이 연구는 미국 국립보건원(NIH) 보조금: RO1 EY012085(J.X.J) 및 F32DK134051(F.M.A.)와 웰치 재단 보조금: AQ-1507(J.X.J.)의 지원을 받았습니다. 내용은 전적으로 저자의 책임이며 반드시 미국 국립보건원(National Institutes of Health)의 공식 견해를 나타내는 것은 아닙니다. 피규어는 부분적으로 Biorender.com 로 만들어졌습니다.

본 연구는 동물복지법 및 동물복지 시행 규정의 '실험동물 관리 및 이용 지침서'의 원칙에 따라 수행되었다. 모든 동물 시술은 샌안토니오에 있는 텍사스 대학교 보건 과학 센터의 기관 동물 관리 및 사용 위원회의 승인을 받았습니다. 프로토콜에 대한 개요는 그림 1을 참조하십시오. 이 프로토콜에 사용되는 모든 재료, 시약 및 기기에 대한 자세한 내용은 재료 표를 참조하십시오.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/65727/65727fig01.jpg"> 그림 1: 실험 개요. 1 . 프로토콜의 첫 번째 단계는 특정 표적 단백질의 결정, 관련 유전자 서열의 식별 및 DNA 단편 생성입니다. 2 . 접합기 벡터로의 초기 클로닝에 의한 레트로바이러스 벡터로의 유전자 서열 클로닝, 3. 바이러스 벡터에 뒤따름 . 4 . 패키징 셀을 사용하여 수확 및 농축하는 고역가 바이러스 입자의 준비. 5 . 이 프로토콜의 마지막 단계이자 초점은 RCAS(A) 바이러스 입자를 렌즈 내강에 미세주입하는 것입니다. <a href="https://www.jove.com/files/ftp_upload/65727/65727fig01large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
1. 고역가 재조합 레트로바이러스의 제조
<ol><li>표적 단백질 DNA 단편을 만들기 위한 중합효소연쇄반응(PCR) NOTE: 이 섹션은 표적 수정체 단백질에 해당하는 DNA 염기서열을 증폭하는 것을 목표로 합니다. 자세한 내용은 7,8을 참조하십시오.<ol><li>관심 단백질에 해당하는 PCR용 프라이머를 설계하고, FLAG 에피토프 서열(5'-GACTACAAGGACGACGATGACAAG-3'), 정지 코돈 및 CLa12NCO의 폴리링커 영역 내부에 존재하는 제한 효소 부위(즉, EcoRI)를 포함하거나 포함하지 않고 카르복실 말단-프레임 내 DNA 단편을 적절한 제한 효소에 대한 서열과 함께 이전에 발표된 프로토콜에 기재된 사양에 따라 1, 7,8,10,11입니다.</li>
		<li>PCR 반응10을 수행합니다. 설계된 프라이머의 센스 및 안티센스 100pmol을 0.5μg의 커넥신 cDNA(예: Cx50, Cx43 또는 키메라 Cx50*43L 조합)와 결합하여 선택한 PCR 반응 완충액에 결합합니다. 94°C에서 1분, 58°C에서 1분, 72°C에서 각각 1분으로 구성된 30사이클을 수행한 다음 10°C에서 72분 동안 최종 연장을 수행합니다.</li>
		<li>겔 정제 키트로 PCR 산물을 분리하고 정제합니다.</li>
		<li>정제된 PCR 산물을 제조사의 지침에 따라 선택한 제한 효소를 사용하여 분해합니다.</li>
	</ol></li>
	<li>어댑터 플라스미드에 DNA 삽입물 클로닝 참고: DNA 단편을 어댑터 벡터에 삽입하면 RCAS(A) 벡터 안정성을 증가시키기 위해 도우미 세포/바이러스가 필요하지 않습니다14. 자세한 내용은 7,8을 참조하십시오.<ol><li>Subclone DNA 단편을 끈적 끈적한 말단 연결 반응을 사용하여 어댑터 플라스미드, Cla12NCO로 만듭니다. PCR 단편을 제한효소 및 Cla12NCO와 2-5:1 비율로 혼합합니다. 유능한 세포를 사용하여 결찰 및 DNA 형질전환을 수행합니다.</li>
		<li>DNA 분리 키트를 사용하여 DNA를 분리합니다.</li>
		<li>정확성을 보장하기 위해 DNA 염기서열을 분석합니다.</li>
	</ol></li>
	<li>RCAS(A) 바이러스 벡터로 클로닝 참고: DNA 단편은 발달 중인 병아리 배아14,15의 세포로 유전자의 안정적인 형질도입을 위해 차량(RCAS(A) 레트로바이러스)에 삽입됩니다. 자세한 내용은 7,8,15를 참조하십시오.<ol><li>관심 함유 벡터의 Cla12NCO-DNA 단편을 ClaI(DNA 1μg당 1단위)으로 절단하고 단편을 겔 분리합니다.</li>
		<li>DNA 단편을 ClaI-선형화된 RCAS(A) 플라스미드로 서브클로닝합니다. 제한효소 SalI을 사용하여 RCAS(A) 플라스미드의 ClaI 부위를 구별합니다.</li>
		<li>ClaI 및 SalI 제한 효소를 사용한 분해에 의해 작제물에 삽입된 단편의 올바른 방향을 확인합니다.</li>
