem cells available for treating patients with retinal diseases, it is important to verify these potential therapies in animal models before applying them in human studies. The mouse has become an important scientific model for testing the therapeutic efficacy of gene therapy vectors and stem cell transplantation in the eye.5-8 In this video article, we present a technique to inject gene therapy vectors or stem cells into the subretinal space of the mouse eye while minimizing damage to the surrounding tissue.

This surgical technique illustrates the injection of gene therapy vectors and stem cells into the subretinal space of the mouse eye.

The loss of sight affects approximately 3.4 million people in the United States and is expected to increase in the upcoming years.1 Recently, gene therapy ...

Medicine

In ovo Electroporation in Chick Midbrain for Studying Gene Function in Dopaminergic Neuron Development

Dopaminergic neurons located in the ventral midbrain control movement, emotional behavior, and reward mechanisms1-3. The dysfunction of ventral midbrain dopaminergic neurons is implicated in Parkinson's disease, Schizophrenia, depression, and dementia1-5. Thus, studying the regulation of midbrain dopaminergic neuron differentiation could not only provide important insight into mechanisms regulating midbrain development and neural progenitor fate specification, but also help develop new therapeutic strategies for treating a variety of human neurological disorders.
Dopaminergic neurons differentiate from neural progenitors lining the ventricular zone of embryonic ventral midbrain. The development of neural progenitors is controlled by gene expression programs6,7. Here we report techniques utilizing electroporation to express genes specifically in the midbrain of Hamburger Hamilton (HH) stage 11 (thirteen somites, 42 hours) chick embryos8,9. The external development of chick embryos allows for convenient experimental manipulations at specific embryonic stages, with the effects determined at later developmental time points10-13. Chick embryonic neural tubes earlier than HH stage 13 (nineteen somites, 48 hours) consist of multipotent neural progenitors that are capable of differentiating into distinct cell types of the nervous system. The pCAG vector, which contains both a CMV promoter and a chick &beta;-actin enhancer, allows for robust expression of Flag or other epitope-tagged constructs in embryonic chick neural tubes14. In this report, we emphasize special measures to achieve regionally restricted gene expression in embryonic midbrain dopaminergic neuron progenitors, including how to inject DNA constructs specifically into the embryonic midbrain region and how to pinpoint electroporation with small custom-made electrodes. Analyzing chick midbrain at later stages provides an excellent in vivo system for plasmid vector-mediated gain-of-function and loss-of-function studies of midbrain development. Modification of the experimental system may extend the assay to other parts of the nervous system for performing fate mapping analysis and for investigating the regulation of gene expression.

In ovo Electroporation in Chick Midbrain for Studying Gene Function in Dopaminergic Neuron Development

To assess the function and the regulation of genes during the development of midbrain dopaminergic neurons, we describe a method that involves in ovo electroporation of plasmid DNA constructs into embryonic chick ventral midbrain dopaminergic neuron progenitors. This technique can be used to achieve efficient expression of genes of interest to study different aspects of midbrain development and dopaminergic neuron differentiation.

Dopaminergic neurons located in the ventral midbrain control movement, emotional behavior, and reward mechanisms1-3. The dysfunction of ventral midbrain ...

Neuroscience

Microinjection-based System for In Vivo Implantation of Embryonic Cardiomyocytes in the Avian Embryo

Interpreting the relative impact of cell autonomous patterning versus extrinsic microenvironmental influence on cell lineage determination represents a general challenge in developmental biology research. In the embryonic heart, this can be particularly difficult as regional differences in the expression of transcriptional regulators, paracrine/juxtacrine signaling cues, and hemodynamic force are all known to influence cardiomyocyte maturation. A simplified method to alter a developing cardiomyocyte's molecular and biomechanical microenvironment would, therefore, serve as a powerful technique to examine how local conditions influence cell fate and function. To address this, we have optimized a method to physically transplant juvenile cardiomyocytes into ectopic locations in the heart or the surrounding embryonic tissue. This allows us to examine how microenvironmental conditions influence cardiomyocyte fate transitions at single cell resolution within the intact embryo. Here, we describe a protocol in which embryonic myocytes can be isolated from a variety of cardiac sub-domains, dissociated, fluorescently labeled, and microinjected into host embryos with high precision. Cells can then be directly analyzed in situ using a variety of imaging and histological techniques. This protocol is a powerful alternative to traditional grafting experiments that can be prohibitively difficult in a moving tissue such as the heart. The general outline of this method can also be adapted to a variety of donor tissues and host environments, and its ease of use, low cost, and speed make it a potentially useful application for a variety of developmental studies.

