تم دعم هذا العمل من خلال منح المعاهد الوطنية للصحة (NIH): RO1 EY012085 (إلى JXJ) و F32DK134051 (إلى F.M.A) ، ومنحة مؤسسة ويلش: AQ-1507 (إلى JXJ). المحتوى هو مسؤولية المؤلفين وحدهم ولا يمثل بالضرورة الآراء الرسمية للمعاهد الوطنية للصحة. تم إنشاء الأرقام جزئيا باستخدام Biorender.com.

أجريت هذه الدراسة وفقا لقانون رعاية الحيوان واللوائح التنفيذية لرعاية الحيوان وفقا لمبادئ دليل رعاية واستخدام المختبر. تمت الموافقة على جميع الإجراءات الحيوانية من قبل لجنة رعاية واستخدام الحيوان المؤسسية في مركز العلوم الصحية بجامعة تكساس في سان أنطونيو. للحصول على نظرة عامة على البروتوكول ، انظر الشكل 1 ؛ انظر جدول المواد للحصول على تفاصيل حول جميع المواد والكواشف والأدوات المستخدمة في هذا البروتوكول.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/65727/65727fig01.jpg"> الشكل 1: مخطط تجريبي. 1 . تتمثل الخطوة الأولى للبروتوكول في تحديد بروتين (بروتينات) مستهدف محدد ، وتحديد تسلسل (تسلسلات) الجينات المرتبطة ، وتوليد شظايا الحمض النووي. 2 . استنساخ تسلسل (تسلسلات) الجينات في ناقل فيروسي رجعي عن طريق الاستنساخ الأولي إلى ناقل محول ، 3. يليه ناقل فيروسي . 4 . تحضير جزيئات فيروسية عالية العيار باستخدام خلايا التعبئة والتغليف للحصاد والتركيز. 5 . الخطوة الأخيرة ، ومحور هذا البروتوكول ، هي الحقن المجهري لعدسة الدجاج للجزيئات الفيروسية RCAS (A) في تجويف العدسة. <a href="https://www.jove.com/files/ftp_upload/65727/65727fig01large.jpg" target="_blank">يرجى النقر هنا لعرض نسخة أكبر من هذا الرقم.</a>
1. تحضير الفيروسات القهقرية المؤتلفة عالية العيار
<ol><li>تفاعل البوليميراز المتسلسل (PCR) لصنع شظايا الحمض النووي للبروتين المستهدف ملاحظة: يهدف هذا القسم إلى تضخيم تسلسل الحمض النووي المقابل لبروتين العدسة المستهدف. لمزيد من التفاصيل، انظر 7,8.<ol><li>تصميم الاشعال ل PCR ، المقابلة للبروتين محل الاهتمام ، لجعل شظايا الحمض النووي مع كربوكسيل تيرميني في الإطار مع أو بدون تسلسل FLAG epitope (5'-GACTACAAGGACGACGATGACAAG-3') ، وكودون توقف ، وموقع إنزيم تقييد (أي EcoRI) موجود داخل منطقة polylinker من CLa12NCO)) وفقا للمواصفات المذكورة في البروتوكولات المنشورة سابقا ، مع تسلسل لإنزيمات التقييد الكافية1 ، 7،8،10،11.</li>
		<li>أداء تفاعل PCR10. اجمع بين 100 pmol من الحس ومضاد الإحساس للبادئات المصممة مع 0.5 ميكروغرام من connexin cDNA (مثل Cx50 أو Cx43 أو مجموعات Cx50 * 43L الوهمية) ، إلى المخزن المؤقت لتفاعل تفاعل البوليميراز المتسلسل المفضل. قم بإجراء 30 دورة تتكون كل منها من 94 درجة مئوية لمدة 1 دقيقة ، و 58 درجة مئوية لمدة 1 دقيقة ، و 72 درجة مئوية لمدة دقيقة واحدة ، متبوعة بتمديد نهائي لمدة 10 دقائق عند 72 درجة مئوية.</li>
		<li>عزل وتنقية منتجات PCR باستخدام مجموعة تنقية الهلام.</li>
		<li>هضم منتجات PCR المنقاة باستخدام إنزيمات التقييد المفضلة وفقا لتعليمات الشركة المصنعة.</li>
	</ol></li>
	<li>استنساخ إدراج الحمض النووي في محول البلازميد ملاحظة: إدخال شظايا الحمض النووي في ناقل محول يلغي الحاجة إلى الخلايا / الفيروسات المساعدة لزيادة استقرار ناقل RCAS (A)14. لمزيد من التفاصيل، انظر 7,8.<ol><li>شظايا الحمض النووي المستنسخة في محول البلازميد ، Cla12NCO باستخدام تفاعل ربط النهاية اللزجة. امزج شظايا تفاعل البوليميراز المتسلسل مع إنزيمات القطع و Cla12NCO بنسبة 2-5: 1. إجراء الربط وتحويل الحمض النووي باستخدام الخلايا المختصة.</li>
		<li>عزل الحمض النووي باستخدام مجموعة عزل الحمض النووي.</li>
		<li>تسلسل الحمض النووي لضمان الدقة.</li>
	</ol></li>
	<li>الاستنساخ في الناقل الفيروسي RCAS (A) ملاحظة: يتم إدخال شظايا الحمض النووي في مركبة (RCAS (A) retrovirus) من أجل النقل المستقر للجين إلى الخلايا في جنين الفرخالنامي 14,15. لمزيد من التفاصيل ، انظر7،8،15.<ol><li>هضم جزء Cla12NCO-DNA من المتجه المحتوي على الفائدة باستخدام ClaI (وحدة واحدة لكل 1 ميكروغرام من الحمض النووي) وعزل الأجزاء الهلامية.</li>
		<li>قم باستنساخ شظايا الحمض النووي إلى بلازميد RCAS (A) خطي ClaI. استخدم إنزيم القطع SalI لتمييز موقع ClaI على بلازميد RCAS (A).</li>
