עבודה זו נתמכה על ידי מענקי המכונים הלאומיים לבריאות (NIH): RO1 EY012085 (ל- J.X.J) ו- F32DK134051 (ל- F.M.A), ומענק קרן וולש: AQ-1507 (ל- J.X.J). התוכן הוא באחריותם הבלעדית של המחברים ואינו מייצג בהכרח את הדעות הרשמיות של המכונים הלאומיים לבריאות. הדמויות נוצרו חלקית עם Biorender.com.

מחקר זה נערך בהתאם לחוק צער בעלי חיים ולתקנות צער בעלי חיים בהתאם לעקרונות המדריך לטיפול ושימוש בחיות מעבדה. כל ההליכים בבעלי חיים אושרו על ידי הוועדה המוסדית לטיפול ושימוש בבעלי חיים במרכז למדעי הבריאות של אוניברסיטת טקסס בסן אנטוניו. לסקירה כללית של הפרוטוקול, ראו איור 1; עיין בטבלת החומרים לקבלת פרטים על כל החומרים, הריאגנטים והמכשירים המשמשים בפרוטוקול זה.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/65727/65727fig01.jpg"> איור 1: מתווה ניסויי. 1 . השלב הראשון של הפרוטוקול הוא קביעת חלבון מטרה ספציפי, זיהוי רצפי הגנים הקשורים ויצירת מקטעי DNA. 2 . שיבוט רצפי הגן לווקטור רטרו-ויראלי על ידי שיבוט ראשוני לווקטור מתאם, 3. ואחריו וקטור ויראלי . 4 . הכנת חלקיקים נגיפיים בעלי טיטר גבוה באמצעות תאי אריזה לקציר והתרכיז. 5 . השלב האחרון, והמוקד של פרוטוקול זה, הוא מיקרו-הזרקה של חלקיקי נגיפים RCAS(A) לתוך לומן העדשה. <a href="https://www.jove.com/files/ftp_upload/65727/65727fig01large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של איור זה.</a>
1. הכנת רטרו-וירוסים רקומביננטיים בעלי טיטר גבוה
<ol><li>תגובת שרשרת פולימראז (PCR) ליצירת מקטעי DNA של חלבון מטרה הערה: סעיף זה נועד להגביר את רצף הדנ"א המתאים לחלבון עדשת המטרה. לקבלת פרטים נוספים, ראה 7,8.<ol><li>תכנון פריימרים עבור PCR, המתאימים לחלבון המעניין, כדי ליצור מקטעי DNA עם termini carboxyl שלהם בתוך מסגרת עם או בלי רצף אפיטופ FLAG (5'-GACTACAAGGACGACGATGACAAG-3'), קודון עצירה, ואתר אנזים הגבלה (כלומר, EcoRI) נוכח בתוך אזור פולילינקר של CLa12NCO)) על פי המפרטים שצוינו בפרוטוקולים שפורסמו בעבר, עם רצפים עבור אנזימי הגבלה נאותים1, 7,8,10,11.</li>
		<li>בצע את תגובת ה-PCR10. שלב 100 pmol של חישה ואנטיסנס של הפריימרים המעוצבים עם 0.5 מיקרוגרם של connexin cDNA (כגון Cx50, Cx43, או שילובים כימריים Cx50*43L), למאגר התגובה PCR הנבחר. בצע 30 מחזורים שכל אחד מהם מורכב מ- 94 ° C למשך דקה אחת, 58 ° C למשך דקה אחת ו- 72 ° C למשך דקה אחת, ולאחר מכן הארכה סופית למשך 10 דקות ב- 72 ° C.</li>
		<li>בודדו וטיהרו מוצרי PCR עם ערכת טיהור ג'ל.</li>
		<li>לעכל את מוצרי ה-PCR המטוהרים באמצעות אנזימי הגבלה לפי בחירתכם בהתאם להוראות היצרן.</li>
	</ol></li>
	<li>שיבוט של החדרת DNA לפלסמיד מתאם הערה: החדרת מקטעי DNA לווקטור מתאם מבטלת את הצורך בתאים/וירוסים מסייעים כדי להגביר את יציבות וקטור RCAS(A)14. לקבלת פרטים נוספים, ראה 7,8.<ol><li>תת-שכפול מקטעי DNA לתוך פלסמיד מתאם, Cla12NCO באמצעות תגובת קשירה דביקה. ערבבו את מקטעי ה-PCR עם אנזימי הגבלה ו-Cla12NCO ביחס של 2-5:1. ביצוע קשירה וטרנספורמציה של DNA באמצעות תאים מתאימים.</li>
		<li>בודדו DNA באמצעות ערכת בידוד DNA.</li>
		<li>רצף את הדנ"א כדי להבטיח דיוק.</li>
	</ol></li>
	<li>שיבוט לווקטור הנגיפי RCAS(A) הערה: מקטעי DNA מוחדרים לרכב (RCAS(A) רטרו-וירוס) לצורך העברה יציבה של גן לתאים בעובר אפרוח מתפתח14,15. לקבלת פרטים נוספים, ראה 7,8,15.<ol><li>עיכלו את מקטע Cla12NCO-DNA של וקטור המכיל עניין עם ClaI (יחידה אחת לכל 1 מיקרוגרם של DNA) ובודדו את המקטעים.</li>
		<li>לשכפל את מקטעי הדנ"א לפלסמיד RCAS(A) ליניארי ClaI. השתמש באנזים ההגבלה SalI כדי להבחין באתר ClaI על פלסמיד RCAS(A).</li>
		<li>אשר את הכיוון הנכון של המקטעים שהוכנסו על המבנים על ידי עיכול עם אנזימי הגבלה ClaI ו- SalI.</li>
		<li>בודדו DNA באמצעות ערכת בידוד DNA.</li>
		<li>לקבוע את ריכוז ה- DNA.</li>
	</ol></li>