		<li>DNA 분리 키트를 사용하여 DNA를 분리합니다.</li>
		<li>DNA 농도를 결정합니다.</li>
	</ol></li>
	<li>병아리 배아 섬유아세포(CEF) 세포의 형질주입 및 RCAS(A) 수확 참고: 바이러스 패키징 셀(CEF)은 바이러스 입자15,16을 포함하는 세포 배양 배지를 얻거나 수확하는 데 사용됩니다. 자세한 내용은 7,8,15를 참조하십시오.<ol><li>제조업체의 지침에 따라 transfection제를 사용하여 재조합 레트로바이러스 DNA 구조체로 CEF 세포를 transfection합니다.</li>
		<li>transfection된 세포의 western blotting을 수행하여 관심 단백질의 발현을 검사합니다.</li>
		<li>transfection된 세포가 밀도에 도달하면 상층액 배지를 수집하여 적절하게 처리/여과하고(0.22μm 필터를 사용하여 세포 파편을 제거하기 위해) 농축할 준비가 될 때까지 -80°C에서 보관합니다.</li>
	</ol></li>
	<li>바이러스 주식의 농도 및 적정 참고: 바이러스 입자가 포함된 세포에서 파생된 펠릿 및 대량의 배지는 여과해야 합니다. 또한 숙주 세포에 대한 바이러스의 강도를 확인하기 위해 바이러스 역가 분석을 수행해야 합니다. 자세한 내용은 6,7,8,15를 참조하십시오.<ol><li>비리온이 들어있는 배양 배지를 해동합니다.</li>
		<li>72,000× g 의 배양 배지를 4°C에서 2시간 동안 회전시킵니다.</li>
		<li>상층액을 디캔팅하고 바이러스 펠릿을 잔류(~50μL) 배지로 재현탁시키고 사용할 때까지 -80°C에서 ~10μL 바이러스 스톡에 보관합니다.</li>
		<li>역가를 위해 QT-6 또는 CEF 세포를 사용하여 바이러스 스톡을 연속적으로 희석하여 세포를 transfection합니다.</li>
		<li>합류 후 4% 포름알데히드를 사용하여 세포를 고정합니다.</li>
		<li>바이러스 개그 단백질에 대한 면역염색 또는 알칼리성 인산가수분해효소를 조직화학적으로 처리하여 역가를 얻고, 밀리리터당 (콜로니 형성 단위) CFU(CFU/mL)로 정의됩니다.</li>
	</ol></li>
</ol><img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65727/65727fig02.jpg"> 그림 2: chick lens microinjection을 위한 기기 및 설정 . (A) P-30 수동 수직 미세 전극 마이크로 피펫 풀러. (1) 유리 마이크로피펫을 당기는 모습을 보여주는 삽입물. (B) (2) 계란 부화기. 65°C 인큐베이터에서 ~68-37시간 동안 닭고기 달걀을 배양하여 레트로바이러스 주입을 위해 18단계(밀봉되고 빈 중앙 내강 포함)에 도달합니다. (C) 미세 주입 설정. (3) 조명 장비, (4) 피코 인젝터, (5) 해부 현미경, (6) 드러먼드 마이크로 매니퓰레이터, (7) 시각화용 컴퓨터/카메라. <a href="https://www.jove.com/files/ftp_upload/65727/65727fig02large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
2. 병아리 렌즈 미세주입
<ol><li>소모품 준비<ol><li>미세주입을 위한 유리 마이크로피펫의 제조17 참고: 유리 모세관은 미세주입을 위해 팁 포인트와 외경(OD)이 ~11μm인 유리 마이크로피펫을 만드는 데 사용됩니다. 설정은 그림 2A에 나와 있습니다.<ol><li>붕규산 유리 모세관을 수동 수직 마이크로피펫 풀러의 고무 완충 클립에 부착합니다.</li>
			<li>가열 온도(HEAT 1)를 950°C로 설정하고 프리풀링을 수행하여 더 얇고 부드러운 유리 모세관을 얻습니다.</li>
			<li>가열 온도(HEAT 2)를 790°C로 설정하고 2차 당김을 수행하여 최종 마이크로피펫을 생성합니다.</li>
			<li>마이크로피펫 그라인더를 사용하여 팁 개구부를 ~11μm의 OD로 날카롭게 합니다.</li>
			<li>향후 실험을 위해 유리 마이크로피펫을 유리병 안의 스폰지 클램핑 패드에 보관하십시오.</li>
		</ol></li>
		<li>발달 단계까지 수정란의 부화 18 참고: 수정체 발달 중 배아 발달 ~65-68시간에 수정체는 외배엽에서 분리되어 중앙 내강이 있는 밀봉된 소포를 형성합니다. 이 빈 수정체에 주입하면 증식성 수정체 세포에 대한 발현이 제한되는 루멘 프라임이 7,8,18.<ol><li>65°C 가습 로킹 인큐베이터에서 ~68-37시간 동안 수정된 닭고기 계란을 배양합니다(그림 2B).</li>
		</ol></li>
	</ol></li>