		<li>تأكيد الاتجاه الصحيح للشظايا المدرجة على التركيبات عن طريق الهضم باستخدام إنزيمات تقييد ClaI و SalI.</li>
		<li>عزل الحمض النووي باستخدام مجموعة عزل الحمض النووي.</li>
		<li>تحديد تركيز الحمض النووي (DNA).</li>
	</ol></li>
	<li>نقل خلايا الخلايا الليفية الجنينية للكتاكيت (CEF) وحصاد RCAS (A) ملاحظة: تستخدم خلايا تغليف الفيروسات ، CEFs ، للحصول على / حصاد وسائط زراعة الخلايا التي تحتوي على جزيئات فيروسية15,16. لمزيد من التفاصيل ، انظر7،8،15.<ol><li>نقل خلايا CEF مع تركيبات الحمض النووي الفيروسي القهقري المؤتلف باستخدام عامل النقل وفقا لتعليمات الشركة المصنعة.</li>
		<li>أداء النشاف الغربي للخلايا المنقولة لفحص تعبيرها عن البروتين محل الاهتمام.</li>
		<li>عندما تصل الخلايا المنقولة إلى نقطة التقاء ، ابدأ في جمع الوسط الطافي ، ومعالجته / ترشيحه بشكل مناسب (لإزالة أي حطام خلوي باستخدام مرشح 0.22 ميكرومتر) ، وتخزينه عند -80 درجة مئوية حتى يصبح جاهزا للتركيز.</li>
	</ol></li>
	<li>تركيز ومعايرة المخزونات الفيروسية ملاحظة: يجب تصفية الحبيبات والكميات الكبيرة من الوسائط المشتقة من الخلايا التي تحتوي على الجسيمات الفيروسية. بالإضافة إلى ذلك ، يجب إجراء فحص عيار فيروسي لتحديد قوة الفيروس ضد الخلايا المضيفة. لمزيد من التفاصيل ، انظر6،7،8،15.<ol><li>قم بإذابة وسائط الثقافة التي تحتوي على الفيروسات.</li>
		<li>قم بتدوير وسائط الاستزراع عند 72000 × جم لمدة 2 ساعة عند 4 درجات مئوية.</li>
		<li>صب المادة الطافية وإعادة تعليق الحبيبات الفيروسية بالوسط المتبقي (~ 50 ميكرولتر) وتخزينها في -80 درجة مئوية حتى الاستخدام ، في ~ 10 ميكرولتر من المخزون الفيروسي.</li>
		<li>للمعايرة ، باستخدام خلايا QT-6 أو CEF ، قم بنقل الخلايا بتخفيف تسلسلي للمخزون الفيروسي.</li>
		<li>بعد التقاء ، إصلاح الخلايا باستخدام 4 ٪ الفورمالديهايد.</li>
		<li>Immunostain لبروتينات هفوة الفيروسية أو عملية الفوسفاتيز القلوي نسيجيكيميائيا للحصول على عيار ، يعرف بأنه (وحدات تشكيل مستعمرة) CFU لكل مليلتر (CFU / mL).</li>
	</ol></li>
</ol><img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65727/65727fig02.jpg"> الشكل 2: الأدوات والإعداد للحقن المجهري لعدسة الفرخ . (أ) مجتذب ماصة ميكروماصة عمودية عمودية P-30. (1) ملحق داخلي يظهر ماصة زجاجية يتم سحبها. ب: (2) حاضنة البيض. احتضان بيضة الدجاج لمدة ~ 65-68 ساعة في حاضنة 37 درجة مئوية للوصول إلى المرحلة 18 (مع تجويف مركزي مغلق وفارغ) لحقن الفيروس القهقري. (ج) إعداد الحقن المجهري. (3) معدات الإضاءة ، (4) Pico-Injector ، (5) مجهر تشريح ، (6) Drummond micromanipulator ، (7) كمبيوتر / كاميرا للتصور. <a href="https://www.jove.com/files/ftp_upload/65727/65727fig02large.jpg" target="_blank">يرجى النقر هنا لعرض نسخة أكبر من هذا الرقم.</a>
2. الحقن المجهري لعدسة الفرخ
<ol><li>إعداد اللوازم<ol><li>تحضير الماصات الزجاجية الدقيقة للحقن المجهري17 ملاحظة: تستخدم الشعيرات الدموية الزجاجية لصنع ماصات زجاجية دقيقة بنقطة طرف وقطر خارجي (OD) ~ 11 ميكرومتر للحقن المجهري. يظهر الإعداد في الشكل 2 أ.<ol><li>قم بتوصيل الشعيرات الدموية الزجاجية البورسليكات بالمشابك المبطنة بالمطاط في مجتذب الماصة العمودي اليدوي.</li>
			<li>اضبط درجة حرارة الحرارة (HEAT 1) على 950 درجة مئوية وقم بإجراء السحب المسبق للحصول على شعيرات زجاجية أرق وأكثر نعومة.</li>
			<li>اضبط درجة حرارة الحرارة (HEAT 2) على 790 درجة مئوية وقم بإجراء سحب ثانوي لإنتاج ماصات دقيقة نهائية.</li>
			<li>باستخدام مطحنة micropipette ، شحذ فتحة الطرف إلى OD ~ 11 ميكرومتر.</li>
			<li>للتجارب المستقبلية ، احتفظ بالماصات الزجاجية الدقيقة في وسادة تثبيت إسفنجية داخل وعاء زجاجي.</li>
		</ol></li>
		<li>حضانة البويضات المخصبة حتى مرحلة التطوير 18 ملاحظة: أثناء تطوير العدسة ، عند ~ 65-68 ساعة من التطور الجنيني ، تنفصل العدسة عن الأديم الظاهر وتشكل حويصلة محكمة الغلق ذات تجويف مركزي ؛ الحقن في هذا التجويف العدسة الفارغ يستعد للتعبير المقيد لخلايا العدسة التكاثرية7،8،18.<ol><li>احتضان بيض الدجاج المخصب لمدة ~ 65-68 ساعة في حاضنة هزازة مرطبة 37 درجة مئوية (الشكل 2 ب).</li>
		</ol></li>
	</ol></li>