	<li>טרנספקציה של תאי פיברובלסט עוברי אפרוח (CEF) וקציר RCAS(A) הערה: תאי אריזה של וירוסים, CEFs, משמשים להשגה/קצירת מדיה של תרבית תאים המכילה חלקיקים נגיפיים15,16. לקבלת פרטים נוספים, ראה 7,8,15.<ol><li>Transfect תאי CEF עם מבני DNA רטרו-ויראליים רקומביננטיים באמצעות סוכן transfection על פי הוראות היצרן.</li>
		<li>לבצע ניקוי מערבי של התאים הנגועים כדי לבחון את הביטוי שלהם של החלבון המעניין.</li>
		<li>כאשר התאים הנגועים מגיעים למפגש, התחילו לאסוף את התווך הסופרנאטנטי, לעבד/לסנן אותו כראוי (כדי להסיר פסולת תאית באמצעות מסנן 0.22μm), ואחסנו בטמפרטורה של -80°C עד לריכוז.</li>
	</ol></li>
	<li>ריכוז וטירינג של מניות ויראליות הערה: יש לסנן את הכדוריות ואת כמויות המדיה הגדולות שמקורן בתאים המכילים את החלקיקים הנגיפיים. בנוסף, יש לבצע בדיקת טיטר נגיפי כדי לקבוע את חוזק הנגיף כנגד התאים המארחים. לקבלת פרטים נוספים, ראה 6,7,8,15.<ol><li>הפשירו את אמצעי התרבות המכילים את הוויריונים.</li>
		<li>סובב את מדיה התרבות ב 72,000 × גרם במשך 2 שעות ב 4 ° C.</li>
		<li>דקרו את הסופרנאטנט והשהו מחדש את הגלולה הוויראלית עם התווך השיורי (~50 μL) ואחסנו בטמפרטורה של -80 מעלות צלזיוס עד לשימוש, ב~10 μL ויראלי.</li>
		<li>עבור titering, באמצעות תאי QT-6 או CEF, transfecate את התאים עם דילול סדרתי של מלאי ויראלי.</li>
		<li>לאחר המפגש, לתקן את התאים באמצעות 4% פורמלדהיד.</li>
		<li>Immunostain עבור חלבוני gag נגיפי או תהליך עבור phosphatase אלקליין היסטוכימית כדי לקבל את titer, מוגדר כמו (יחידות יוצרות מושבה) CFU למיליליטר (CFU/mL).</li>
	</ol></li>
</ol><img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65727/65727fig02.jpg"> איור 2: מכשירים והתקנה למיקרו-הזרקה של עדשת אפרוח . (A) P-30 מושך מיקרופיפטה אנכי ידני. (1) כניסה המראה משיכה של מיקרופיפטה מזכוכית. (ב) (2) אינקובטור ביצים. לדגור על ביצת תרנגולת במשך ~ 65-68 שעות באינקובטור של 37 מעלות צלזיוס כדי להגיע לשלב 18 (עם לומן מרכזי אטום וריק) להזרקת רטרו-וירוס. (C) הגדרת מיקרו-הזרקה. (3) ציוד תאורה, (4) Pico-Injector, (5) מיקרוסקופ ניתוח, (6) מיקרומניפולטור Drummond, (7) מחשב/מצלמה להדמיה. <a href="https://www.jove.com/files/ftp_upload/65727/65727fig02large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של איור זה.</a>
2. מיקרו-הזרקה של עדשת צ'יק
<ol><li>הכנת אספקה<ol><li>הכנת מיקרופיפטות זכוכית למיקרו-הזרקה17 הערה: נימי זכוכית משמשים לייצור מיקרופיפטות זכוכית עם נקודת קצה וקוטר חיצוני (OD) של ~ 11 מיקרומטר למיקרו-הזרקה. ההגדרה מוצגת באיור 2A.<ol><li>חבר את נימי זכוכית הבורוסיליקט לאטבים המרופדים בגומי במושך המיקרופיפטה האנכי הידני.</li>
			<li>כוונו את טמפרטורת החום (חום 1) ל-950°C ובצעו משיכה מקדימה לקבלת נימי זכוכית דקים ורכים יותר.</li>
			<li>הגדר את טמפרטורת החום (חום 2) ל 790 ° C ובצע משיכה משנית כדי לייצר מיקרופיפטות סופיות.</li>
			<li>בעזרת מטחנת מיקרופיפטה, מחדדים את פתח החוד ל-OD של ~11 מיקרומטר.</li>
			<li>לניסויים עתידיים, שמרו את מיקרופיפטות הזכוכית במשטח הידוק ספוג בתוך צנצנת זכוכית.</li>
		</ol></li>
		<li>דגירה של ביציות מופרות עד לשלב ההתפתחות 18 הערה: במהלך התפתחות העדשה, ב~65-68 שעות של התפתחות עוברית, העדשה נפרדת מהאקטודרם ויוצרת שלפוחית אטומה עם לומן מרכזי; הזרקה לתוך עדשה ריקה זו לומן ראשונים לביטוי מוגבל לתאי עדשה שגשוג 7,8,18.<ol><li>דגרו על ביצי תרנגולות מופרות במשך ~65-68 שעות באינקובטור נדנדה לח של 37°C (איור 2B).</li>
		</ol></li>
	</ol></li>
	<li>פתיחת ביצת התרנגולת הערה: שלב זה מתאר את הזיהוי והחשיפה של העובר למיקרו-הזרקה. לקבלת פרטים נוספים, ראה 7,8.<ol><li>נגבו היטב את אזור העבודה עם 70% אתנול.</li>
		<li>מוציאים את הביצים מהאינקובטור, מרססים אותן בכבדות באתנול 70% ונותנים להן להתייבש באוויר.</li>
