Reconhecemos o apoio do NIH Innovator Award Nova DP2 116520 e ORAU Ralph Powe Júnior Prêmio Valorização da Faculdade.

1. Manutenção de células <ol><li> HESC H1 (WiCell) foram mantidos em células estaminais embrionárias humanas qualificados Matrigel poços revestidos com mTeSR1 mídia, com os meios de mudar a cada dia. Os poços foram revestidos por solução diluída de matrigel, preparado por adição de 300 ul de matrigel hESC em 25 ml de DMEM: F12. 1 ml desta solução matrigel foi adicionado a cada poço de uma placa de seis bem, ou 400 ul adicionados a cada poço de uma placa de 12 poços e deixou-se revestimento durante 1 hora à temperatura ambiente. As células foram passadas mecanicamente a uma razão de divisão de 1:4 por raspagem colónias uma vez que eles atingiram entre 1 e 1,5 milímetros de diâmetro. </li><li> RHMVEC (VEC tecnologias) foi mantida em MCDB-131 meios de comunicação com a mídia mudar a cada dois dias. As células foram divididos por tripsinização uma vez confluência de 80% foi atingido a uma razão de divisão de 1:3. As células endoteliais entre as passagens 3 e 7 foram utilizados para este estudo. </li></ol> 2. Preparação das soluções de reserva <ol><li> Activina A foi reconstituído em 50 ug / mL em P estérilBS contendo 0,1% de albumina de soro bovino. A solução foi distribuído por alíquotas e armazenado a -20 ° C. </li><li> EGF foi reconstituído em 500 ug / mL em estéril ácido acético 10 mM. A solução foi distribuído por alíquotas e armazenado a -20 ° C. </li><li> A insulina foi reconstituído a 10 mg / ml pela adição de H2O acidificada (pH ≤ 2), preparado por adição de 0,1 ml de ácido acético glacial a 10 ml de água. </li><li> DAPT foi reconstituído em DMSO a 18 mg / ml. Foi ainda diluída até 300 uM de concentração em DMEM: F12, aliquotas a -20 ° C. </li><li> KAAD ciclopamina-foi reconstituído em DMSO a 5mg/ml. Foi ainda diluído para 2 mM de concentração em DMEM: F12, aliquotas a -20 ° C. </li><li> Ácido trans-retinóico foi reconstituído em 2,7 mg / ml em etanol a 95%. Foi ainda diluído para 2 mM de concentração em DMEM: F12, aliquotas a -80 ° C. </li></ol> 3. Endoderma definitivo (DE) e pâncreas Progenitor de indução (PP) <ol><li> Uma vez que hCES colónias atingiu entre 1 e 1,5 milímetros de diâmetro, a indução DE foi realizada adicionando DMEM: F12 suplementado com B27, BSA 0,2%, 100 ng / ml Activina A e 1 wortmannin iM durante 4 dias (Dia 0 Dia-4) com meios mudam todos os dias. </li><li> Após a indução DE estava completa, a indução de células progenitoras de pâncreas foi induzida pela alteração dos meios de comunicação para DMEM: F12 suplementado com B27, BSA 0,2% e KAAD-ciclopamina a 0,2 uM durante 24 horas (Dia 4 Dia-5). </li><li> Após 24 horas meio foi mudado para DMEM: F12 suplementado com B27, 0,2% de BSA, KAAD-ciclopamina a 0,2 uM e ácido all-trans retinóico em 2 concentração iM durante 3 dias com os meios de mudar a cada dia (dia 5-Dia 8) . </li></ol> 4. Maturação de pâncreas <ol><li> Após a indução de PP, todos os grupos foram mudadas para meio de maturação compostos de DMEM: F12 suplementado com B27 0,2% de BSA, 10 mM de nicotinamida, 25 insulina ug / ml, 30 nM Na, 2 ug SeO 3 e 50 / transferrina ml para 2 days com a mídia mudam todos os dias (Dia 8 Dia-10). </li><li> Após 2 dias em meio de maturação, o passo de maturação final é realizada em paralelo utilizando várias condições diferentes para comparação. Diferenciação foi induzida sob as seguintes condições: (i) utilizando entalhe inibidor DAPT (ii) co-cultura utilizando meios apenas, sem células endoteliais como controlo e (iii) usando contacto co-cultura com células RHMVEC. As células foram mantidas em meios DAPT ou co-cultura durante uma semana (Dia 10 Dia-17) com os meios de mudar a cada dia. <ol><li> Mídia DAPT foi preparado, completando os meios de maturação com 30 DAPT mM. Células nesta grupos foram primeiro expostas para completar MCDB131 durante 24 horas e em seguida exposto a meios DAPT durante 6 dias (Dia 11 Dia-17). </li><li> Co-cultura meio foi preparado, completando MCDB-131 meios de