	<li>فتح بيضة الدجاج ملاحظة: تصف هذه الخطوة تحديد الجنين وتعرضه للحقن المجهري. لمزيد من التفاصيل، انظر 7,8.<ol><li>امسح منطقة العمل جيدا باستخدام 70٪ إيثانول.</li>
		<li>أخرج البيض من الحاضنة ، ورشه بشدة بنسبة 70٪ من الإيثانول ، واتركه يجف في الهواء.</li>
		<li>ضع البيضة ، بحيث يكون الطرف الأكبر من البيضة متجها لأعلى ، على حامل البيض.</li>
		<li>باستخدام زوج من الملقط ذو الأسنان الحادة ، قم بإنتاج ثقب قطره ~ 2 سم على الطرف الأكبر من البيضة عن طريق النقر بعناية على قشر البيض وإزالة شظايا قشر البيض (الشكل 3 أ).</li>
		<li>باستخدام مجهر تشريح ، حدد موقع الجنين.</li>
		<li>بمجرد تحديد موقع الجنين وعدسة الفرخ ، استخدم مجهر التشريح والملقط والمقص الدقيق لقطع الغشاء الأمنيوسي الذي يغطي الجزء العلوي من الجنين على الفور (الشكل 3 ب). ملاحظة: لا تقطع على نطاق واسع (يكفي فقط لفضح الجنين ~ 0.5 سم × 0.5 سم) ، وإلا فقد تغرق الأجنة في كتلة صفار البيض ؛ تجنب أيضا لمس الأوعية الدموية ، إن أمكن.</li>
		<li>غطي فتحة البيضة بطبق بتري 60 مم استعدادا للخطوات التالية.</li>
	</ol></li>
	<li>الحقن المجهري للمخزون الفيروسي المركز ملاحظة: يتم إدخال الجسيمات الفيروسية التي تحتوي على شظايا الحمض النووي للبروتين المستهدف للتنبيغ في الخلايا داخل تجويف العدسة. يظهر الإعداد في الشكل 2C. لمزيد من التفاصيل ، انظر6،7،8.<ol><li>ذوبان مخزون الأسهم الفيروسية على الجليد.</li>
		<li>لتصور المخزون الفيروسي أثناء الحقن ، قم بتخفيف 1 ميكرولتر من 10x أخضر سريع في قنينة واحدة من المخزون الفيروسي تحتوي على 10 ميكرولتر.</li>
		<li>لضمان عدم وجود قطع كبيرة من المواد غير المذابة التي يمكن أن تسد الماصة الزجاجية الدقيقة ، قم بطرد المحاليل لمدة 10 ثوان عند 10000 × جم عند 4 درجات مئوية لحبيبات "قطع كبيرة" ونقل المواد الطافية إلى أنابيب جديدة ، كل ذلك مع الحفاظ على المحاليل على الجليد.</li>
		<li>على طبق استزراع 35 مم × 10 مم ، ضع بارافيلم مختبري ممتد وأضف 1 ميكرولتر من المحلول الملحي المعقم (PBS) أعلى الفيلم (غير معقم ، مع اعتبار الجانب المغطى "نظيفا").</li>
		<li>قم بتوصيل ماصة زجاجية معدة بحاقن بيكو أوتوماتيكي.</li>
		<li>اضغط على وضع التعبئة لملء المحلول الملحي المعقم (PBS) في ماصة زجاجية دقيقة ، ثم استخدم وضع الحقن لاختبار 1 ميكرولتر المخصصة من السائل.</li>
		<li>ضع بارافيلم مختبري ممتد ثان على سطح طبق زراعة خلايا جديد مقاس 35 مم × 10 مم وأضف 1 ميكرولتر من المخزون الفيروسي سريع اللون باللون الأخضر فوق الفيلم.</li>
		<li>اخفض طرف الماصة الدقيقة في المخزون الفيروسي واضغط على نموذج التعبئة لملء الماصة الزجاجية الدقيقة ب ~ 1 ميكرولتر من المخزون الفيروسي. ملاحظة: لتجنب الجفاف ، ضع طرف الماصة المملوءة في محلول ملحي معقم (PBS) كلما كان هناك توقف مؤقت في الإجراء.</li>
		<li>قم بخفض الماصة الزجاجية المملوءة ، المتصلة بحاقن أوتوماتيكي ، في المنطقة المستهدفة من تجويف عدسة الجنين بمساعدة مجهر تشريح.</li>
		<li>اضبط مصدر الضوء لضمان رؤية واضحة لمخطط حويصلة العدسة. ملاحظة: عادة ما يستخدم تجويف العدسة اليمنى (متجها لأعلى) للحقن ويتم الحفاظ على اليسار (متجها لأسفل) سليما كعنصر تحكم مقابل.</li>
		<li>بمجرد التأكد من أن موضع الماصة الدقيقة يقع في الموقع الصحيح داخل تجويف العدسة ، قم بحقن 5-40 nL من المخزون الفيروسي (الشكل 3C). ملاحظة: الممارسة ضرورية جدا لوضع الحقن الأمثل.</li>
		<li>انتظر ~ 45 ثانية ثم قم بإزالة الماصة الزجاجية برفق.</li>
		<li>تحقق من نجاح الحقن المجهري في تجويف العدسة باستخدام مجهر التشريح من خلال فحص صبغة Fast Green التي يجب أن تبقى في التجويف الفارغ للعدسة دون أي تسرب.</li>
		<li>بعد إجراء الحقن ، أغلق فتحة قشر البيض بشريط سكوتش.</li>
		<li>أعد الجنين إلى الحاضنة المرطبة 37 درجة مئوية ، دون أي حركة دوارة ، حتى يتم الوصول إلى العمر الجنيني المطلوب لتشريح العدسة.</li>
	</ol></li>
</ol><img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/65727/65727fig03.jpg"> الشكل 3: إعداد كتكوت الحقن الدقيق والتخطيطي. أ: فتح بيضة دجاج. ب: قطع الغشاء السلوي. (ج) الحقن المجهري لعدسة الدجاج. <a href="https://www.jove.com/files/ftp_upload/65727/65727fig03large.jpg" target="_blank">يرجى النقر هنا لعرض نسخة أكبر من هذا الرقم.</a>