		<li>מניחים את הביצה, כאשר הקצה הגדול יותר של הביצה פונה כלפי מעלה, על מחזיק ביצים.</li>
		<li>באמצעות זוג מלקחיים חדי שיניים, יוצרים חור בקוטר ~2 ס"מ בקצה הגדול יותר של הביצה על-ידי הקשה זהירה על קליפת הביצה והסרת שברים מקליפת הביצה (איור 3A).</li>
		<li>באמצעות מיקרוסקופ מנתח, אתר את העובר.</li>
		<li>לאחר איתור עדשת העובר והאפרוח, השתמשו במיקרוסקופ המנתח ובמלקחיים ובמספריים לניתוח עדין כדי לחתוך את קרום מי השפיר המכסה מיד את החלק העליון של העובר (איור 3B). הערה: אין לחתוך רחב מדי (רק מספיק כדי לחשוף את העובר ~ 0.5 ס"מ x 0.5 ס"מ), אחרת העוברים עלולים לשקוע לתוך מסת החלמון; כמו כן, הימנעו מלגעת בכלי הדם, במידת האפשר.</li>
		<li>מכסים את פתח הביצה בצלחת פטרי בקוטר 60 מ"מ כהכנה לשלבים הבאים.</li>
	</ol></li>
	<li>מיקרו-הזרקה של מלאי ויראלי מרוכז הערה: חלקיקים נגיפיים המכילים מקטעי DNA של חלבון מטרה לצורך התמרה מוחדרים לתאים בתוך לומן העדשה. ההגדרה מוצגת באיור 2C. לקבלת פרטים נוספים, ראה 6,7,8.<ol><li>הפשירו את מניות המניות הוויראליות על הקרח.</li>
		<li>להדמיה של המלאי הנגיפי במהלך ההזרקה, לדלל 1 μL של 10x ירוק מהיר לתוך בקבוקון אחד של מלאי ויראלי המכיל 10 μL.</li>
		<li>כדי להבטיח שאין גושים גדולים של חומר בלתי מומס שעלולים לסתום את מיקרופיפטת הזכוכית, צנטריפוגו את התמיסות למשך 10 שניות ב-10,000 × גרם ב-4°C כדי לפלוט "גושים גדולים" ולהעביר את הסופרנאטנטים לצינורות חדשים, כל זאת תוך שמירה על התמיסות על קרח.</li>
		<li>על צלחת תרבית בגודל 35 מ"מ x 10 מ"מ, מניחים פרפילם מעבדה מתוח ומוסיפים 1 μL של מלח סטרילי (PBS) על גבי הסרט (לא מעוקר, כאשר הצד המכוסה נחשב "נקי").</li>
		<li>חבר מיקרופיפט זכוכית מוכן למזרק פיקו אוטומטי.</li>
		<li>לחץ על מצב המילוי כדי למלא את המלח הסטרילי (PBS) לתוך מיקרופיפטה זכוכית, ולאחר מכן השתמש במצב הזרקה כדי לבדוק את 1 μL המוקצה של נוזל.</li>
		<li>הניחו פרפילם מעבדה מתוח שני על פני צלחת תרבית תאים חדשה בגודל 35 מ"מ x 10 מ"מ והוסיפו 1 μL של מלאי נגיפים מוכתמים בירוק מהיר על גבי הסרט.</li>
		<li>הורידו את קצה המיקרופיפטה למלאי הנגיפי ולחצו על דגם המילוי כדי למלא את מיקרופיפטת הזכוכית ב~1 μL של מלאי נגיפי. הערה: כדי למנוע התייבשות, שים את קצה המיקרופיפטה המלאה במי מלח סטריליים (PBS) בכל פעם שיש הפסקה בהליך.</li>
		<li>הורידו את מיקרופיפטת הזכוכית המלאה, המחוברת למזרק אוטומטי, לאזור המטרה של לומן עדשת העובר בעזרת מיקרוסקופ מנתח.</li>
		<li>כוונן את מקור האור כדי להבטיח הדמיה ברורה של קווי המתאר של שלפוחית העדשה. הערה: לומן העדשה הימנית (פונה כלפי מעלה) משמש בדרך כלל להזרקה והשמאלית (פונה כלפי מטה) נשמרת שלמה כבקרה נגדית.</li>
		<li>ברגע שאתם בטוחים שמיקום המיקרופיפטה נמצא במיקום הנכון בתוך לומן העדשה, הזריקו 5-40 nL של הזן הנגיפי (איור 3C). הערה: תרגול הוא הכרחי מאוד עבור מיקום הזרקה אופטימלי.</li>
		<li>המתן ~ 45 שניות ולאחר מכן הסר בעדינות את מיקרופיפטת הזכוכית.</li>
		<li>בדוק את המיקרו-הזרקה המוצלחת לתוך לומן העדשה באמצעות המיקרוסקופ המנתח על ידי בדיקת צבע ירוק מהיר שאמור להישאר בלומן הריק של העדשה ללא כל דליפה.</li>
		<li>לאחר הליך ההזרקה, אוטמים את פתח קליפת הביצה בסרט סקוטש.</li>
		<li>יש להחזיר את העובר לאינקובטור הלח בטמפרטורה של 37 מעלות צלזיוס, ללא כל תנועה סיבובית, עד להגעה לגיל העוברי הרצוי לדיסקציה של העדשה.</li>
	</ol></li>
</ol><img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/65727/65727fig03.jpg"> איור 3: הכנת אפרוח במיקרו-הזרקה וסכמטית . (א) פתיחת ביצת תרנגולת. (B) חיתוך קרום מי השפיר. (C) סכימת מיקרו-הזרקה של עדשת עוף. <a href="https://www.jove.com/files/ftp_upload/65727/65727fig03large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של איור זה.</a>