comunicação com B27, 0,2% de BSA, 10 mM de nicotinamida, 10 ng / ml de EGF, 1 ug / ml de hidrocortisona, 10 mg EndoGro, 90 ug / ml de heparina. Para a mídia condição de controle de diferenciação das células foram expostaspara MCDB-131 meio completo, durante 24 horas (Dia 10 Dia-11), após o que o meio foi alterado para co-cultura media durante 6 dias (Dia 11 Dia-17) (sem células endoteliais). </li><li> Para a condição de contacto co-cultura, um milhão RHMVEC foi adicionado às células de diferenciação em completos MCDB-131 meios (VEC tecnologias) durante 24 horas (Dia 10 Dia-11) para permitir a ligação. Depois de mídia 24 horas foi alterado para co-cultura de mídia para 6 dias (dia 11 Dia-17) com meios de comunicação mudam todos os dias. </li></ol></li></ol> 5. qRT-PCR <ol><li> No final de cada fase de diferenciação (endoderme; progenitor pancreática; ilhota maduro) foram lisadas e RNA foi extraído usando NucleoSpin RNA extraction kit II de acordo com as instruções do fabricante. </li><li> RNA foi analisada a qualidade, verificando absorvância RNA em 260 nm e 280 nm, seguido por quantificação de RNA usando uma SmartSpec Além disso espectrofotómetro. </li><li> A transcrição reversa foi realizada utilizando ImProm II k transcrição reversalo de acordo com as instruções do fabricante. Todas as reacções foram realizadas com 100 ng de RNA. </li><li> qRT-PCR foi realizada utilizando o sistema de Mx3005P QPCR (Agilent) e Brilliant II SYBR Green QPCR mistura principal de acordo com as instruções do fabricante. Os iniciadores utilizados estão listados na tabela 1. A etapa de inicialização foi realizada a 50 ° C durante 2 minutos, seguido por 95 ° C durante 10 minutos. 50 ciclos de amplificação foram realizadas como se segue: 95 ° C durante 30 segundos, 54 ° C durante 30 segundos e 72 ° C durante 1 minuto. </li><li> Mudança de dobragem de expressão de mRNA-alvo ao longo células indiferenciadas foi calculada a partir dos valores de TC usando as seguintes fórmulas: ΔCT (marcador i) = CT (marcador i) - CT (GAPDH) Δ ΔCT (marcador i) = ΔCT (marcador i) (Amostra) - ΔCT (marcador i) (células indiferenciadas) A expressão relativa (Marker i) = 2-ΔΔCT(Marcador i) </li></ol> 6. Imunocitoquímica <ol><li> No final de cada fase de diferenciação (endoderme; progenitor pancreática; ilhota madura), as células foram fixadas em formaldeído a 4% durante 15 minutos à temperatura ambiente. </li><li> As células fixas foram permeabilizadas usando 0,25% de Triton X-100 (TX) durante 15 minutos. </li><li> Coloração não específica foi bloqueada por incubação em soro burro 10% em 0,05% TX durante 30 minutos. </li><li> Incubação do anticorpo primário foi realizada durante a noite a 4 ° C em tampão de bloqueio na diluição de anticorpo recomendada (ver tabela 1). </li><li> As células foram lavadas com 0,05% de TX três vezes durante 5 minutos. </li><li> Incubação do anticorpo secundário foi realizada durante uma hora à temperatura ambiente no escuro com anticorpos adequados diluídas em tampão de bloqueio. </li><li> As células foram lavadas com 0,05% de TX três vezes durante 5 minutos. </li><li> A coloração nuclear foi realizada por incubação com Hoescht mancha na diluição 1:1000 em PBSdurante 5 minutos, seguido por 3 lavagens com PBS. </li><li> Células fixadas e coradas foram fotografadas usando microscópio Olympus IX81 invertido e Metamorph software de imagem. </li></ol> 7. Os resultados representativos A adição de Activina A e wortmannin para hESC indiferenciada durante 4 dias induz endoderme definitivo como confirmado por qRT-PCR para marcadores DE Sox17 e CXCR4, e Foxa2 e imunocoloração para Sox17 como ilustrado na Figura 2. Diferenciação para células progenitoras pancreáticas após a adição de ácido retinóico e ciclopamina foi confirmada por qRT-PCR de marcadores pancreáticas progenitoras e imunocoloração para Pdx1 como ilustrado na Figura 3. Na fase final da diferenciação, contacto co-cultura com células RHMVEC fortemente induzidas upregulation de expressão de insulina nas células estaminais embrionárias humanas derivadas