دراسة شفط البروتين أثناء تطوير عدسة الدجاج

<ol>
	<li>Li, Z., Gu, S., Quan, Y., Varadaraj, K., Jiang, J. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+potent+embryonic+chick+lens+model+for+studying+congenital+cataracts+in+vivo.">Development of a potent embryonic chick lens model for studying congenital cataracts in vivo.</a> Communications Biology. 4 (1), 325 (2021).</li><li>Chen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=&#947;-Crystallins+of+the+chicken+lens:+remnants+of+an+ancient+vertebrate+gene+family+in+birds.">&#947;-Crystallins of the chicken lens: remnants of an ancient vertebrate gene family in birds.</a> The FEBS Journal. 283 (8), 1516-1530 (2016).</li><li>Coulombre, A. J., Coulombre, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lens+development.+I.+Role+of+the+lens+in+eye+growth.">Lens development. I. Role of the lens in eye growth.</a> Journal of Experimental Zoology. 156 (1), 39-47 (1964).</li><li>McKeehan, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+portions+of+the+chick+lens+without+contact+with+the+optic+cup.">Induction of portions of the chick lens without contact with the optic cup.</a> The Anatomical Record. 132 (3), 297-305 (1958).</li><li>Kothlow, S., Schenk-Weibhauser, K., Ratcliffe, M. J., Kaspers, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prolonged+effect+of+BAFF+on+chicken+B+cell+development+revealed+by+RCAS+retroviral+gene+transfer+in+vivo.">Prolonged effect of BAFF on chicken B cell development revealed by RCAS retroviral gene transfer in vivo.</a> Molecular immunology. 47 (7-8), 1619-1628 (2010).</li><li>Fekete, D. M., Cepko, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication-competent+retroviral+vectors+encoding+alkaline+phosphatase+reveal+spatial+restriction+of+viral+gene+expression/transduction+in+the+chick+embryo.">Replication-competent retroviral vectors encoding alkaline phosphatase reveal spatial restriction of viral gene expression/transduction in the chick embryo.</a> Molecular and Cellular Biology. 13 (4), 2604-2613 (1993).</li><li>Jiang, J. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+retroviruses+to+express+connexins.">Use of retroviruses to express connexins.</a> Methods in Molecular Biology. , 159-174 (2001).</li><li>Jiang, J. X., Goodenough, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+expression+of+connexins+in+embryonic+chick+lens.">Retroviral expression of connexins in embryonic chick lens.</a> Investigative Ophthalmology &amp; Visual Science. 39 (3), 537-543 (1998).</li><li>Shestopalov, V. I., Bassnett, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+autofluorescent+proteins+reveals+a+novel+protein+permeable+pathway+between+cells+in+the+lens+core.">Expression of autofluorescent proteins reveals a novel protein permeable pathway between cells in the lens core.</a> Journal of Cell Science. 113 (11), 1913-1921 (2000).</li><li>Liu, J., Xu, J., Gu, S., Nicholson, B. J., Jiang, J. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aquaporin+0+enhances+gap+junction+coupling+via+its+cell+adhesion+function+and+interaction+with+connexin+50.">Aquaporin 0 enhances gap junction coupling via its cell adhesion function and interaction with connexin 50.</a> Journal of Cell Science. 124 (2), 198-206 (2011).</li><li>Li, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+second+extracellular+domain+of+connexin+50+is+important+for+in+cell+adhesion,+lens+differentiation,+and+adhesion+molecule+expression.">The second extracellular domain of connexin 50 is important for in cell adhesion, lens differentiation, and adhesion molecule expression.</a> Journal of Biological Chemistry. 299 (3), 102965 (2023).</li><li>Shestopalov, V. I., Bassnett, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exogenous+gene+expression+and+protein+targeting+in+lens+fiber+cells.">Exogenous gene expression and protein targeting in lens fiber cells.</a> Investigative Ophthalmology &amp; Visual Science. 40 (7), 1435-1443 (1999).</li><li>Shestopalov, V. I., Bassnett, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+organization+of+primary+lens+fiber+cells.">Three-dimensional organization of primary lens fiber cells.</a> Investigative Ophthalmology &amp; Visual Science. 41 (3), 859-863 (2000).</li><li>Hughes, S. H., Greenhouse, J. J., Petropoulos, C. J., Sutrave, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adaptor+plasmids+simplify+the+insertion+of+foreign+DNA+into+helper-independent+retroviral+vectors.">Adaptor plasmids simplify the insertion of foreign DNA into helper-independent retroviral vectors.</a> Journal of Virology. 61 (10), 3004-3012 (1987).</li><li>Yan, R. T., Wang, S. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+high-titer+RCAS+retrovirus.">Production of high-titer RCAS retrovirus.</a> Methods in Molecular Biology. 884, 193-199 (2012).</li><li>Kingston, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Introduction+of+DNA+into+mammalian+cells.">Introduction of DNA into mammalian cells.</a> Current Protocols in Molecular Biology. 64 (1), 1-95 (2003).</li><li>Li, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studying+macrophage+activation+in+immune-privileged+lens+through+CSF-1+protein+intravitreal+injection+in+mouse+model.">Studying macrophage activation in immune-privileged lens through CSF-1 protein intravitreal injection in mouse model.</a> STAR Protocols. 3 (1), 101060 (2022).</li><li>Hamburger, V., Hamilton, H. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+series+of+normal+stages+in+the+development+of+the+chick+embryo.">A series of normal stages in the development of the chick embryo.</a> Developmental Dynamics. 195 (4), 231-272 (1992).</li><li>Hallagan, J. B., Allen, D. C., Borzelleca, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+safety+and+regulatory+status+of+food,+drug+and+cosmetics+colour+additives+exempt+from+certification.">The safety and regulatory status of food, drug and cosmetics colour additives exempt from certification.</a> Food and Chemical Toxicology. 33 (6), 515-528 (1995).</li><li>Okada, T. S., Eguchi, G., Takeichi, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+expression+of+differentiation+by+chicken+lens+epithelium+in+in+vitro+cell+culture.">The expression of differentiation by chicken lens epithelium in in vitro cell culture.</a> Development, Growth &amp; Differentiation. 13 (4), 323-336 (1971).</li><li>Menko, A. S., Klukas, K. A., Johnson, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chicken+embryo+lens+cultures+mimic+differentiation+in+the+lens.">Chicken embryo lens cultures mimic differentiation in the lens.</a> Developmental Biology. 103 (1), 129-141 (1984).</li><li>Parreno, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methodologies+to+unlock+the+molecular+expression+and+cellular+structure+of+ocular+lens+epithelial+cells.">Methodologies to unlock the molecular expression and cellular structure of ocular lens epithelial cells.</a> Frontiers in Cell and Developmental Biology. 10, 983178 (2022).</li><li>Edwards, A., Gupta, J. D., Harley, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photomicrographic+evaluation+of+drug-induced+cataracts+in+cultured+embryonic+chick+lens.">Photomicrographic evaluation of drug-induced cataracts in cultured embryonic chick lens.</a> Experimental Eye Research. 15 (4), 495-498 (1973).</li><li>Musil, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primary+cultures+of+embryonic+chick+lens+cells+as+a+model+system+to+study+lens+gap+junctions+and+fiber+cell+differentiation.">Primary cultures of embryonic chick lens cells as a model system to study lens gap junctions and fiber cell differentiation.</a> Journal of Membrane Biology. 245 (7), 357-368 (2012).</li><li>West-Mays, J. A., Pino, G., Lovicu, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+use+of+the+lens+epithelial+explant+system+to+study+lens+differentiation+and+cataractogenesis.">Development and use of the lens epithelial explant system to study lens differentiation and cataractogenesis.</a> Progress in Retinal and Eye Research. 29 (2), 135-143 (2010).</li><li>Upreti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lens+epithelial+explants+treated+with+vitreous+humor+undergo+alterations+in+chromatin+landscape+with+concurrent+activation+of+genes+associated+with+fiber+cell+differentiation+and+innate+immune+response.">Lens epithelial explants treated with vitreous humor undergo alterations in chromatin landscape with concurrent activation of genes associated with fiber cell differentiation and innate immune response.</a> Cells. 12 (3), 501 (2023).</li><li>Walker, J. L., Wolff, I. M., Zhang, L., Menko, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+SRC+kinases+signals+induction+of+posterior+capsule+opacification.">Activation of SRC kinases signals induction of posterior capsule opacification.</a> Investigative Ophthalmology &amp; Visual Science. 48 (5), 2214-2223 (2007).</li><li>Briskin, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heritable+retroviral+transgenes+are+highly+expressed+in+chickens.">Heritable retroviral transgenes are highly expressed in chickens.</a> Proceedings of the National Academy of Sciences of the United States of America. 88 (5), 1736-1740 (1991).</li><li>Hughes, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RCAS+vector+system.">The RCAS vector system.</a> Folia Biologica. 50 (3-4), 107-119 (2004).</li></ol>