חקר ביטוי חלבונים במהלך התפתחות עדשת עוף

<ol>
	<li>Li, Z., Gu, S., Quan, Y., Varadaraj, K., Jiang, J. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+potent+embryonic+chick+lens+model+for+studying+congenital+cataracts+in+vivo.">Development of a potent embryonic chick lens model for studying congenital cataracts in vivo.</a> Communications Biology. 4 (1), 325 (2021).</li><li>Chen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=&#947;-Crystallins+of+the+chicken+lens:+remnants+of+an+ancient+vertebrate+gene+family+in+birds.">&#947;-Crystallins of the chicken lens: remnants of an ancient vertebrate gene family in birds.</a> The FEBS Journal. 283 (8), 1516-1530 (2016).</li><li>Coulombre, A. J., Coulombre, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lens+development.+I.+Role+of+the+lens+in+eye+growth.">Lens development. I. Role of the lens in eye growth.</a> Journal of Experimental Zoology. 156 (1), 39-47 (1964).</li><li>McKeehan, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+portions+of+the+chick+lens+without+contact+with+the+optic+cup.">Induction of portions of the chick lens without contact with the optic cup.</a> The Anatomical Record. 132 (3), 297-305 (1958).</li><li>Kothlow, S., Schenk-Weibhauser, K., Ratcliffe, M. J., Kaspers, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prolonged+effect+of+BAFF+on+chicken+B+cell+development+revealed+by+RCAS+retroviral+gene+transfer+in+vivo.">Prolonged effect of BAFF on chicken B cell development revealed by RCAS retroviral gene transfer in vivo.</a> Molecular immunology. 47 (7-8), 1619-1628 (2010).</li><li>Fekete, D. M., Cepko, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication-competent+retroviral+vectors+encoding+alkaline+phosphatase+reveal+spatial+restriction+of+viral+gene+expression/transduction+in+the+chick+embryo.">Replication-competent retroviral vectors encoding alkaline phosphatase reveal spatial restriction of viral gene expression/transduction in the chick embryo.</a> Molecular and Cellular Biology. 13 (4), 2604-2613 (1993).</li><li>Jiang, J. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+retroviruses+to+express+connexins.">Use of retroviruses to express connexins.</a> Methods in Molecular Biology. , 159-174 (2001).</li><li>Jiang, J. X., Goodenough, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+expression+of+connexins+in+embryonic+chick+lens.">Retroviral expression of connexins in embryonic chick lens.</a> Investigative Ophthalmology &amp; Visual Science. 39 (3), 537-543 (1998).</li><li>Shestopalov, V. I., Bassnett, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+autofluorescent+proteins+reveals+a+novel+protein+permeable+pathway+between+cells+in+the+lens+core.">Expression of autofluorescent proteins reveals a novel protein permeable pathway between cells in the lens core.</a> Journal of Cell Science. 113 (11), 1913-1921 (2000).</li><li>Liu, J., Xu, J., Gu, S., Nicholson, B. J., Jiang, J. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aquaporin+0+enhances+gap+junction+coupling+via+its+cell+adhesion+function+and+interaction+with+connexin+50.">Aquaporin 0 enhances gap junction coupling via its cell adhesion function and interaction with connexin 50.</a> Journal of Cell Science. 124 (2), 198-206 (2011).</li><li>Li, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+second+extracellular+domain+of+connexin+50+is+important+for+in+cell+adhesion,+lens+differentiation,+and+adhesion+molecule+expression.">The second extracellular domain of connexin 50 is important for in cell adhesion, lens differentiation, and adhesion molecule expression.</a> Journal of Biological Chemistry. 299 (3), 102965 (2023).</li><li>Shestopalov, V. I., Bassnett, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exogenous+gene+expression+and+protein+targeting+in+lens+fiber+cells.">Exogenous gene expression and protein targeting in lens fiber cells.</a> Investigative Ophthalmology &amp; Visual Science. 40 (7), 1435-1443 (1999).</li><li>Shestopalov, V. I., Bassnett, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+organization+of+primary+lens+fiber+cells.">Three-dimensional organization of primary lens fiber cells.</a> Investigative Ophthalmology &amp; Visual Science. 41 (3), 859-863 (2000).</li><li>Hughes, S. H., Greenhouse, J. J., Petropoulos, C. J., Sutrave, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adaptor+plasmids+simplify+the+insertion+of+foreign+DNA+into+helper-independent+retroviral+vectors.">Adaptor plasmids simplify the insertion of foreign DNA into helper-independent retroviral vectors.</a> Journal of Virology. 61 (10), 3004-3012 (1987).</li><li>Yan, R. T., Wang, S. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+high-titer+RCAS+retrovirus.">Production of high-titer RCAS retrovirus.</a> Methods in Molecular Biology. 884, 193-199 (2012).</li><li>Kingston, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Introduction+of+DNA+into+mammalian+cells.">Introduction of DNA into mammalian cells.</a> Current Protocols in Molecular Biology. 64 (1), 1-95 (2003).</li><li>Li, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studying+macrophage+activation+in+immune-privileged+lens+through+CSF-1+protein+intravitreal+injection+in+mouse+model.">Studying macrophage activation in immune-privileged lens through CSF-1 protein intravitreal injection in mouse model.</a> STAR Protocols. 3 (1), 101060 (2022).</li><li>Hamburger, V., Hamilton, H. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+series+of+normal+stages+in+the+development+of+the+chick+embryo.">A series of normal stages in the development of the chick embryo.</a> Developmental Dynamics. 195 (4), 231-272 (1992).</li><li>Hallagan, J. B., Allen, D. C., Borzelleca, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+safety+and+regulatory+status+of+food,+drug+and+cosmetics+colour+additives+exempt+from+certification.">The safety and regulatory status of food, drug and cosmetics colour additives exempt from certification.</a> Food and Chemical Toxicology. 33 (6), 515-528 (1995).</li><li>Okada, T. S., Eguchi, G., Takeichi, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+expression+of+differentiation+by+chicken+lens+epithelium+in+in+vitro+cell+culture.">The expression of differentiation by chicken lens epithelium in in vitro cell culture.</a> Development, Growth &amp; Differentiation. 13 (4), 323-336 (1971).</li><li>Menko, A. S., Klukas, K. A., Johnson, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chicken+embryo+lens+cultures+mimic+differentiation+in+the+lens.">Chicken embryo lens cultures mimic differentiation in the lens.</a> Developmental Biology. 103 (1), 129-141 (1984).</li><li>Parreno, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methodologies+to+unlock+the+molecular+expression+and+cellular+structure+of+ocular+lens+epithelial+cells.">Methodologies to unlock the molecular expression and cellular structure of ocular lens epithelial cells.</a> Frontiers in Cell and Developmental Biology. 10, 983178 (2022).</li><li>Edwards, A., Gupta, J. D., Harley, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photomicrographic+evaluation+of+drug-induced+cataracts+in+cultured+embryonic+chick+lens.">Photomicrographic evaluation of drug-induced cataracts in cultured embryonic chick lens.</a> Experimental Eye Research. 15 (4), 495-498 (1973).</li><li>Musil, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primary+cultures+of+embryonic+chick+lens+cells+as+a+model+system+to+study+lens+gap+junctions+and+fiber+cell+differentiation.">Primary cultures of embryonic chick lens cells as a model system to study lens gap junctions and fiber cell differentiation.</a> Journal of Membrane Biology. 245 (7), 357-368 (2012).</li><li>West-Mays, J. A., Pino, G., Lovicu, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+use+of+the+lens+epithelial+explant+system+to+study+lens+differentiation+and+cataractogenesis.">Development and use of the lens epithelial explant system to study lens differentiation and cataractogenesis.</a> Progress in Retinal and Eye Research. 29 (2), 135-143 (2010).</li><li>Upreti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lens+epithelial+explants+treated+with+vitreous+humor+undergo+alterations+in+chromatin+landscape+with+concurrent+activation+of+genes+associated+with+fiber+cell+differentiation+and+innate+immune+response.">Lens epithelial explants treated with vitreous humor undergo alterations in chromatin landscape with concurrent activation of genes associated with fiber cell differentiation and innate immune response.</a> Cells. 12 (3), 501 (2023).</li><li>Walker, J. L., Wolff, I. M., Zhang, L., Menko, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+SRC+kinases+signals+induction+of+posterior+capsule+opacification.">Activation of SRC kinases signals induction of posterior capsule opacification.</a> Investigative Ophthalmology &amp; Visual Science. 48 (5), 2214-2223 (2007).</li><li>Briskin, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heritable+retroviral+transgenes+are+highly+expressed+in+chickens.">Heritable retroviral transgenes are highly expressed in chickens.</a> Proceedings of the National Academy of Sciences of the United States of America. 88 (5), 1736-1740 (1991).</li><li>Hughes, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RCAS+vector+system.">The RCAS vector system.</a> Folia Biologica. 50 (3-4), 107-119 (2004).</li></ol>