de células progenitoras pancreáticas. A eficiência de co-cultura diferenciação mediada foi analisado por comparing com a condição de controle usando DAPT. DAPT foi utilizado como um controlo positivo, uma vez que é actualmente um dos métodos mais amplamente utilizados para atingir a maturação pancreático. Uma vez que a co-cultura foi realizada em meio modificado, suplementado por factores de suporte de células endoteliais, controle adicional foi realizada com os meios de comunicação, na ausência de células endoteliais para verificar o efeito dos meios de comunicação em diferenciação. Detalhes desta análise são apresentados na Figura 4. <img alt="Figura 1." src="/files/ftp_upload/3759/3759fig1.jpg" /> Figura 1. Multi-estágio protocolo para a diferenciação de hESC em células que expressam de insulina. <img alt="Figura 2." src="/files/ftp_upload/3759/3759fig2.jpg" /> Figura 2. Indução endoderma definitivo de células estaminais embrionárias humanas. A) análise de qRT-PCR de marcadores representativos DE em células expostas a células estaminais embrionárias humanas Activina A e wortmannin durante 4 dias. Resultados ar<html> e normalizada em relação ao hESC indiferenciada. B) Sox17 coloração (verde) e DAPI (azul) mostraram expressão nuclear de Sox17. Barra de escala: de 50 um. <img alt="Figura 3." src="/files/ftp_upload/3759/3759fig3.jpg" /> Figura 3. Indução de células progenitoras do pâncreas do de células estaminais embrionárias derivadas de células endoderme. A) análise de qRT-PCR de marcadores pancreáticas iniciais em células derivadas hESC endoderme expostos ao ácido retinóico ciclopamina e durante 4 dias após a indução DE. Resultados normalizados com respeito a hESC indiferenciada. B) Pdx1 coloração (violeta) e DAPI (azul) mostraram expressão nuclear de Pdx1. Barra de escala: de 50 um. &quot;&gt; <img alt="Figura 4." src="/files/ftp_upload/3759/3759fig4.jpg" /> Figura 4. Fase de maturação do pâncreas A) análise de qRT-PCR de hormonas pancreáticas na hESC após a maturação pancreática utilizando DAPT, contacto meios co-cultura ou de co-cultura (controlo). Resultados normalizados com respeito a hESC indiferenciada. valores p obtidos pelo teste t de Student. B) co-cultura com Dil-Ac-LDL RHMVEC rotulada (vermelho) mostram regiões onde ECs ligam à placa se existem espaços vazios (topo), RHMVEC outro pode ser encontrada em contacto directo com o CES diferenciador (parte inferior). C) C-péptido de coloração (verde) para as células diferenciadas com co-cultura método. Barra de escala: 12,5 mM (superior) e 50 mM (Inferior) D) A imunomarcação de RHMVEC demonstra nenhuma expressão de insulina no RHMVEC. <table border="1"><tbody><tr><td> Marcador </td><td> Primer1 (5 &#39;para 3&#39;) &lt;/ Td&gt; <td> Primer2 (5 &#39;para 3&#39;) </td><td> Ref </td></tr><tr><td> SOX17 </td><td> CTCTGCCTCCTCCACGAA </td><td> CAGAATCCAGACCTGCACAA </td><td> 12 </td></tr><tr><td> CXCR4 </td><td> CACCGCATCTGGAGAACCA </td><td> GCCCATTTCCTCGGTGTAGTT </td><td> 4 </td></tr><tr><td> FOXA2 </td><td> GGAGCGGTGAAGATGGAA </td><td> TACGTGTTCATGCCGTTCAT </td><td> 12 </td></tr><tr><td> PDX1 </td><td> AAGTCTACCAAAGCTCACGCG </td><td> GTAGGCGCCGCCTGC </td><td> 4 </td></tr><tr><td> PTF1 </td><td> CATAGAGAACGAAACCACCCTTTGAG </td><td> GCACGGAGTTTCCTGGACAGAGTTC </td><td> 12 </td></tr><tr><td> HLXB9 </td><td> CACCGCGGGCATGATC </td><td> ACTTCCCCAGGAGGTTCGA </td><td> 4 </td></tr><tr><td> HNF6 </td><td> TGTGGAAGTGGCTGCAGGA </td><td> TGTGAAGACCAACCTGGGCT </td><td> 5 </td></tr><tr><td> PAX6 </td><td> CGAATTCTGCAGGTGTCCAA </td><td> ACAGACCCCCTCGGACAGTAAT </td><td> 5 </td></tr><tr><td> NKX6.1 </td><td> AGACCCACTTTTTCCGGACA </td><td> CCAACGAATAGGCCAAACGA </td><td> 5 </td></tr><tr><td> ISL1 </td><td> GATCTATGTCACCTCGCAAGG </td><td> TACAACCACCATTTCACTG </td><td> 12 </td></tr><tr><td> GLUCAGON </td><td> AGGCAGACCCACTCAGTGA </td><td> AACAATGGCGACCTCTTCTG </td><td> 4 </td></tr><tr><td> INSULINA </td><td> AAGAGGCCATCAAGCAGATCA </td><td> CAGGAGGCGCATCCACA </td><td> 12 </td></tr></tbody></table> Primers Tabela 1. Usado para reações qPCR.