	<li>닭고기 달걀 개봉 알림: 이 단계에서는 미세 주입을 위한 배아의 식별 및 노출에 대해 설명합니다. 자세한 내용은 7,8을 참조하십시오.<ol><li>70% 에탄올로 작업 영역을 철저히 닦으십시오.</li>
		<li>인큐베이터에서 계란을 꺼내 70% 에탄올을 강하게 뿌린 다음 자연 건조시킵니다.</li>
		<li>달걀의 큰 쪽 끝이 위를 향하도록 달걀을 달걀 홀더에 놓습니다.</li>
		<li>한 쌍의 날카로운 이빨이 있는 집게를 사용하여 달걀 껍질을 조심스럽게 두드리고 달걀 껍질 조각을 제거하여 달걀의 더 큰 쪽 끝에 ~2cm 직경의 구멍을 만듭니다(그림 3A).</li>
		<li>해부 현미경을 사용하여 배아를 찾습니다.</li>
		<li>배아와 병아리 수정체를 찾으면 해부 현미경과 미세 해부 겸자 및 가위를 사용하여 배아 상단을 바로 덮고 있는 양막을 잘라냅니다(그림 3B). 알림: 너무 넓게 자르지 마십시오(배아가 ~0.5cm x 0.5cm가 노출될 정도만) 그렇지 않으면 배아가 난황 덩어리 속으로 가라앉을 수 있습니다. 또한 가능하면 혈관을 만지지 마십시오.</li>
		<li>다음 단계를 준비하기 위해 60mm 페트리 접시로 달걀 입구를 덮습니다.</li>
	</ol></li>
	<li>농축된 바이러스 스톡의 미세 주입 참고: transduction을 위한 표적 단백질 DNA 단편을 포함하는 바이러스 입자는 렌즈 내강 내부의 세포에 삽입됩니다. 설정은 그림 2C에 나와 있습니다. 자세한 내용은 6,7,8을 참조하십시오.<ol><li>바이러스 성 주식 주식을 얼음 위에서 해동하십시오.</li>
		<li>주입 중 바이러스 스톡을 시각화하기 위해 10x Fast green 1μL를 10μL가 포함된 바이러스 스톡 바이알 1개에 희석합니다.</li>
		<li>유리 마이크로피펫을 막을 수 있는 용해되지 않은 물질의 큰 덩어리가 없도록 하려면 용액을 얼음 위에 유지하면서 4°C에서 10,000× g 에서 10초 동안 원심분리하여 "큰 덩어리"를 펠릿화하고 상층액을 새 튜브로 옮깁니다.</li>
		<li>35mm x 10mm 배양 접시에 늘어난 실험실 파라필름을 놓고 필름 위에 1μL의 멸균 식염수(PBS)를 추가합니다(멸균되지 않음, 덮인 면이 "깨끗한" 것으로 간주됨).</li>
		<li>준비된 유리 마이크로피펫을 자동 피코 주입기에 연결합니다.</li>
		<li>충전 모드를 눌러 멸균 식염수(PBS)를 유리 마이크로피펫에 채운 다음 주입 모드를 사용하여 할당된 1μL의 액체를 테스트합니다.</li>
		<li>새로운 35mm x 10mm 세포 배양 접시의 표면에 두 번째 늘어난 실험실 파라필름을 놓고 필름 위에 1μL의 Fast green-stained viral stock을 추가합니다.</li>
		<li>마이크로피펫의 끝을 바이러스 스톡으로 내리고 충전 모델을 눌러 유리 마이크로피펫에 ~1μL의 바이러스 스톡을 채웁니다. 알림: 건조를 방지하려면 절차가 일시 중지될 때마다 채워진 마이크로피펫의 끝을 멸균 식염수(PBS)에 넣으십시오.</li>
		<li>자동 주입기에 연결된 충전된 유리 마이크로피펫을 해부 현미경의 도움을 받아 배아 수정체 내강의 대상 영역으로 내립니다.</li>
		<li>렌즈 소포의 윤곽을 명확하게 시각화할 수 있도록 광원을 조정합니다. 알림: 오른쪽 렌즈의 루멘(위를 향함)은 일반적으로 주입에 사용되며 왼쪽(아래를 향함)은 반대측 대조군으로 그대로 유지됩니다.</li>
		<li>마이크로피펫의 위치가 렌즈 내강 내부의 올바른 위치에 있는지 확인한 후 5-40nL의 바이러스 스톡을 주입합니다(그림 3C). 알림: 최적의 주입 배치를 위해서는 연습이 매우 필요합니다.</li>
		<li>~45초 동안 기다린 다음 유리 마이크로피펫을 부드럽게 제거합니다.</li>
		<li>누출 없이 렌즈의 빈 루멘에 남아 있어야 하는 Fast Green 염료를 검사하여 해부 현미경을 사용하여 렌즈 루멘에 성공적으로 미세 주입되었는지 확인합니다.</li>
		<li>주입 절차 후 달걀 껍질 입구를 스카치 테이프로 밀봉합니다.</li>
		<li>수정체 박리를 위해 원하는 배아 연령에 도달할 때까지 회전 동작 없이 배아를 37°C 가습 인큐베이터로 되돌립니다.</li>
	</ol></li>
</ol><img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/65727/65727fig03.jpg"> 그림 3: 미세주입 병아리 준비 및 개략도 . (A) 닭고기 달걀 열기. (B) 양막의 절단. (C) 치킨 렌즈 루멘 미세주입 개략도. <a href="https://www.jove.com/files/ftp_upload/65727/65727fig03large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