המחברים מצהירים כי המחקר נערך בהיעדר קשרים מסחריים או פיננסיים שיכולים להתפרש כניגוד עניינים פוטנציאלי.

מודל ניסיוני זה מציע הזדמנות לבטא את העניין של החלבונים בעדשה השלמה, מה שמוביל לחקר הרלוונטיות התפקודית של חלבונים אלה במבנה העדשה ובתפקודה. מודל המיקרו-הזרקה של אפרוח עוברי מבוסס בחלקו על עבודתו של Fekete et. al.6 ופותח עוד יותר על ידי Jiang et. al.8 ושימש כאמצעי להחדרת פלסמ?...

מטרת פרוטוקול זה היא לתאר את המתודולוגיה של מיקרו-הזרקה של עדשת עוף עוברית של RCAS(A) (סרקומה של עופות / רטרו-וירוס לויקוזיס A). העברה רטרו-ויראלית יעילה בעדשת עוף עוברית הוכחה ככלי מבטיח לחקר in vivo של המנגנון המולקולרי והמבנה-תפקוד של חלבוני עדשה בפיזיולוגיה רגילה של העדשה, בתנאים פתולוגיים ובהתפתחות. יתר על כן, מודל ניסיוני זה יכול לשמש לזיהוי מטרות טיפוליות וסינון תרופות למצבים כגון קטרקט מולד אנושי. בסך הכל, פרוטוקול זה נועד לפרוס את הצעדים הדרושים לפיתוח פלטפורמה להתאמה אישית לחקר חלבוני עדשה.
אפרוחים עובריים (Gallus domesticus), בשל הדמיון שלהם במבנה העדשה ובתפקודה עם העדשה האנושית, הם מודל חייתי מבוסס היטב לחקר התפתחות העדשה ופיזיולוגיה 1,2,3,4. השימוש ברטרו-וירוס עופות RCAS(A) בעל יכולת שכפול נחשב למערכת יעילה, מהירה וניתנת להתאמה אישית לביטוי חלבונים אקסוגניים בעוברי אפרוחים. יש לציין כי יש לו יכולת ייחודית להגביל את העברת גן המטרה לתאי סיבי עדשה שגשוגיים ללא צורך במקדמים ספציפיים לרקמות, תוך שימוש במסגרת הזמן הייחודית להתפתחות עוברית שבה נוכחות לומן עדשה ריק מאפשרת באתרו מיקרו-הזרקה RCAS(A) לאתר המוגבל לביטוי חלבונים אקסוגניים בתוך תאי סיבי עדשה מתרבים5, 6,7,8.
הליך המיקרו-הזרקה של עובר אפרוח, המתואר כאן בהרחבה, מבוסס בחלקו על עבודתו של Fekete et. al.6 ופותח עוד יותר על ידי Jiang et. al.8 ושימש כאמצעי להחדרת פלסמידים נגיפיים ולא ויראליים לעדשת אפרוחים עובריים 1,9,10,11,12,13. בסך הכל, העבודה הקודמת מדגימה את הפוטנציאל של שימוש במתודולוגיה זו לחקר התפתחות עדשות, התמיינות שלהן, תקשורת תאית והתקדמות מחלות, ולגילוי ובדיקה של מטרות טיפוליות למצבים פתולוגיים של עדשות כגון קטרקט.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.22 &#181;m Filter</td>
			<td>Corning</td>
			<td>431118</td>
			<td>For removing cellular debris from media</td>
		</tr>
		<tr>
			<td>35 mm x 10 mm Culture Dish</td>
			<td>FisherScientific</td>
			<td>50-202-030</td>
			<td>For using during microinjection</td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Fisherbrand</td>
			<td>13-100-676</td>
			<td>Spinning down solution</td>
		</tr>
		<tr>
			<td>Constructs</td>
			<td>GENEWIZ</td>
			<td>-</td>
			<td>For generation of constructs</td>
		</tr>
		<tr>
			<td>Dissecting microscope</td>
			<td>AmScope</td>
			<td>SM-4TZ-144A</td>
			<td>Visualization of lens for microinjection</td>
		</tr>
		<tr>
			<td>DNA PCR primers</td>
			<td>Integrated DNA Technologies</td>
			<td>-</td>
			<td>Generation of primers: 
			 