<ol>
	<li>De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Les+cellules+souches+embryonnaires+humaines+:+de+la+transgression+de+l'embryon+humain+&#225;+la+m&#233;decine+r&#233;g&#233;n&#233;ratrice+de+demain.">Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain &#225; la m&#233;decine r&#233;g&#233;n&#233;ratrice de demain.</a> Gyn&#233;cologie Obst&#233;trique &#38; Fertilit&#233;. 37, 620-626 (2009).</li><li>Murtaugh, L. C., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes,+Signals,+and+Lineages+in+Pancreas+Development.">Genes, Signals, and Lineages in Pancreas Development.</a> Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).</li><li>Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+definitive+endoderm+from+embryonic+stem+cells+in+culture.">Development of definitive endoderm from embryonic stem cells in culture.</a> Development. 131, 1651-1662 (2004).</li><li>D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells.">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat. Biotech. 24, 1392-1401 (2006).</li><li>Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+differentiation+of+human+ES+cells+and+iPS+cells+into+mature+pancreatic+insulin-producing+cells.">Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells.</a> Cell Res. 19, 429-438 (2009).</li><li>Basma, H., Soto-Guti&#233;rrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+and+Transplantation+of+Human+Embryonic+Stem+Cell-Derived+Hepatocytes.">Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes.</a> Gastroenterology. 136, 990-999 (2009).</li><li>Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -. P., Chipperfield, H., Tan, E. -. K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+Differentiation+of+Human+Embryonic+Stem+Cells+into+the+Pancreatic+Endocrine+Lineage.">Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage.</a> Stem Cells and Development. 16, 561-578 (2007).</li><li>Kim, S. K., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pancreas+development+is+promoted+by+cyclopamine,+a+Hedgehog+signaling+inhibitor.">Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor.</a> Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).</li><li>Docherty, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Growth+and+development+of+the+islets+of+Langerhans:+implications+for+the+treatment+of+diabetes+mellitus.">Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus.</a> Current Opinion in Pharmacology. 1, 641-649 (2001).</li><li>Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., F&#228;ssler, R., Gu, G., Gerber, H. -. P., Ferrara, N., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Vascular+Basement+Membrane:+A+Niche+for+Insulin+Gene+Expression+and+[beta]&gt;+Cell+Proliferation.">The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]&gt; Cell Proliferation.</a> Developmental Cell. 10, 397-405 (2006).</li><li>Yoshitomi, H., Zaret, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endothelial+cell+interactions+initiate+dorsal+pancreas+development+by+selectively+inducing+the+transcription+factor+Ptf1a.">Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a.</a> Development. 131, 807-817 (2004).</li><li>Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Marked+differences+in+differentiation+propensity+among+human+embryonic+stem+cell+lines.">Marked differences in differentiation propensity among human embryonic stem cell lines.</a> Nat. Biotech. 26, 313-315 (2008).</li><li>Banerjee, I., Sharma, N., Yarmush, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+co-culture+on+pancreatic+differentiation+of+embryonic+stem+cells.">Impact of co-culture on pancreatic differentiation of embryonic stem cells.</a> J. Tissue Eng. Regen. Med. 5, 313-323 (2010).</li></ol>