يعلن المؤلفون أن البحث قد أجري في غياب أي علاقات تجارية أو مالية يمكن تفسيرها على أنها تضارب محتمل في المصالح.

يوفر هذا النموذج التجريبي الفرصة للتعبير عن البروتين (البروتينات) ذات الأهمية في العدسة السليمة مما يؤدي إلى دراسة الأهمية الوظيفية لهذه البروتينات في بنية العدسة ووظيفتها. يعتمد نموذج الحقن المجهري للفرخ الجنيني جزئيا على عمل Fekete et. al.6 وتم تطويره بواسطة Jiang et. al.8</sup...

الهدف من هذا البروتوكول هو وصف منهجية الحقن المجهري لعدسة الدجاج الجنينية ل RCAS (A) (ساركوما الطيور / الفيروس القهقري A المختص بالتكرار). لقد ثبت أن التوصيل الفعال للفيروسات القهقرية في عدسة الدجاج الجنينية أداة واعدة للدراسة في الجسم الحي للآلية الجزيئية ووظيفة بنية بروتينات العدسة في فسيولوجيا العدسة الطبيعية والحالات المرضية والتطور. علاوة على ذلك ، يمكن استخدام هذا النموذج التجريبي لتحديد الأهداف العلاجية وفحص الأدوية لحالات مثل إعتام عدسة العين الخلقي البشري. إجمالا ، يهدف هذا البروتوكول إلى وضع الخطوات اللازمة لتطوير منصة قابلة للتخصيص لدراسة بروتينات العدسة.
الكتاكيت الجنينية (Gallus domesticus) ، بسبب تشابهها في بنية العدسة ووظيفتها مع العدسة البشرية ، هي نموذج حيواني راسخ لدراسة تطور العدسة وعلم وظائف الأعضاء1،2،3،4. يعتبر استخدام الفيروس القهقري للطيور RCAS (A) المختص بالتكرار نظاما فعالا للغاية وسريعا وقابلا للتخصيص للتعبير عن البروتينات الخارجية في أجنة الصيصان. والجدير بالذكر أن لديها قدرة فريدة على حصر نقل الجينات المستهدفة في خلايا ألياف العدسة التكاثرية دون الحاجة إلى محفزات خاصة بالأنسجة ، باستخدام الإطار الزمني الفريد للتطور الجنيني الذي يسمح فيه وجود تجويف العدسة الفارغ بالحقن المجهري RCAS (A) في الموقع المقيد للتعبير عن البروتينات الخارجية داخل خلايا ألياف العدسة التكاثرية5 ، 6,7,8.
يعتمد إجراء الحقن المجهري لجنين الفرخ ، الموصوف بعمق هنا ، جزئيا في الأصل على عمل Fekete et. al.6 وتطويرها كذلك من قبل جيانغ وآخرون. AL.8 وقد تم استخدامه كوسيلة لإدخال كل من البلازميدات الفيروسية وغير الفيروسية في عدسة الكتاكيت الجنينية1،9،10،11،12،13. بشكل عام ، يوضح العمل السابق إمكانية استخدام هذه المنهجية لدراسة تطور العدسة ، والتمايز ، والاتصال الخلوي ، وتطور المرض ، واكتشاف واختبار الأهداف العلاجية للحالات المرضية للعدسة مثل إعتام عدسة العين.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.22 &#181;m Filter</td>
			<td>Corning</td>
			<td>431118</td>
			<td>For removing cellular debris from media</td>
		</tr>
		<tr>
			<td>35 mm x 10 mm Culture Dish</td>
			<td>FisherScientific</td>
			<td>50-202-030</td>
			<td>For using during microinjection</td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Fisherbrand</td>
			<td>13-100-676</td>
			<td>Spinning down solution</td>
		</tr>
		<tr>
			<td>Constructs</td>
			<td>GENEWIZ</td>
			<td>-</td>
			<td>For generation of constructs</td>
		</tr>
		<tr>
			<td>Dissecting microscope</td>
			<td>AmScope</td>
			<td>SM-4TZ-144A</td>
			<td>Visualization of lens for microinjection</td>
		</tr>
		<tr>
			<td>DNA PCR primers</td>
			<td>Integrated DNA Technologies</td>
			<td>-</td>
			<td>Generation of primers: 
			 