			Intracellular loop (IL)-deleted Cx50 (residues 1&#8211;97 and 149&#8211;400) as well as the Cla12NCO vector were obtained with the following pair of primers: sense, CTCCTGAGAACCTACATCCT; antisense, CACCGCATGCCCAAAGTACAC 
			 
			ILs of Cx43 (residues 98&#8211;150) and Cx46 (residues 98&#8211;166) were&#160; obtained with the following pairs of primers: sense, TACGTGATGAGGAAAGAAGAG; antisense, TCCTCCACGCATCTTTACCTTG; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCC AT ACGGATTC, respectively 
			 
			Cla12NCO-Cx43 construct template was obtained with the following pair of primers: sense, CTGCTTCGTACTTACATCATC; antisense, GAACAC GTGCGCCAGGTAC 
			 
			ILs of Cx50 (residues 98&#8211;148) or Cx46 (residues 98&#8211;166) were cloned by using Cla12NCO-Cx50 and Cla12NCO-Cx46 constructs as the templates with the following pair of primers: sense, CACCATGTCCGCATGGAGGAGA; antisense, GGTCCCC TC CAGGCGAAAC; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCCATACGGATTC, respectively</td>
		</tr>
		<tr>
			<td>Drummond Nanoject II Automatic Nanoliter Injector</td>
			<td>Drummond Scientific</td>
			<td>3-000-204</td>
			<td>Microinjection Pipet</td>
		</tr>
		<tr>
			<td>Dual Gooseneck Lights Microscope Illuminator</td>
			<td>AmScope</td>
			<td>LED-50WY</td>
			<td>Lighting for visualization</td>
		</tr>
		<tr>
			<td>Dulbecco&#8217;s Modified Eagle Medium (DMEM)</td>
			<td>Invitrogen</td>
			<td></td>
			<td>For cell culture</td>
		</tr>
		<tr>
			<td>Egg Holder</td>
			<td>-</td>
			<td>-</td>
			<td>Homemade styrofoam rings with 2-inch diameter and one-half inch height</td>
		</tr>
		<tr>
			<td>Egg Incubator</td>
			<td>GQF Manufacturing Company Inc.</td>
			<td>1502</td>
			<td>For incubation of fertilized eggs</td>
		</tr>
		<tr>
			<td>Fast Green</td>
			<td>Fisher scientific</td>
			<td>F99-10</td>
			<td>For visualization of viral stock injection</td>
		</tr>
		<tr>
			<td>Fertilized white leghorn chicken eggs</td>
			<td>Texas A&#38;M University</td>
			<td>N/A</td>
			<td>Animal model of choice for microinjection (https://posc.tamu.edu/fertile-egg-orders/)</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Hyclone Laboratories</td>
			<td></td>
			<td>For cell culture</td>
		</tr>
		<tr>
			<td>Fluorescein-conjugated anti-mouse IgG</td>
			<td>Jackson ImmunoResearch</td>
			<td>115-095-003</td>
			<td>For anti-FLAG&#160; 1:500</td>
		</tr>
		<tr>
			<td>Forceps</td>
			<td>FisherScientific</td>
			<td>22-327379</td>
			<td>For moving things around and isolation</td>
		</tr>
		<tr>
			<td>Glass capillaries</td>
			<td>Sutter Instruments</td>
			<td>B100-75-10</td>
			<td>Glass micropipette for microinjection (O.D. 1.0 mm, I.D. 0.75 mm, 10 cm length)</td>
		</tr>
		<tr>
			<td>Lipofectamine</td>
			<td>Invitrogen</td>
			<td>L3000001</td>
			<td>For transfection</td>
		</tr>
		<tr>
			<td>Manual vertical micropipette puller</td>
			<td>Sutter Instruments</td>
			<td>P-30</td>
			<td>To obtain glass micropipette of the correct size</td>
		</tr>
		<tr>
			<td>Microcentrifuge Tubes</td>
			<td>FisherScientific</td>
			<td>02-682-004</td>
			<td>Dissolving solution</td>
		</tr>
		<tr>
			<td>Microscope</td>
			<td>Keyence</td>
			<td>BZ-X710</td>
			<td>For imaging staining</td>
		</tr>
		<tr>
			<td>Parafilm</td>
			<td>FisherScientific</td>
			<td>03-448-254</td>
			<td>Placing solution</td>
		</tr>
		<tr>
			<td>Penicillin/Streptomycin</td>
			<td>Invitrogen</td>
			<td></td>
			<td>For cell culture</td>
		</tr>
		<tr>
			<td>Pico-Injector</td>
			<td>Harvard Apparatus</td>
			<td>PLI-100</td>
			<td>For delivering small liquid volumes precisely through micropipettes by applying a regulated pressure for a digitally set period of time</td>
		</tr>
		<tr>
			<td>rabbit anti-chick AQP0</td>
			<td>Self generated</td>
			<td>-</td>
			<td>Jiang JX, White TW, Goodenough DA, Paul DL. Molecular cloning and functional characterization of chick lens fiber connexin 45.6. Mol Biol Cell. 1994 Mar;5(3):363-73. doi: 10.1091/mbc.5.3.363.</td>
		</tr>
		<tr>
			<td>rabbit anti-FLAG antibody</td>
			<td>Rockland Immunichemicals</td>
			<td>600-401-383</td>
			<td>For staining FLAG</td>
		</tr>
		<tr>
			<td>Rhodamine-conjugated anti-rabbit IgG&#160;</td>
			<td>Jackson ImmunoResearch</td>
			<td>111-295-003</td>
			<td>For anti-AQP0&#160; 1:500</td>
		</tr>
		<tr>
			<td>Sponge clamping pad</td>
			<td>Sutter Instruments</td>
			<td>BX10</td>
			<td>For storage of glass micropipette</td>
		</tr>
	</tbody>
</table>