Não temos nada a divulgar.

Durante o desenvolvimento de pâncreas, células pancreáticas de diferenciação estão em estreita proximidade com as células endoteliais da aorta, além disso, ilhéus pancreáticos são densamente vascularizado para promover a troca rápida de glicose no sangue e hormonas de ilhéus. Tendo em conta estes factos, não é surpreendente que as células endoteliais desempenham um papel importante no processo de organogénese pancreático. Embora a importância das células endoteliais durante o desenvolvimento pancreá...

<table border="1"><tbody><tr><td> Nome do reagente </td><td> Companhia </td><td> Número de catálogo </td><td> Concentrações </td></tr><tr><td> mTeSR1 (com suplemento) </td><td> Stem Cell Technologies </td><td> 5850 </td><td></td></tr><tr><td> hESC matrigel qualificado </td><td> BD Biosciences </td><td> 354277 </td><td></td></tr><tr><td> DMEM: F12 </td><td> Invitrogen </td><td> 11330-032 </td><td></td></tr><tr><td> MCDB-131 </td><td> Invitrogen </td><td> 10372019 </td><td></td></tr><tr><td> MCDB-131 (Completo) </td><td> VEC Technologies </td><td> MCDB-131 </td><td></td></tr><tr><td> B27 Suplemento </td><td> Invitrogen </td><td> 17504044 </td><td></td></tr><tr><td> Activina A </td><td> R &amp; D </td><td> <a href="http://www.rndsystems.com/pdf/338-ac.pdf">338-AC</a> </td><td> 100ng/ml </td></tr><tr><td> Wortmannin </td><td> Invitrogen </td><td> W3144 </td><td> 1μM </td></tr><tr><td> KAAD-Cyclopamie </td><td> Sigma-Aldrich </td><td> C4116 </td><td> 0.2μM </td></tr><tr><td> All-trans retinóico </td><td> Sigma-Aldrich </td><td> R2625 </td><td> 2μM </td></tr><tr><td> DAPT </td><td> Sigma-Aldrich </td><td> D5942 </td><td> 30μM </td></tr><tr><td> Nicotinamida </td><td> Sigma-Aldrich </td><td> N0636 </td><td> 10 mM </td></tr><tr><td> Selenito de sódio </td><td> Sigma-Aldrich </td><td> S5261 </td><td> 30 nM </td></tr><tr><td> Insulina </td><td> Sigma-Aldrich </td><td> I1882 </td><td> 25 ug / ml </td></tr><tr><td> Transferrina </td><td> Sigma-Aldrich </td><td> T8158 </td><td> 50 ug / ml </td></tr><tr><td> EGF </td><td> R &amp; D </td><td> <a href="http://www.rndsystems.com/pdf/236-eg.pdf">236-EG</a> </td><td> 10ng/ml </td></tr><tr><td> EndoGro </td><td> VEC Technologies </td><td> ENDOGRO </td><td> 10mg </td></tr><tr><td> Heparina </td><td> Sigma-Aldrich </td><td> H3149 </td><td> 90μg/ml </td></tr><tr><td> Hidrocortisona </td><td> Sigma-Aldrich </td><td> H0888 </td><td> 1μg/ml </td></tr><tr><td> NucleoSpin RNA II </td><td> Macherey Nagel </td><td> 740955 </td><td></td></tr><tr><td> ImProm II sistema de transcrição reversa </td><td> Promega </td><td> A3800 </td><td></td></tr><tr><td> Brilhante II SYBR Green QPCR mestre mix </td><td> Straragene </td><td> 600548 </td><td></td></tr><tr><td> Sox17 IgG de cabra policlonal </td><td> Santa Cruz </td><td> sc-17.355 </td><td> 1/500 </td></tr><tr><td> PDX1 cabra policlonal IgG </td><td> Santa Cruz </td><td> sc-14.662 </td><td> 1/500 </td></tr><tr><td> C-Peptide policlonal de coelho </td><td> Sinalização celular </td><td> 4593 </td><td> 1/500 </td></tr><tr><td> Alexa Fluor 488 burro anti-IgG de coelho </td><td> Invitrogen </td><td> A-21.206 </td><td> 1/1000 </td></tr><tr><td> Alexa Fluor 647 cabra burro anti-IgG </td><td> Invitrogen </td><td> A-21.447 </td><td> 1/1000 </td></tr></tbody></table> Tabela 2. Reagentes e kits.