			Intracellular loop (IL)-deleted Cx50 (residues 1&#8211;97 and 149&#8211;400) as well as the Cla12NCO vector were obtained with the following pair of primers: sense, CTCCTGAGAACCTACATCCT; antisense, CACCGCATGCCCAAAGTACAC 
			 
			ILs of Cx43 (residues 98&#8211;150) and Cx46 (residues 98&#8211;166) were&#160; obtained with the following pairs of primers: sense, TACGTGATGAGGAAAGAAGAG; antisense, TCCTCCACGCATCTTTACCTTG; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCC AT ACGGATTC, respectively 
			 
			Cla12NCO-Cx43 construct template was obtained with the following pair of primers: sense, CTGCTTCGTACTTACATCATC; antisense, GAACAC GTGCGCCAGGTAC 
			 
			ILs of Cx50 (residues 98&#8211;148) or Cx46 (residues 98&#8211;166) were cloned by using Cla12NCO-Cx50 and Cla12NCO-Cx46 constructs as the templates with the following pair of primers: sense, CACCATGTCCGCATGGAGGAGA; antisense, GGTCCCC TC CAGGCGAAAC; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCCATACGGATTC, respectively</td>
		</tr>
		<tr>
			<td>Drummond Nanoject II Automatic Nanoliter Injector</td>
			<td>Drummond Scientific</td>
			<td>3-000-204</td>
			<td>Microinjection Pipet</td>
		</tr>
		<tr>
			<td>Dual Gooseneck Lights Microscope Illuminator</td>
			<td>AmScope</td>
			<td>LED-50WY</td>
			<td>Lighting for visualization</td>
		</tr>
		<tr>
			<td>Dulbecco&#8217;s Modified Eagle Medium (DMEM)</td>
			<td>Invitrogen</td>
			<td></td>
			<td>For cell culture</td>
		</tr>
		<tr>
			<td>Egg Holder</td>
			<td>-</td>
			<td>-</td>
			<td>Homemade styrofoam rings with 2-inch diameter and one-half inch height</td>
		</tr>
		<tr>
			<td>Egg Incubator</td>
			<td>GQF Manufacturing Company Inc.</td>
			<td>1502</td>
			<td>For incubation of fertilized eggs</td>
		</tr>
		<tr>
			<td>Fast Green</td>
			<td>Fisher scientific</td>
			<td>F99-10</td>
			<td>For visualization of viral stock injection</td>
		</tr>
		<tr>
			<td>Fertilized white leghorn chicken eggs</td>
			<td>Texas A&#38;M University</td>
			<td>N/A</td>
			<td>Animal model of choice for microinjection (https://posc.tamu.edu/fertile-egg-orders/)</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Hyclone Laboratories</td>
			<td></td>
			<td>For cell culture</td>
		</tr>
		<tr>
			<td>Fluorescein-conjugated anti-mouse IgG</td>
			<td>Jackson ImmunoResearch</td>
			<td>115-095-003</td>
			<td>For anti-FLAG&#160; 1:500</td>
		</tr>
		<tr>
			<td>Forceps</td>
			<td>FisherScientific</td>
			<td>22-327379</td>
			<td>For moving things around and isolation</td>
		</tr>
		<tr>
			<td>Glass capillaries</td>
			<td>Sutter Instruments</td>
			<td>B100-75-10</td>
			<td>Glass micropipette for microinjection (O.D. 1.0 mm, I.D. 0.75 mm, 10 cm length)</td>
		</tr>
		<tr>
			<td>Lipofectamine</td>
			<td>Invitrogen</td>
			<td>L3000001</td>
			<td>For transfection</td>
		</tr>
		<tr>
			<td>Manual vertical micropipette puller</td>
			<td>Sutter Instruments</td>
			<td>P-30</td>
			<td>To obtain glass micropipette of the correct size</td>
		</tr>
		<tr>
			<td>Microcentrifuge Tubes</td>
			<td>FisherScientific</td>
			<td>02-682-004</td>
			<td>Dissolving solution</td>
		</tr>
		<tr>
			<td>Microscope</td>
			<td>Keyence</td>
			<td>BZ-X710</td>
			<td>For imaging staining</td>
		</tr>
		<tr>
			<td>Parafilm</td>
			<td>FisherScientific</td>
			<td>03-448-254</td>
			<td>Placing solution</td>
		</tr>
		<tr>
			<td>Penicillin/Streptomycin</td>
			<td>Invitrogen</td>
			<td></td>
			<td>For cell culture</td>
		</tr>
		<tr>
			<td>Pico-Injector</td>
			<td>Harvard Apparatus</td>
			<td>PLI-100</td>
			<td>For delivering small liquid volumes precisely through micropipettes by applying a regulated pressure for a digitally set period of time</td>
		</tr>
		<tr>
			<td>rabbit anti-chick AQP0</td>
			<td>Self generated</td>
			<td>-</td>
			<td>Jiang JX, White TW, Goodenough DA, Paul DL. Molecular cloning and functional characterization of chick lens fiber connexin 45.6. Mol Biol Cell. 1994 Mar;5(3):363-73. doi: 10.1091/mbc.5.3.363.</td>
		</tr>
		<tr>
			<td>rabbit anti-FLAG antibody</td>
			<td>Rockland Immunichemicals</td>
			<td>600-401-383</td>
			<td>For staining FLAG</td>
		</tr>
		<tr>
			<td>Rhodamine-conjugated anti-rabbit IgG&#160;</td>
			<td>Jackson ImmunoResearch</td>
			<td>111-295-003</td>
			<td>For anti-AQP0&#160; 1:500</td>
		</tr>
		<tr>
			<td>Sponge clamping pad</td>
			<td>Sutter Instruments</td>
			<td>BX10</td>
			<td>For storage of glass micropipette</td>
		</tr>
	</tbody>
</table>