닭 수정체 발달 중 단백질 발현 연구

<ol>
	<li>Li, Z., Gu, S., Quan, Y., Varadaraj, K., Jiang, J. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+potent+embryonic+chick+lens+model+for+studying+congenital+cataracts+in+vivo.">Development of a potent embryonic chick lens model for studying congenital cataracts in vivo.</a> Communications Biology. 4 (1), 325 (2021).</li><li>Chen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=&#947;-Crystallins+of+the+chicken+lens:+remnants+of+an+ancient+vertebrate+gene+family+in+birds.">&#947;-Crystallins of the chicken lens: remnants of an ancient vertebrate gene family in birds.</a> The FEBS Journal. 283 (8), 1516-1530 (2016).</li><li>Coulombre, A. J., Coulombre, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lens+development.+I.+Role+of+the+lens+in+eye+growth.">Lens development. I. Role of the lens in eye growth.</a> Journal of Experimental Zoology. 156 (1), 39-47 (1964).</li><li>McKeehan, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+portions+of+the+chick+lens+without+contact+with+the+optic+cup.">Induction of portions of the chick lens without contact with the optic cup.</a> The Anatomical Record. 132 (3), 297-305 (1958).</li><li>Kothlow, S., Schenk-Weibhauser, K., Ratcliffe, M. J., Kaspers, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prolonged+effect+of+BAFF+on+chicken+B+cell+development+revealed+by+RCAS+retroviral+gene+transfer+in+vivo.">Prolonged effect of BAFF on chicken B cell development revealed by RCAS retroviral gene transfer in vivo.</a> Molecular immunology. 47 (7-8), 1619-1628 (2010).</li><li>Fekete, D. M., Cepko, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication-competent+retroviral+vectors+encoding+alkaline+phosphatase+reveal+spatial+restriction+of+viral+gene+expression/transduction+in+the+chick+embryo.">Replication-competent retroviral vectors encoding alkaline phosphatase reveal spatial restriction of viral gene expression/transduction in the chick embryo.</a> Molecular and Cellular Biology. 13 (4), 2604-2613 (1993).</li><li>Jiang, J. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+retroviruses+to+express+connexins.">Use of retroviruses to express connexins.</a> Methods in Molecular Biology. , 159-174 (2001).</li><li>Jiang, J. X., Goodenough, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+expression+of+connexins+in+embryonic+chick+lens.">Retroviral expression of connexins in embryonic chick lens.</a> Investigative Ophthalmology &amp; Visual Science. 39 (3), 537-543 (1998).</li><li>Shestopalov, V. I., Bassnett, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+autofluorescent+proteins+reveals+a+novel+protein+permeable+pathway+between+cells+in+the+lens+core.">Expression of autofluorescent proteins reveals a novel protein permeable pathway between cells in the lens core.</a> Journal of Cell Science. 113 (11), 1913-1921 (2000).</li><li>Liu, J., Xu, J., Gu, S., Nicholson, B. J., Jiang, J. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aquaporin+0+enhances+gap+junction+coupling+via+its+cell+adhesion+function+and+interaction+with+connexin+50.">Aquaporin 0 enhances gap junction coupling via its cell adhesion function and interaction with connexin 50.</a> Journal of Cell Science. 124 (2), 198-206 (2011).</li><li>Li, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+second+extracellular+domain+of+connexin+50+is+important+for+in+cell+adhesion,+lens+differentiation,+and+adhesion+molecule+expression.">The second extracellular domain of connexin 50 is important for in cell adhesion, lens differentiation, and adhesion molecule expression.</a> Journal of Biological Chemistry. 299 (3), 102965 (2023).</li><li>Shestopalov, V. I., Bassnett, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exogenous+gene+expression+and+protein+targeting+in+lens+fiber+cells.">Exogenous gene expression and protein targeting in lens fiber cells.</a> Investigative Ophthalmology &amp; Visual Science. 40 (7), 1435-1443 (1999).</li><li>Shestopalov, V. I., Bassnett, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+organization+of+primary+lens+fiber+cells.">Three-dimensional organization of primary lens fiber cells.</a> Investigative Ophthalmology &amp; Visual Science. 41 (3), 859-863 (2000).</li><li>Hughes, S. H., Greenhouse, J. J., Petropoulos, C. J., Sutrave, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adaptor+plasmids+simplify+the+insertion+of+foreign+DNA+into+helper-independent+retroviral+vectors.">Adaptor plasmids simplify the insertion of foreign DNA into helper-independent retroviral vectors.</a> Journal of Virology. 61 (10), 3004-3012 (1987).</li><li>Yan, R. T., Wang, S. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+high-titer+RCAS+retrovirus.">Production of high-titer RCAS retrovirus.</a> Methods in Molecular Biology. 884, 193-199 (2012).</li><li>Kingston, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Introduction+of+DNA+into+mammalian+cells.">Introduction of DNA into mammalian cells.</a> Current Protocols in Molecular Biology. 64 (1), 1-95 (2003).</li><li>Li, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studying+macrophage+activation+in+immune-privileged+lens+through+CSF-1+protein+intravitreal+injection+in+mouse+model.">Studying macrophage activation in immune-privileged lens through CSF-1 protein intravitreal injection in mouse model.</a> STAR Protocols. 3 (1), 101060 (2022).</li><li>Hamburger, V., Hamilton, H. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+series+of+normal+stages+in+the+development+of+the+chick+embryo.">A series of normal stages in the development of the chick embryo.</a> Developmental Dynamics. 195 (4), 231-272 (1992).</li><li>Hallagan, J. B., Allen, D. C., Borzelleca, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+safety+and+regulatory+status+of+food,+drug+and+cosmetics+colour+additives+exempt+from+certification.">The safety and regulatory status of food, drug and cosmetics colour additives exempt from certification.</a> Food and Chemical Toxicology. 33 (6), 515-528 (1995).</li><li>Okada, T. S., Eguchi, G., Takeichi, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+expression+of+differentiation+by+chicken+lens+epithelium+in+in+vitro+cell+culture.">The expression of differentiation by chicken lens epithelium in in vitro cell culture.</a> Development, Growth &amp; Differentiation. 13 (4), 323-336 (1971).</li><li>Menko, A. S., Klukas, K. A., Johnson, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chicken+embryo+lens+cultures+mimic+differentiation+in+the+lens.">Chicken embryo lens cultures mimic differentiation in the lens.</a> Developmental Biology. 103 (1), 129-141 (1984).</li><li>Parreno, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methodologies+to+unlock+the+molecular+expression+and+cellular+structure+of+ocular+lens+epithelial+cells.">Methodologies to unlock the molecular expression and cellular structure of ocular lens epithelial cells.</a> Frontiers in Cell and Developmental Biology. 10, 983178 (2022).</li><li>Edwards, A., Gupta, J. D., Harley, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photomicrographic+evaluation+of+drug-induced+cataracts+in+cultured+embryonic+chick+lens.">Photomicrographic evaluation of drug-induced cataracts in cultured embryonic chick lens.</a> Experimental Eye Research. 15 (4), 495-498 (1973).</li><li>Musil, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primary+cultures+of+embryonic+chick+lens+cells+as+a+model+system+to+study+lens+gap+junctions+and+fiber+cell+differentiation.">Primary cultures of embryonic chick lens cells as a model system to study lens gap junctions and fiber cell differentiation.</a> Journal of Membrane Biology. 245 (7), 357-368 (2012).</li><li>West-Mays, J. A., Pino, G., Lovicu, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+use+of+the+lens+epithelial+explant+system+to+study+lens+differentiation+and+cataractogenesis.">Development and use of the lens epithelial explant system to study lens differentiation and cataractogenesis.</a> Progress in Retinal and Eye Research. 29 (2), 135-143 (2010).</li><li>Upreti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lens+epithelial+explants+treated+with+vitreous+humor+undergo+alterations+in+chromatin+landscape+with+concurrent+activation+of+genes+associated+with+fiber+cell+differentiation+and+innate+immune+response.">Lens epithelial explants treated with vitreous humor undergo alterations in chromatin landscape with concurrent activation of genes associated with fiber cell differentiation and innate immune response.</a> Cells. 12 (3), 501 (2023).</li><li>Walker, J. L., Wolff, I. M., Zhang, L., Menko, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+SRC+kinases+signals+induction+of+posterior+capsule+opacification.">Activation of SRC kinases signals induction of posterior capsule opacification.</a> Investigative Ophthalmology &amp; Visual Science. 48 (5), 2214-2223 (2007).</li><li>Briskin, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heritable+retroviral+transgenes+are+highly+expressed+in+chickens.">Heritable retroviral transgenes are highly expressed in chickens.</a> Proceedings of the National Academy of Sciences of the United States of America. 88 (5), 1736-1740 (1991).</li><li>Hughes, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RCAS+vector+system.">The RCAS vector system.</a> Folia Biologica. 50 (3-4), 107-119 (2004).</li></ol>