endothelial cell co-culture mediates maturation of human embryonic stem cell to pancreatic insulin producing cells in a directed differentiation approach

Células-tronco embrionárias (ESC) tem duas características principais: eles podem ser propagadas in vitro indefinidamente em um estado indiferenciado e são pluripotentes, tendo assim o potencial de se diferenciar em várias linhagens. Essas propriedades fazem CES extremamente atraente para a terapia baseada em células e aplicações de tratamento regenerativo 1. No entanto, para o seu pleno potencial a ser realizado as células têm de ser diferenciada em fenótipos maduros e funcionais, o que é uma tarefa assustadora. Uma abordagem promissora na indução da diferenciação celular é a de perto imitar o caminho de organogénese na configuração in vitro. Desenvolvimento pancreática é conhecido para ocorrer em fases específicas 2, começando com endoderme, que pode desenvolver em vários órgãos, incluindo fígado e pâncreas. Indução endoderme pode ser conseguido por modulação da via nodal através da adição de Activina A 3 em combinação com vários factores de crescimento de 4-7 </sup&gt;. Células endoderme definitivos, em seguida, submetidos a compromisso pancreática por inibição da sónica inibição hedgehog, que pode ser conseguida in vitro por adição de ciclopamina 8. Maturação pancreática é mediada por vários eventos paralelos, incluindo inibição da sinalização do entalhe; agregação de células progenitoras pancreáticas em 3-dimensionais aglomerados; indução da vascularização; para nomear alguns. De longe o mais bem sucedido na maturação in vitro de células progenitoras derivadas do CES pancreáticas foram alcançados através da inibição da sinalização Notch por DAPT suplementação 9. Embora bem sucedido, isto resulta em baixo rendimento do fenótipo maduro com funcionalidade reduzida. A área menos estudada é o efeito de células endoteliais de sinalização na maturação do pâncreas, que é cada vez mais apreciada como um fator importante que contribui para in-vivo ilhota pancreática maturação 10,11. O presente estudo explora o efeito de endothelial célula de sinalização na maturação de células progenitoras humanas CES derivados pancreáticas produtoras de insulina em ilhota células semelhantes. Relatamos um multi-estágio protocolo diferenciação dirigida para onde os CES humanos são primeiro induzida no sentido endoderme por Activina A, juntamente com a inibição da via PI3K. Especificação do pâncreas de células endoderme é conseguido através da inibição da sinalização por Sonic hedgehog ciclopamina juntamente com a indução de retinóide por adição de ácido retinóico. A fase final de maturação é induzida pela sinalização celular endotelial conseguido através de uma configuração de co-cultura. Embora várias células endoteliais foram testados na co-cultura, aqui apresentamos os nossos dados com células de rato do coração microvasculares endoteliais (RHMVEC), principalmente para a facilidade de análise.