microinjection of recombinant rcas(a) retrovirus into embryonic chicken lens

الدجاج الجنيني (Gallus domesticus) هو نموذج حيواني راسخ لدراسة تطور العدسة وعلم وظائف الأعضاء ، نظرا لدرجة تشابهها العالية مع العدسة البشرية. RCAS (A) هو فيروس ارتجاعي دجاج مؤهل للتكاثر يصيب الخلايا المنقسمة ، والذي يعمل كأداة قوية لدراسة التعبير في الموقع ووظيفة البروتينات البرية والطافرة أثناء تطوير العدسة عن طريق الحقن المجهري في التجويف الفارغ لحويصلة العدسة في مراحل النمو المبكرة ، مما يقصر عمله على خلايا العدسة المتكاثرة المحيطة. بالمقارنة مع الأساليب الأخرى ، مثل النماذج المعدلة وراثيا والثقافات خارج الجسم الحي ، فإن استخدام الفيروس القهقري للطيور RCAS (A) المختص بالتكرار يوفر نظاما فعالا للغاية وسريعا وقابلا للتخصيص للتعبير عن البروتينات الخارجية في أجنة الصيصان. على وجه التحديد ، يمكن أن يقتصر نقل الجينات المستهدف على خلايا ألياف العدسة التكاثرية دون الحاجة إلى محفزات خاصة بالأنسجة. في هذه المقالة ، سنلقي نظرة عامة موجزة على الخطوات اللازمة لإعداد RCAS (A) للفيروس القهقري المؤتلف ، ونقدم نظرة عامة مفصلة وشاملة على إجراء الحقن المجهري ، ونقدم نتائج عينة من التقنية.

The goal of this protocol is to describe the methodology of embryonic chicken lens microinjection of an RCAS(A) (replication-competent avian sarcoma/leukosis retrovirus A). Effective retroviral delivery in an embryonic chicken lens has been demonstrated to be a promising tool for the in vivo study of the molecular mechanism and structure-function of lens proteins in normal lens physiology, pathological conditions, and development. Moreover, this experimental model could be used for the identification of therapeutic targets and drug screening for conditions such as human congenital cataracts. In all, this protocol aims to lay out the necessary steps for the development of a customizable platform for the study of lens proteins.
Embryonic chicks (Gallus domesticus), owing to their similarity in lens structure and function with the human lens, are a well-established animal model for the study of lens development and physiology1,2,3,4. The use of an RCAS(A) replication-competent avian retrovirus has been regarded as a highly effective, rapid, and customizable system to express exogenous proteins in chick embryos. Notably, it has a unique ability to confine the target gene transfer to proliferative lens fiber cells without the need for tissue-specific promoters, using the unique embryonic development time frame in which the presence of empty lens lumen permits in situ RCAS(A) microinjection into the restricted site for the expression of exogenous proteins within proliferative lens fiber cells5,6,7,8.
The chick embryo microinjection procedure, described in-depth here, is based originally partially on the work of Fekete et. al.6 and further developed by Jiang et. al.8 and has been utilized as a means of introducing both viral and nonviral plasmids into the lens of embryonic chicks1,9,10,11,12,13. Overall, the previous work demonstrates the potential of utilizing this methodology to study lens development, differentiation, cellular communication, and disease progression, and for the discovery and testing of therapeutic targets for lens pathological conditions such as cataracts.

تسليط الضوء على المؤلف: التحقيق في تطوير العدسة ووظيفتها من خلال الحقن المجهري للفيروس القهقري RCAS (A) في عدسة الدجاج الجنينية 

الحقن المجهري للفيروس القهقري RCAS (A) المؤتلف في عدسة الدجاج الجنينية

The presented methodology of embryonic chicken lens microinjection of a RCAS retrovirus is meant as a tool for studying in situ function and expression of proteins during lens development. Compared to other approaches, such as transgenic models and ex vivo cultures, the RCAS replication-competent avian retrovirus provides a highly-effective, rapid, and customizable system for expressing exogenous proteins in chick embryos. Targeted gene transfer can be confined to proliferative lens fiber cells without the need for promoters.There is prominent potential for utilizing this methodology to study lens development, differentiation, cellular communication, and disease progression, and for the discovery and testing of therapeutic targets for lens pathological conditions such as cataracts.

بعد تحديد بروتين (بروتينات) مستهدف محدد وتحديد تسلسل (تسلسلات) الجينات المرتبطة به ، يتضمن النهج التجريبي الشامل استنساخ تسلسل (تسلسلات) الجينات في ناقل RCAS (A) للفيروسات القهقرية عن طريق الاستنساخ الأولي إلى ناقل محول ، يليه ناقل فيروسي. ثانيا ، يتم تحضير الجسيمات الفيروسية عالية العيار باس...

Watch this Scientific Journal Video about Investigating Lens Development and Function Through Microinjection of RCASA Retrovirus in Embryonic Chicken Lens at JoVE.com

تصف ورقة البروتوكول هذه منهجية الحقن المجهري لعدسة الدجاج الجنينية لفيروس RCAS (A) كأداة لدراسة الوظيفة في الموقع والتعبير عن البروتينات أثناء نمو العدسة.

Embryonic chicken (Gallus domesticus) is a well-established animal model for the study of lens development and physiology, given its high degree of ...