In this method, embryonic cardiac tissues are surgically microdissected, dissociated, fluorescently labeled, and implanted into host embryonic tissues. This provides a platform for studying the individual or tissue level developmental organization under ectopic hemodynamic conditions, and/or altered paracrine/juxtacrine environments.

Interpreting the relative impact of cell autonomous patterning versus extrinsic microenvironmental influence on cell lineage determination represents a ...

In Ovo Intravascular Injection in Chicken Embryos

As a classical model system of embryo biology, the chicken embryo has been used to investigate embryonic development and differentiation. Delivering exogenous materials into chicken embryos has a great advantage for studying gene function, transgenic breeding, and chimera preparation during embryonic development. Here we show the method of in ovo intravascular injection whereby exogenous materials such as plasmid vectors or modified primordial germ cells (PGCs) can be transferred into donor chicken embryos at early developmental stages. The results show that the intravascular injection through the dorsal aorta and head allows injected materials to diffuse into the whole embryo through the blood circulatory system. In the presented protocol, the efficacy of exogenous plasmid and lentiviral vector introduction, and the colonization of injected exogenous PGCs in the recipient gonad, were determined by observing fluorescence in the embryos. This article describes detailed procedures of this method, thereby providing an excellent approach to studying gene function, embryo and developmental biology, and gonad-chimeric chicken production. In conclusion, this article will allow researchers to perform in ovo intravascular injection of exogenous materials into chicken embryos with great success and reproducibility.

In Ovo Intravascular Injection in Chicken Embryos

The overall goal of this paper is to describe how to perform in ovo intracellular injection of exogenous materials into chicken embryos. This approach is very useful to study the developmental biology of chicken embryos.

As a classical model system of embryo biology, the chicken embryo has been used to investigate embryonic development and differentiation. Delivering ...

Limbal Approach-Subretinal Injection of Viral Vectors for Gene Therapy in Mice Retinal Pigment Epithelium

The eye is a small and enclosed organ which makes it an ideal target for gene therapy. Recently various strategies have been applied to gene therapy in retinopathies using non-viral and viral gene delivery to the retina and retinal pigment epithelium (RPE). Subretinal injection is the best approach to deliver viral vectors directly to RPE cells. Before the clinical trial of a gene therapy, it is inevitable to validate the efficacy of the therapy in animal models of various retinopathies. Thus, subretinal injection in mice becomes a fundamental technique for an ocular gene therapy. In this protocol, we provide the easy and replicable technique for subretinal injection of viral vectors to experimental mice. This technique is modified from the intravitreal injection, which is widely used technique in ophthalmology clinics. The representative results of RPE/choroid/scleral complex flat-mount will help to understand the efficacy of this technique and adjust the volume and titer of viral vectors for the extent of gene transduction.

Subretinal injection is a surgical technique for effective gene delivery to retinal pigment epithelium in the mouse eye. Here we describe an easy and replicable method for subretinal injection of viral vectors to retinal pigment epithelium in experimental mice.

The eye is a small and enclosed organ which makes it an ideal target for gene therapy. Recently various strategies have been applied to gene therapy in ...