저자는 이 연구가 잠재적인 이해 상충으로 해석될 수 있는 상업적 또는 재정적 관계가 없는 상태에서 수행되었음을 선언합니다.

이 실험 모델은 온전한 수정체에서 관심 있는 단백질을 발현할 수 있는 기회를 제공하여 렌즈 구조 및 기능에서 이러한 단백질의 기능적 관련성을 연구할 수 있습니다. 배아 병아리 미세주입 모델은 부분적으로 Fekete 등의 연구를 기반으로 합니다. al.6 및 Jiang et에 의해 더욱 개발되었습니다. al.8 및 바이러스 플라스미드 및 작용제, 작은 간섭 RNA(siRNA) 및 펩타이?...

이 프로토콜의 목표는 RCAS(A)(복제 가능한 조류 육종/백혈병 레트로바이러스 A)의 배아 닭 렌즈 미세 주입 방법론을 설명하는 것입니다. 배아 닭 수정체에서 효과적인 레트로바이러스 전달은 정상 수정체 생리학, 병리학적 조건 및 발달에서 수정체 단백질의 분자 메커니즘 및 구조-기능에 대한 생체 내 연구를 위한 유망한 도구임이 입증되었습니다. 또한, 이 실험 모델은 인간 선천성 백내장과 같은 질환에 대한 치료 표적 식별 및 약물 스크리닝에 사용될 수 있습니다. 전체적으로, 이 프로토콜은 수정체 단백질 연구를 위한 맞춤형 플랫폼 개발에 필요한 단계를 제시하는 것을 목표로 합니다.
배아 병아리(Gallus domesticus)는 수정체 구조와 기능이 인간의 수정체와 유사하기 때문에 수정체 발달 및 생리학 연구를 위한 잘 확립된 동물 모델입니다 1,2,3,4. RCAS(A) 복제가 가능한 조류 레트로바이러스의 사용은 병아리 배아에서 외인성 단백질을 발현하는 매우 효과적이고 신속하며 맞춤형 시스템으로 간주되어 왔습니다. 특히, 빈 수정체 내강의 존재가 증식성 수정체 섬유 세포 내에서 외인성 단백질의 발현을 위해 제한된 부위에 제자리 RCAS(A) 미세주입을 허용하는 고유한 배아 발달 시간 프레임을 사용하여 조직 특이적 프로모터를 필요 없이 증식성 수정체 섬유 세포로 표적 유전자 전달을 제한하는 고유한 능력을 가지고있습니다 5, 6,7,8 참조.
여기에 자세히 설명된 병아리 배아 미세 주입 절차는 원래 부분적으로 Fekete et의 작업을 기반으로 합니다. al.6 및 Jiang et. al.8 및 배아 병아리 1,9,10,11,12,13의 수정체에 바이러스 및 비바이러스 플라스미드를 모두 도입하는 수단으로 활용되었습니다. 전반적으로, 이전 연구는 수정체 발달, 분화, 세포 통신 및 질병 진행을 연구하고 백내장과 같은 수정체 병리학적 상태에 대한 치료 표적을 발견하고 테스트하기 위해 이 방법론을 활용할 수 있는 잠재력을 보여줍니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.22 &#181;m Filter</td>
			<td>Corning</td>
			<td>431118</td>
			<td>For removing cellular debris from media</td>
		</tr>
		<tr>
			<td>35 mm x 10 mm Culture Dish</td>
			<td>FisherScientific</td>
			<td>50-202-030</td>
			<td>For using during microinjection</td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Fisherbrand</td>
			<td>13-100-676</td>
			<td>Spinning down solution</td>
		</tr>
		<tr>
			<td>Constructs</td>
			<td>GENEWIZ</td>
			<td>-</td>
			<td>For generation of constructs</td>
		</tr>
		<tr>
			<td>Dissecting microscope</td>
			<td>AmScope</td>
			<td>SM-4TZ-144A</td>
			<td>Visualization of lens for microinjection</td>
		</tr>
		<tr>
			<td>DNA PCR primers</td>
			<td>Integrated DNA Technologies</td>
			<td>-</td>
			<td>Generation of primers: 
			 