microinjection of recombinant rcas(a) retrovirus into embryonic chicken lens

עוף עוברי (Gallus domesticus) הוא מודל חייתי מבוסס היטב לחקר התפתחות העדשה והפיזיולוגיה, בהתחשב במידת הדמיון הגבוהה שלה לעדשה האנושית. RCAS(A) הוא רטרו-וירוס עוף בעל יכולת שכפול המדביק תאים מתחלקים, המשמש ככלי רב עוצמה לחקר הביטוי באתרו ותפקודם של חלבונים מסוג בר וחלבונים מוטנטיים במהלך התפתחות העדשה על ידי מיקרו-הזרקה ללומן הריק של שלפוחית העדשה בשלבי התפתחות מוקדמים, ומגביל את פעולתו לתאי עדשה מתרבים סביב. בהשוואה לגישות אחרות, כגון מודלים טרנסגניים ותרביות ex vivo, השימוש ברטרו-וירוס עופות בעל יכולת שכפול RCAS(A) מספק מערכת יעילה, מהירה וניתנת להתאמה אישית לביטוי חלבונים אקסוגניים בעוברי אפרוחים. באופן ספציפי, העברת גנים ממוקדת יכולה להיות מוגבלת לתאי סיבי עדשה מתרבים ללא צורך במקדמים ספציפיים לרקמות. במאמר זה, נסקור בקצרה את השלבים הדרושים להכנת רטרו-וירוס רקומביננטי RCAS(A), נספק סקירה מפורטת ומקיפה של הליך המיקרו-הזרקה, ונספק תוצאות לדוגמה של הטכניקה.

The goal of this protocol is to describe the methodology of embryonic chicken lens microinjection of an RCAS(A) (replication-competent avian sarcoma/leukosis retrovirus A). Effective retroviral delivery in an embryonic chicken lens has been demonstrated to be a promising tool for the in vivo study of the molecular mechanism and structure-function of lens proteins in normal lens physiology, pathological conditions, and development. Moreover, this experimental model could be used for the identification of therapeutic targets and drug screening for conditions such as human congenital cataracts. In all, this protocol aims to lay out the necessary steps for the development of a customizable platform for the study of lens proteins.
Embryonic chicks (Gallus domesticus), owing to their similarity in lens structure and function with the human lens, are a well-established animal model for the study of lens development and physiology1,2,3,4. The use of an RCAS(A) replication-competent avian retrovirus has been regarded as a highly effective, rapid, and customizable system to express exogenous proteins in chick embryos. Notably, it has a unique ability to confine the target gene transfer to proliferative lens fiber cells without the need for tissue-specific promoters, using the unique embryonic development time frame in which the presence of empty lens lumen permits in situ RCAS(A) microinjection into the restricted site for the expression of exogenous proteins within proliferative lens fiber cells5,6,7,8.
The chick embryo microinjection procedure, described in-depth here, is based originally partially on the work of Fekete et. al.6 and further developed by Jiang et. al.8 and has been utilized as a means of introducing both viral and nonviral plasmids into the lens of embryonic chicks1,9,10,11,12,13. Overall, the previous work demonstrates the potential of utilizing this methodology to study lens development, differentiation, cellular communication, and disease progression, and for the discovery and testing of therapeutic targets for lens pathological conditions such as cataracts.

מחבר זרקור: חקירת התפתחות ותפקוד עדשה באמצעות מיקרו-הזרקה של רטרו-וירוס RCAS(A) בעדשת עוף עוברית 

מיקרו-הזרקה של רטרו-וירוס רקומביננטי RCAS(A) לעדשת עוף עוברית

The presented methodology of embryonic chicken lens microinjection of a RCAS retrovirus is meant as a tool for studying in situ function and expression of proteins during lens development. Compared to other approaches, such as transgenic models and ex vivo cultures, the RCAS replication-competent avian retrovirus provides a highly-effective, rapid, and customizable system for expressing exogenous proteins in chick embryos. Targeted gene transfer can be confined to proliferative lens fiber cells without the need for promoters.There is prominent potential for utilizing this methodology to study lens development, differentiation, cellular communication, and disease progression, and for the discovery and testing of therapeutic targets for lens pathological conditions such as cataracts.

לאחר קביעת חלבון מטרה ספציפי וזיהוי רצפי הגנים הקשורים, הגישה הניסויית הכוללת כוללת שיבוט של רצפי הגן לווקטור RCAS(A) רטרו-ויראלי על ידי השיבוט הראשוני לווקטור מתאם, ואחריו וקטור נגיפי. שנית, חלקיקים נגיפיים בעלי טיטר גבוה מוכנים באמצעות תאי אריזה כדי לקצור ולרכז את הנגיפים. שני הצעדים העיקר?...

Watch this Scientific Journal Video about Investigating Lens Development and Function Through Microinjection of RCASA Retrovirus in Embryonic Chicken Lens at JoVE.com

מאמר פרוטוקול זה מתאר את המתודולוגיה של מיקרו-הזרקה של רטרו-וירוס RCAS(A) בעדשת עוף עוברית ככלי לחקר תפקוד באתרו וביטוי חלבונים במהלך התפתחות העדשה.

Embryonic chicken (Gallus domesticus) is a well-established animal model for the study of lens development and physiology, given its high degree of ...