Watch this Scientific Journal Video about Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach at J

Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach

O presente estudo descreve uma abordagem diferenciada dirigida em induzir a diferenciação de pâncreas de células estaminais embrionárias humanas. De grande importância é a constatação de que células endoteliais co-cultura maturação media de células-tronco embrionárias humanas derivadas progenitores pâncreas em células que expressam insulina.

Células endoteliais em co-cultura Maturação media de células estaminais humanas embrionárias a células pancreáticas produtoras de insulina em uma abordagem diferenciada Direção

Embryonic stem cells (ESC) have two main characteristics: they can be indefinitely propagated in vitro in an undifferentiated state and they are ...

endothelial-cell-co-culture-mediates-maturation-human-embryonic-stem

Research

JoVE Journal

Biology

16.2K visualizações.  University of Pittsburgh. O presente estudo descreve uma abordagem diferenciada dirigida em induzir a diferenciação de pâncreas de células estaminais embrionárias humanas. De grande importância é a constatação de que células endoteliais co-cultura maturação media de células-tronco embrionárias humanas derivadas progenitores pâncreas em células que expressam insulina.

Vídeo: Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach

Derivation of Hematopoietic Stem Cells from Murine Embryonic Stem Cells

A stem cell is defined as a cell with the capacity to both self-renew and generate multiple differentiated progeny.  Embryonic stem cells (ESC) are derived from the blastocyst of the early embryo and are pluripotent in differentiative ability.  Their vast differentiative potential has made them the focus of much research centered on deducing how to coax them to generate clinically useful cell types.  The successful derivation of hematopoietic stem cells (HSC) from mouse ESC has recently been accomplished and can be visualized in this video protocol.  HSC, arguably the most clinically exploited cell population, are used to treat a myriad of hematopoietic malignancies and disorders.  However, many patients that might benefit from HSC therapy lack access to suitable donors.  ESC could provide an alternative source of HSC for these patients.  The following protocol establishes a baseline from which ESC-HSC can be studied and inform efforts to isolate HSC from human ESC.  In this protocol, ESC are differentiated as embryoid bodies (EBs) for 6 days in commercially available serum pre-screened for optimal hematopoietic differentiation.  EBs are then dissociated and infected with retroviral HoxB4.  Infected EB-derived cells are plated on OP9 stroma, a bone marrow stromal cell line derived from the calvaria of  M-CSF-/- mice, and co-cultured in the presence of hematopoiesis promoting cytokines for ten days.  During this co-culture, the infected cells expand greatly, resulting in the generation a heterogeneous pool of 100s of millions of cells.  These cells can then be used to rescue and reconstitute lethally irradiated mice.

This protocol details the derivation of transplantable hematopoietic stem cells from mouse embryonic stem cells (ESC) and their subsequent injection into lethally irradiated recipient mice. Briefly, ESC are differentiated as embryoid bodies, which are then infected with retroviral HoxB4 and co-cultured with OP9 stromal cells and hematopoietic cytokines.

Derivação de Células-Tronco Hematopoéticas murino de Células-Tronco Embrionárias

A stem cell is defined as a cell with the capacity to both self-renew and generate multiple differentiated progeny.  Embryonic stem cells (ESC) are ...