			Intracellular loop (IL)-deleted Cx50 (residues 1&#8211;97 and 149&#8211;400) as well as the Cla12NCO vector were obtained with the following pair of primers: sense, CTCCTGAGAACCTACATCCT; antisense, CACCGCATGCCCAAAGTACAC 
			 
			ILs of Cx43 (residues 98&#8211;150) and Cx46 (residues 98&#8211;166) were&#160; obtained with the following pairs of primers: sense, TACGTGATGAGGAAAGAAGAG; antisense, TCCTCCACGCATCTTTACCTTG; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCC AT ACGGATTC, respectively 
			 
			Cla12NCO-Cx43 construct template was obtained with the following pair of primers: sense, CTGCTTCGTACTTACATCATC; antisense, GAACAC GTGCGCCAGGTAC 
			 
			ILs of Cx50 (residues 98&#8211;148) or Cx46 (residues 98&#8211;166) were cloned by using Cla12NCO-Cx50 and Cla12NCO-Cx46 constructs as the templates with the following pair of primers: sense, CACCATGTCCGCATGGAGGAGA; antisense, GGTCCCC TC CAGGCGAAAC; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCCATACGGATTC, respectively</td>
		</tr>
		<tr>
			<td>Drummond Nanoject II Automatic Nanoliter Injector</td>
			<td>Drummond Scientific</td>
			<td>3-000-204</td>
			<td>Microinjection Pipet</td>
		</tr>
		<tr>
			<td>Dual Gooseneck Lights Microscope Illuminator</td>
			<td>AmScope</td>
			<td>LED-50WY</td>
			<td>Lighting for visualization</td>
		</tr>
		<tr>
			<td>Dulbecco&#8217;s Modified Eagle Medium (DMEM)</td>
			<td>Invitrogen</td>
			<td></td>
			<td>For cell culture</td>
		</tr>
		<tr>
			<td>Egg Holder</td>
			<td>-</td>
			<td>-</td>
			<td>Homemade styrofoam rings with 2-inch diameter and one-half inch height</td>
		</tr>
		<tr>
			<td>Egg Incubator</td>
			<td>GQF Manufacturing Company Inc.</td>
			<td>1502</td>
			<td>For incubation of fertilized eggs</td>
		</tr>
		<tr>
			<td>Fast Green</td>
			<td>Fisher scientific</td>
			<td>F99-10</td>
			<td>For visualization of viral stock injection</td>
		</tr>
		<tr>
			<td>Fertilized white leghorn chicken eggs</td>
			<td>Texas A&#38;M University</td>
			<td>N/A</td>
			<td>Animal model of choice for microinjection (https://posc.tamu.edu/fertile-egg-orders/)</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Hyclone Laboratories</td>
			<td></td>
			<td>For cell culture</td>
		</tr>
		<tr>
			<td>Fluorescein-conjugated anti-mouse IgG</td>
			<td>Jackson ImmunoResearch</td>
			<td>115-095-003</td>
			<td>For anti-FLAG&#160; 1:500</td>
		</tr>
		<tr>
			<td>Forceps</td>
			<td>FisherScientific</td>
			<td>22-327379</td>
			<td>For moving things around and isolation</td>
		</tr>
		<tr>
			<td>Glass capillaries</td>
			<td>Sutter Instruments</td>
			<td>B100-75-10</td>
			<td>Glass micropipette for microinjection (O.D. 1.0 mm, I.D. 0.75 mm, 10 cm length)</td>
		</tr>
		<tr>
			<td>Lipofectamine</td>
			<td>Invitrogen</td>
			<td>L3000001</td>
			<td>For transfection</td>
		</tr>
		<tr>
			<td>Manual vertical micropipette puller</td>
			<td>Sutter Instruments</td>
			<td>P-30</td>
			<td>To obtain glass micropipette of the correct size</td>
		</tr>
		<tr>
			<td>Microcentrifuge Tubes</td>
			<td>FisherScientific</td>
			<td>02-682-004</td>
			<td>Dissolving solution</td>
		</tr>
		<tr>
			<td>Microscope</td>
			<td>Keyence</td>
			<td>BZ-X710</td>
			<td>For imaging staining</td>
		</tr>
		<tr>
			<td>Parafilm</td>
			<td>FisherScientific</td>
			<td>03-448-254</td>
			<td>Placing solution</td>
		</tr>
		<tr>
			<td>Penicillin/Streptomycin</td>
			<td>Invitrogen</td>
			<td></td>
			<td>For cell culture</td>
		</tr>
		<tr>
			<td>Pico-Injector</td>
			<td>Harvard Apparatus</td>
			<td>PLI-100</td>
			<td>For delivering small liquid volumes precisely through micropipettes by applying a regulated pressure for a digitally set period of time</td>
		</tr>
		<tr>
			<td>rabbit anti-chick AQP0</td>
			<td>Self generated</td>
			<td>-</td>
			<td>Jiang JX, White TW, Goodenough DA, Paul DL. Molecular cloning and functional characterization of chick lens fiber connexin 45.6. Mol Biol Cell. 1994 Mar;5(3):363-73. doi: 10.1091/mbc.5.3.363.</td>
		</tr>
		<tr>
			<td>rabbit anti-FLAG antibody</td>
			<td>Rockland Immunichemicals</td>
			<td>600-401-383</td>
			<td>For staining FLAG</td>
		</tr>
		<tr>
			<td>Rhodamine-conjugated anti-rabbit IgG&#160;</td>
			<td>Jackson ImmunoResearch</td>
			<td>111-295-003</td>
			<td>For anti-AQP0&#160; 1:500</td>
		</tr>
		<tr>
			<td>Sponge clamping pad</td>
			<td>Sutter Instruments</td>
			<td>BX10</td>
			<td>For storage of glass micropipette</td>
		</tr>
	</tbody>
</table>