המתודולוגיה המוצגת של מיקרו-הזרקה של עדשת עוף עוברית של רטרו-וירוס RCAS נועדה ככלי לחקר תפקוד באתרו וביטוי חלבונים במהלך התפתחות העדשה. בהשוואה לגישות אחרות, כגון מודלים טרנסגניים ותרביות ex vivo, רטרו-וירוס העופות בעל יכולת השכפול של RCAS מספק מערכת יעילה, מהירה וניתנת להתאמה אישית לביטוי חלבונים אקסוגניים בעוברי אפרוחים. העברת גנים ממוקדת יכולה להיות מוגבלת לתאי סיבי עדשה מתרבים ללא צורך במקדמים.קיים פוטנציאל בולט לשימוש במתודולוגיה זו לחקר התפתחות עדשות, התמיינות שלהן, תקשורת תאית והתקדמות מחלות, ולגילוי ובדיקה של מטרות טיפוליות למצבים פתולוגיים של עדשות כגון קטרקט.

microinjection-recombinant-rcasa-retrovirus-into-embryonic-chicken

Research

JoVE Journal

Biology

Microinjection of Recombinant RCAS(A) Retrovirus into Embryonic Chicken Lens

701 Views.  University of Texas Health Science Center, San Antonio. המתודולוגיה המוצגת של מיקרו-הזרקה של עדשת עוף עוברית של רטרו-וירוס RCAS נועדה ככלי לחקר תפקוד באתרו וביטוי חלבונים במהלך התפתחות העדשה. בהשוואה לגישות אחרות, כגון מודלים טרנסגניים ותרביות ex vivo, רטרו-וירוס העופות בעל יכולת השכפול של RCAS מספק מערכת יעילה, מהירה וניתנת להתאמה אי?...

Video: מחבר זרקור: חקירת התפתחות ותפקוד עדשה באמצעות מיקרו-הזרקה של רטרו-וירוס RCAS(A) בעדשת עוף עוברית 

Embryonic chicken (Gallus domesticus) is a well-established animal model for the study of lens development and physiology, given its high degree of similarity with the human lens. RCAS(A) is a replication-competent chicken retrovirus that infects dividing cells, which serves as a powerful tool to study the in situ expression and function of wild-type and mutant proteins during lens development by microinjection into the empty lumen of lens vesicle at early developmental stages, restricting its action to surrounding proliferating lens cells. Compared to other approaches, such as transgenic models and ex vivo cultures, the use of an RCAS(A) replication-competent avian retrovirus provides a highly effective, rapid, and customizable system to express exogenous proteins in chick embryos. Specifically, targeted gene transfer can be confined to proliferative lens fiber cells without the need for tissue-specific promoters. In this article, we will briefly overview the steps needed for recombinant retrovirus RCAS(A) preparation, provide a detailed, comprehensive overview of the microinjection procedure, and provide sample results of the technique.

This protocol paper describes the methodology of embryonic chicken lens microinjection of an RCAS(A) retrovirus as a tool for studying in situ function and expression of proteins during lens development.

Preparation of Chicken Lens for Microinjection of an RCAS(A) Retrovirus

To begin, attach the borosilicate glass capillary to the rubber cushioned clips in the manual vertical micropipette puller. Set the heat temperature of the micropipette puller to 950 degrees Celsius and perform pre-pulling to obtain a thinner and softer glass capillary. Then set the heat temperature to 790 degrees Celsius and perform a secondary pulling to produce final micropipettes.Using a micropipette grinder, carefully sharpen the tip opening to an outer diameter of 11 micrometers. Then place the micropipettes in a sponge clamping pad inside of a glass jar. Incubate the fertilized chicken eggs until development stage 18 in a 37 degree Celsius humidified rocking incubator.Wipe down the working area thoroughly with 70%ethanol. After development, remove the eggs from the incubator. Spray the eggs with 70%ethanol and allow them to air dry.Then place the egg on an egg holder with the larger end facing upwards. Using a pair of sharp toothed forceps, carefully tap on the larger end of the eggshell to create a two centimeter diameter hole. Then remove the fragments of the egg shell.Place the egg on a dissecting microscope stage and locate the embryo. Next, use the fine dissecting forceps and scissors to cut off the amniotic membrane covering the top of the embryo. Then place a 60 millimeter Petri dish over the opening of the egg.

הכנת עדשת עוף למיקרו-הזרקה של רטרו-וירוס RCAS(A)

Microinjection of an RCAS(A) Retrovirus into Embryonic Chicken Lens for Expressing Exogenous Proteins 

To begin, thaw the RCAS(A)retrovirus stock on ice. To avoid clogging the micropipette, centrifuge the solution at 10, 000 G for 10 seconds at four degrees Celsius and transfer the supernatant into a new tube while keeping the solutions on ice. Place a stretched laboratory parafilm on a 35 by 10 millimeter cell culture dish and add one microliter of sterile PBS to the parafilm.Connect a prepared glass micropipette to an automatic Pico injector. Press the fill mode to fill the PBS into a micropipette and then press the inject mode to test the allocated one microliter of liquid. Place a second piece of stretched laboratory parafilm on a new cell culture dish and add one microliter of fast green stained viral stock to the film.Lower the tip of the micropipette into the viral stock, and press the fill mode to fill the micropipette with one microliter of viral stock. Under a dissecting microscope, lower the filled micropipette connected to an automatic injector into the target region of the chicken embryo lens. Then adjust the light source to provide a clear view of the lens vesicle.After ensuring the micropipette is within the correct location inside the lens lumen, inject five to 40 nanoliters of the viral stock. After injection, wait 45 seconds before gently removing the micropipette. Next, check the successful microinjection by examining the fast green dye in the empty lumen of the lens without an leakage.Following examination, seal the eggshell opening with scotch tape and place the eggs in a 37 degree Celsius humidified static incubator. This study demonstrates the histological evaluation of the chimeric connexon 50 and 43 loops through immunofluorescence. Using Anti-Flag labeling, exogenous connexons were distinguished from endogenous ones.The study also evaluates the interaction between the intracellular loop domain of connexon 50 and Aquaporin zero.