تهدف المنهجية المقدمة للحقن المجهري لعدسة الدجاج الجنينية لفيروس RCAS القهقري كأداة لدراسة الوظيفة في الموقع والتعبير عن البروتينات أثناء تطوير العدسة. بالمقارنة مع الأساليب الأخرى ، مثل النماذج المعدلة وراثيا والثقافات خارج الجسم الحي ، يوفر الفيروس القهقري للطيور المختص بتكرار RCAS نظاما عالي الفعالية وسريعا وقابلا للتخصيص للتعبير عن البروتينات الخارجية في أجنة الصيصان. يمكن أن يقتصر نقل الجينات المستهدف على خلايا ألياف العدسة التكاثرية دون الحاجة إلى المروجين.هناك إمكانات بارزة لاستخدام هذه المنهجية لدراسة تطور العدسة ، والتمايز ، والاتصالات الخلوية ، وتطور المرض ، واكتشاف واختبار الأهداف العلاجية للحالات المرضية للعدسة مثل إعتام عدسة العين.

microinjection-recombinant-rcasa-retrovirus-into-embryonic-chicken

Research

JoVE Journal

Biology

Microinjection of Recombinant RCAS(A) Retrovirus into Embryonic Chicken Lens

701 Views.  University of Texas Health Science Center, San Antonio. تهدف المنهجية المقدمة للحقن المجهري لعدسة الدجاج الجنينية لفيروس RCAS القهقري كأداة لدراسة الوظيفة في الموقع والتعبير عن البروتينات أثناء تطوير العدسة. بالمقارنة مع الأساليب الأخرى ، مثل النماذج المعدلة وراثيا والثقافات خارج الجسم الحي ، يوفر الفيروس القهقري للطيور المخت...

Video: تسليط الضوء على المؤلف: التحقيق في تطوير العدسة ووظيفتها من خلال الحقن المجهري للفيروس القهقري RCAS (A) في عدسة الدجاج الجنينية 

Embryonic chicken (Gallus domesticus) is a well-established animal model for the study of lens development and physiology, given its high degree of similarity with the human lens. RCAS(A) is a replication-competent chicken retrovirus that infects dividing cells, which serves as a powerful tool to study the in situ expression and function of wild-type and mutant proteins during lens development by microinjection into the empty lumen of lens vesicle at early developmental stages, restricting its action to surrounding proliferating lens cells. Compared to other approaches, such as transgenic models and ex vivo cultures, the use of an RCAS(A) replication-competent avian retrovirus provides a highly effective, rapid, and customizable system to express exogenous proteins in chick embryos. Specifically, targeted gene transfer can be confined to proliferative lens fiber cells without the need for tissue-specific promoters. In this article, we will briefly overview the steps needed for recombinant retrovirus RCAS(A) preparation, provide a detailed, comprehensive overview of the microinjection procedure, and provide sample results of the technique.

This protocol paper describes the methodology of embryonic chicken lens microinjection of an RCAS(A) retrovirus as a tool for studying in situ function and expression of proteins during lens development.

Preparation of Chicken Lens for Microinjection of an RCAS(A) Retrovirus

To begin, attach the borosilicate glass capillary to the rubber cushioned clips in the manual vertical micropipette puller. Set the heat temperature of the micropipette puller to 950 degrees Celsius and perform pre-pulling to obtain a thinner and softer glass capillary. Then set the heat temperature to 790 degrees Celsius and perform a secondary pulling to produce final micropipettes.Using a micropipette grinder, carefully sharpen the tip opening to an outer diameter of 11 micrometers. Then place the micropipettes in a sponge clamping pad inside of a glass jar. Incubate the fertilized chicken eggs until development stage 18 in a 37 degree Celsius humidified rocking incubator.Wipe down the working area thoroughly with 70%ethanol. After development, remove the eggs from the incubator. Spray the eggs with 70%ethanol and allow them to air dry.Then place the egg on an egg holder with the larger end facing upwards. Using a pair of sharp toothed forceps, carefully tap on the larger end of the eggshell to create a two centimeter diameter hole. Then remove the fragments of the egg shell.Place the egg on a dissecting microscope stage and locate the embryo. Next, use the fine dissecting forceps and scissors to cut off the amniotic membrane covering the top of the embryo. Then place a 60 millimeter Petri dish over the opening of the egg.

تحضير عدسة الدجاج للحقن المجهري لفيروس RCAS (A) القهقري

Microinjection of an RCAS(A) Retrovirus into Embryonic Chicken Lens for Expressing Exogenous Proteins 

To begin, thaw the RCAS(A)retrovirus stock on ice. To avoid clogging the micropipette, centrifuge the solution at 10, 000 G for 10 seconds at four degrees Celsius and transfer the supernatant into a new tube while keeping the solutions on ice. Place a stretched laboratory parafilm on a 35 by 10 millimeter cell culture dish and add one microliter of sterile PBS to the parafilm.Connect a prepared glass micropipette to an automatic Pico injector. Press the fill mode to fill the PBS into a micropipette and then press the inject mode to test the allocated one microliter of liquid. Place a second piece of stretched laboratory parafilm on a new cell culture dish and add one microliter of fast green stained viral stock to the film.Lower the tip of the micropipette into the viral stock, and press the fill mode to fill the micropipette with one microliter of viral stock. Under a dissecting microscope, lower the filled micropipette connected to an automatic injector into the target region of the chicken embryo lens. Then adjust the light source to provide a clear view of the lens vesicle.After ensuring the micropipette is within the correct location inside the lens lumen, inject five to 40 nanoliters of the viral stock. After injection, wait 45 seconds before gently removing the micropipette. Next, check the successful microinjection by examining the fast green dye in the empty lumen of the lens without an leakage.Following examination, seal the eggshell opening with scotch tape and place the eggs in a 37 degree Celsius humidified static incubator. This study demonstrates the histological evaluation of the chimeric connexon 50 and 43 loops through immunofluorescence. Using Anti-Flag labeling, exogenous connexons were distinguished from endogenous ones.The study also evaluates the interaction between the intracellular loop domain of connexon 50 and Aquaporin zero.