microinjection of recombinant rcas(a) retrovirus into embryonic chicken lens

배아 닭(Gallus domesticus)은 인간의 수정체와 높은 수준의 유사성을 감안할 때 수정체 발달 및 생리학 연구를 위한 잘 확립된 동물 모델입니다. RCAS(A)는 분열하는 세포를 감염시키는 복제가 가능한 닭 레트로바이러스로, 초기 발달 단계에서 수정체 소포의 빈 내강에 미세 주입하여 수정체 발달 중 야생형 및 돌연변이 단백질의 in situ 발현 및 기능을 연구하는 강력한 도구 역할을 합니다. 형질전환 모델 및 체외 배양과 같은 다른 접근법과 비교했을 때, RCAS(A) 복제가 가능한 조류 레트로바이러스를 사용하면 병아리 배아에서 외 인성 단백질을 발현하는 매우 효과적이고 신속하며 맞춤형 시스템을 제공할 수 있습니다. 특히, 표적 유전자 전달은 조직 특이적 프로모터(tissue-specific promoter) 없이 증식성 수정체 섬유 세포(proliferative lens fiber cell)로 제한될 수 있습니다. 이 글에서는 재조합 레트로바이러스 RCAS(A) 제제에 필요한 단계를 간략하게 살펴보고, 미세주입 절차에 대한 상세하고 포괄적인 개요를 제공하며, 이 기법의 샘플 결과를 제공합니다.

The goal of this protocol is to describe the methodology of embryonic chicken lens microinjection of an RCAS(A) (replication-competent avian sarcoma/leukosis retrovirus A). Effective retroviral delivery in an embryonic chicken lens has been demonstrated to be a promising tool for the in vivo study of the molecular mechanism and structure-function of lens proteins in normal lens physiology, pathological conditions, and development. Moreover, this experimental model could be used for the identification of therapeutic targets and drug screening for conditions such as human congenital cataracts. In all, this protocol aims to lay out the necessary steps for the development of a customizable platform for the study of lens proteins.
Embryonic chicks (Gallus domesticus), owing to their similarity in lens structure and function with the human lens, are a well-established animal model for the study of lens development and physiology1,2,3,4. The use of an RCAS(A) replication-competent avian retrovirus has been regarded as a highly effective, rapid, and customizable system to express exogenous proteins in chick embryos. Notably, it has a unique ability to confine the target gene transfer to proliferative lens fiber cells without the need for tissue-specific promoters, using the unique embryonic development time frame in which the presence of empty lens lumen permits in situ RCAS(A) microinjection into the restricted site for the expression of exogenous proteins within proliferative lens fiber cells5,6,7,8.
The chick embryo microinjection procedure, described in-depth here, is based originally partially on the work of Fekete et. al.6 and further developed by Jiang et. al.8 and has been utilized as a means of introducing both viral and nonviral plasmids into the lens of embryonic chicks1,9,10,11,12,13. Overall, the previous work demonstrates the potential of utilizing this methodology to study lens development, differentiation, cellular communication, and disease progression, and for the discovery and testing of therapeutic targets for lens pathological conditions such as cataracts.

저자 스포트라이트: Investigating Lens Development and Function Through Microinjection of RCAS(A) Retrovirus in Embryonic Chicken Lens(배아 닭 수정체에서 RCAS(A) 레트로바이러스의 미세주입을 통한 렌즈 발달 및 기능 조사) 

재조합 RCAS(A) 레트로바이러스를 배아 닭 수정체에 미세주입

The presented methodology of embryonic chicken lens microinjection of a RCAS retrovirus is meant as a tool for studying in situ function and expression of proteins during lens development. Compared to other approaches, such as transgenic models and ex vivo cultures, the RCAS replication-competent avian retrovirus provides a highly-effective, rapid, and customizable system for expressing exogenous proteins in chick embryos. Targeted gene transfer can be confined to proliferative lens fiber cells without the need for promoters.There is prominent potential for utilizing this methodology to study lens development, differentiation, cellular communication, and disease progression, and for the discovery and testing of therapeutic targets for lens pathological conditions such as cataracts.

특정 표적 단백질을 결정하고 관련 유전자 서열을 식별한 후, 전반적인 실험 접근법은 어댑터 벡터로의 초기 클로닝에 의해 유전자 서열을 레트로바이러스 RCAS(A) 벡터로 클로닝한 후 바이러스 벡터를 클로닝하는 것을 포함합니다. 둘째, 고역가 바이러스 입자는 비리온을 채취하고 농축하기 위해 포장 세포를 사용하여 준비됩니다. 이 처음 두 가지 주요 단계는 대체로 설명되었으며 대표적인 결과...

Watch this Scientific Journal Video about Investigating Lens Development and Function Through Microinjection of RCASA Retrovirus in Embryonic Chicken Lens at JoVE.com

이 프로토콜 논문은 렌즈 발달 중 단백질의 in situ 기능 및 발현을 연구하기 위한 도구로서 RCAS(A) 레트로바이러스의 배아 닭 수정체 미세 주입 방법론을 설명합니다.

Embryonic chicken (Gallus domesticus) is a well-established animal model for the study of lens development and physiology, given its high degree of ...