In Ovo Electroporation in Embryonic Chick Retina

Chicken embryonic retina is an excellent tool to study retinal development in higher vertebrates. Because of large size and external development, it is comparatively very easy to manipulate the chick embryonic retina using recombinant DNA/RNA technology. Electroporation of DNA/RNA constructs into the embryonic retina have a great advantage to study gene regulation in retinal stem/progenitor cells during retinal development. Different type of assays such as reporter gene assay, gene over-expression, gene knock down (shRNA) etc. can be performed using the electroporation technique. This video demonstrates targeted retinal injection and in ovo electroporation into the embryonic chick retina at the Hamburger and Hamilton stage 22-23, which is about embryonic day 4 (E4). Here we show a rapid and convenient in ovo electroporation technique whereby a plasmid DNA that expresses green fluorescent protein (GFP) as a marker is directly delivered into the chick embryonic subretinal space and followed by electric pulses to facilitate DNA uptake by retinal stem/progenitor cells. The new method of retinal injection and electroporation at E4 allows the visualization of all retinal cell types, including the late-born neurons1, which has been difficult with the conventional method of injection and electroporation at E1.52.

In Ovo Electroporation in Embryonic Chick Retina

The overall goal of this video is to show how to perform targeted retinal injection and in ovo electroporation of DNA/RNA constructs into the chick embryonic retina at the Hamburger and Hamilton stage 22-23, which is about embryonic day 4 (E4). This technique is very useful to study gene expression, gene regulation, and morphological change in developing chick retina.

Chicken embryonic retina is an excellent tool to study retinal development in higher vertebrates. Because of large size and external development, it is ...

Cone-Enriched Cultures from the Retina of Chicken Embryos to Study Rod to Cone Cellular Interactions

Human daytime vision relies on the function of cone photoreceptors at the center of the retina, the fovea. Patients suffering from the most prevalent form of inherited retinal degeneration, retinitis pigmentosa, lose night vision because of mutation driven loss of rod photoreceptors, a phenomenon followed by a progressive loss of function and death of cones leading to blindness. Geneticists have identified many genes with mutations causing this disease, but the first mutations identified questioned the mechanisms of secondary cone degeneration and how a dominant mutation in the rhodopsin gene encoding for the visual pigment expressed exclusively in rods can trigger cone degeneration.
This result of transplantations in a genetic model of the disease led to the concept of cell interactions between rods and cones and of non-cell autonomous degeneration of cones in all genetic forms of retinitis pigmentosa.
Cones comprise 5% of all photoreceptors in humans and only 3% in the mouse, so their study is difficult in these species, but cones outnumber rods in bird species. We have adapted 96-well plates to culture retinal precursors from the retina of chicken embryos at stage 29 of their development. In these primary cultures, cones represent 80% of the cells after in vitro differentiation. The cells degenerate over a period of one week in the absence of serum. Here, we describe the methods and its standardization.
This cone-enriched culture system was used to identify the epithelium-derived cone viability factor (EdCVF) by high content screening of a rat retinal pigmented epithelium normalized cDNA library. Recombinant EdCVF prevents the degeneration of the cones.

We describe a method to obtain primary cultures of cone photoreceptors from the retina of chicken embryos and its use for high content screening.

Human daytime vision relies on the function of cone photoreceptors at the center of the retina, the fovea. Patients suffering from the most prevalent form ...

Microinjection of Recombinant RCAS(A) Retrovirus into Embryonic Chicken Lens

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Efficient Gene Transfer in Chick Retinas for Primary Cell Culture Studies: An Ex-ovo Electroporation Approach

Identification and Characterization of Metastatic Factors by Gene Transfer into the Novel RIP-Tag; RIP-tva Murine Model

Whole Retinal Explants from Chicken Embryos for Electroporation and Chemical Reagent Treatments

Subretinal Injection of Gene Therapy Vectors and Stem Cells in the Perinatal Mouse Eye

In ovo Electroporation in Chick Midbrain for Studying Gene Function in Dopaminergic Neuron Development

Microinjection-based System for In Vivo Implantation of Embryonic Cardiomyocytes in the Avian Embryo

In Ovo Intravascular Injection in Chicken Embryos

Limbal Approach-Subretinal Injection of Viral Vectors for Gene Therapy in Mice Retinal Pigment Epithelium

In Ovo Electroporation in Embryonic Chick Retina

Cone-Enriched Cultures from the Retina of Chicken Embryos to Study Rod to Cone Cellular Interactions