RCAS 레트로바이러스의 배아 닭 수정체 미세주입 방법론은 수정체 발달 중 단백질의 현장 기능 및 발현을 연구하기 위한 도구로 사용됩니다. 형질전환 모델 및 체외 배양과 같은 다른 접근법과 비교했을 때, RCAS 복제가 가능한 조류 레트로바이러스는 병아리 배아에서 외인성 단백질을 발현하기 위한 매우 효과적이고 신속하며 맞춤형 시스템을 제공합니다. 표적 유전자 전달은 promoter 없이 증식성 수정체 섬유 세포로 제한될 수 있습니다.이 방법론을 활용하여 수정체 발달, 분화, 세포 통신 및 질병 진행을 연구하고 백내장과 같은 수정체 병리학적 상태에 대한 치료 표적을 발견하고 테스트할 수 있는 탁월한 잠재력이 있습니다.

microinjection-recombinant-rcasa-retrovirus-into-embryonic-chicken

Research

JoVE Journal

Biology

Microinjection of Recombinant RCAS(A) Retrovirus into Embryonic Chicken Lens

697 조회수.  University of Texas Health Science Center, San Antonio. RCAS 레트로바이러스의 배아 닭 수정체 미세주입 방법론은 수정체 발달 중 단백질의 현장 기능 및 발현을 연구하기 위한 도구로 사용됩니다. 형질전환 모델 및 체외 배양과 같은 다른 접근법과 비교했을 때, RCAS 복제가 가능한 조류 레트로바이러스는 병아리 배아에서 외인성 단백질을 발현하기 위한 매우 효과적이고 신속하며 맞춤형 시스템을 제공합니다. 표적 유전자 전달은...

비디오: 저자 스포트라이트: Investigating Lens Development and Function Through Microinjection of RCAS(A) Retrovirus in Embryonic Chicken Lens(배아 닭 수정체에서 RCAS(A) 레트로바이러스의 미세주입을 통한 렌즈 발달 및 기능 조사) 

Embryonic chicken (Gallus domesticus) is a well-established animal model for the study of lens development and physiology, given its high degree of similarity with the human lens. RCAS(A) is a replication-competent chicken retrovirus that infects dividing cells, which serves as a powerful tool to study the in situ expression and function of wild-type and mutant proteins during lens development by microinjection into the empty lumen of lens vesicle at early developmental stages, restricting its action to surrounding proliferating lens cells. Compared to other approaches, such as transgenic models and ex vivo cultures, the use of an RCAS(A) replication-competent avian retrovirus provides a highly effective, rapid, and customizable system to express exogenous proteins in chick embryos. Specifically, targeted gene transfer can be confined to proliferative lens fiber cells without the need for tissue-specific promoters. In this article, we will briefly overview the steps needed for recombinant retrovirus RCAS(A) preparation, provide a detailed, comprehensive overview of the microinjection procedure, and provide sample results of the technique.

This protocol paper describes the methodology of embryonic chicken lens microinjection of an RCAS(A) retrovirus as a tool for studying in situ function and expression of proteins during lens development.

연구

생물학

Preparation of Chicken Lens for Microinjection of an RCAS(A) Retrovirus

To begin, attach the borosilicate glass capillary to the rubber cushioned clips in the manual vertical micropipette puller. Set the heat temperature of the micropipette puller to 950 degrees Celsius and perform pre-pulling to obtain a thinner and softer glass capillary. Then set the heat temperature to 790 degrees Celsius and perform a secondary pulling to produce final micropipettes.Using a micropipette grinder, carefully sharpen the tip opening to an outer diameter of 11 micrometers. Then place the micropipettes in a sponge clamping pad inside of a glass jar. Incubate the fertilized chicken eggs until development stage 18 in a 37 degree Celsius humidified rocking incubator.Wipe down the working area thoroughly with 70%ethanol. After development, remove the eggs from the incubator. Spray the eggs with 70%ethanol and allow them to air dry.Then place the egg on an egg holder with the larger end facing upwards. Using a pair of sharp toothed forceps, carefully tap on the larger end of the eggshell to create a two centimeter diameter hole. Then remove the fragments of the egg shell.Place the egg on a dissecting microscope stage and locate the embryo. Next, use the fine dissecting forceps and scissors to cut off the amniotic membrane covering the top of the embryo. Then place a 60 millimeter Petri dish over the opening of the egg.

RCAS(A) 레트로바이러스의 미세주입을 위한 치킨 렌즈의 제조

Microinjection of an RCAS(A) Retrovirus into Embryonic Chicken Lens for Expressing Exogenous Proteins 

To begin, thaw the RCAS(A)retrovirus stock on ice. To avoid clogging the micropipette, centrifuge the solution at 10, 000 G for 10 seconds at four degrees Celsius and transfer the supernatant into a new tube while keeping the solutions on ice. Place a stretched laboratory parafilm on a 35 by 10 millimeter cell culture dish and add one microliter of sterile PBS to the parafilm.Connect a prepared glass micropipette to an automatic Pico injector. Press the fill mode to fill the PBS into a micropipette and then press the inject mode to test the allocated one microliter of liquid. Place a second piece of stretched laboratory parafilm on a new cell culture dish and add one microliter of fast green stained viral stock to the film.Lower the tip of the micropipette into the viral stock, and press the fill mode to fill the micropipette with one microliter of viral stock. Under a dissecting microscope, lower the filled micropipette connected to an automatic injector into the target region of the chicken embryo lens. Then adjust the light source to provide a clear view of the lens vesicle.After ensuring the micropipette is within the correct location inside the lens lumen, inject five to 40 nanoliters of the viral stock. After injection, wait 45 seconds before gently removing the micropipette. Next, check the successful microinjection by examining the fast green dye in the empty lumen of the lens without an leakage.Following examination, seal the eggshell opening with scotch tape and place the eggs in a 37 degree Celsius humidified static incubator. This study demonstrates the histological evaluation of the chimeric connexon 50 and 43 loops through immunofluorescence. Using Anti-Flag labeling, exogenous connexons were distinguished from endogenous ones.The study also evaluates the interaction between the intracellular loop domain of connexon 50 and Aquaporin zero.