Biologia

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

Derivação de células estaminais embrionárias humanas por Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Embryonic Stem Cell-Derived Endothelial Cells for Treatment of Hindlimb Ischemia

Peripheral arterial disease (PAD) results from narrowing of the peripheral arteries that supply oxygenated blood and nutrients to the legs and feet, This pathology causes symptoms such as intermittent claudication (pain with walking), painful ischemic ulcerations, or even limb-threatening gangrene. It is generally believed that the vascular endothelium, a monolayer of endothelial cells that invests the luminal surface of all blood and lymphatic vessels, plays a dominant role in vascular homeostasis and vascular regeneration. As a result, stem cell-based regeneration of the endothelium may be a promising approach for treating PAD.In this video, we demonstrate the transplantation of embryonic stem cell (ESC)-derived endothelial cells for treatment of unilateral hindimb ischemia as a model of PAD, followed by non-invasive tracking of cell homing and survival by bioluminescence imaging. The specific materials and procedures for cell delivery and imaging will be described. This protocol follows another publication in describing the induction of hindlimb ischemia by Niiyama et al.1

The surgical procedure for delivery of embryonic stem cell-derived endothelial cells to the ischemic hindlimb is demonstrated, with non-invasive tracking by bioluminescence imaging.

Embrionárias com células-tronco derivadas de células endoteliais para tratamento da isquemia dos membros posteriores

Peripheral arterial disease (PAD) results from narrowing of the peripheral arteries that supply oxygenated blood and nutrients to the legs and feet, This ...

Isolation and Large Scale Expansion of Adult Human Endothelial Colony Forming Progenitor Cells

This paper introduces a novel recovery strategy for endothelial colony forming progenitor cells (ECFCs) from heparinized but otherwise unmanipulated adult human peripheral blood within a mean of 12 days. After large scale expansion &gt;1x108 ECFCs can be obtained for further tests. Advantageously by using pHPL the contact of human cells with bovine serum antigens can be excluded. By flow cytometry and immunohistochemistry the isolated cells can be characterized as ECFC and their in vitro functionality to form vascular like structures can be tested in a matrigel assay. Further these cells can be subcutaneously injected in a mouse model to form functional, perfused vessels in vivo. After long term expansion and cryopreservation proliferation, function and genomic stability appear to be preserved. 3,4
This animal-protein free isolation and expansion method is easily applicable to generate a large quantity of ECFCs.

Endothelial colony forming progenitor cells (ECFCs) are a promising tool to study vascular homeostasis and repair.1,2 This paper introduces a novel animal-serum free method for isolation and expansion of ECFC from heparinised adult human peripheral blood with pooled human platelet lysate (pHPL) diminishing the risk of anti-bovine immunisation.

Isolamento e expansão em grande escala de Adulto Humanos endotelial Colony Células Progenitoras Forming

This paper introduces a novel recovery strategy for endothelial colony forming progenitor cells (ECFCs) from heparinized but otherwise unmanipulated adult ...

Isolation and Animal Serum Free Expansion of Human Umbilical Cord Derived Mesenchymal Stromal Cells (MSCs) and Endothelial Colony Forming Progenitor Cells (ECFCs)

The umbilical cord is a rich source for progenitor cells with high proliferative potential including mesenchymal stromal cells (also termed mesenchymal stem cells, MSCs) and endothelial colony forming progenitor cells (ECFCs). Both cell types are key players in maintaining the integrity of tissue and are probably also involved in regenerative processes and tumor formation.
To study their biology and function in a comparative manner it is important to have both cells types available from the same donor. It may also be beneficial for regenerative purposes to derive MSCs and ECFCs from the same tissue.
Because cellular therapeutics should eventually find their way from bench to bedside we established a new method to isolate and further expand progenitor cells without the use of animal protein. Pooled human platelet lysate (pHPL) replaced fetal bovine serum in all steps of our protocol to completely avoid contact of the cells to xenogeneic proteins.
This video demonstrates a methodology for the isolation and expansion of progenitor cells from one umbilical cord.
All materials and procedures will be described.

Isolation and Animal Serum Free Expansion of Human Umbilical Cord Derived Mesenchymal Stromal Cells MSCs and Endothelial Colony Forming Progenitor Cells ECFCs

This protocol describes the isolation and subsequent expansion of mesenchymal stromal cells and endothelial colony forming cells without the use of animal serum to generate autologous pairs for experimental transplantation purposes.

Isolamento e animais de Expansão de soro livre de cordão umbilical humano Derivado células mesenquimais estromais (MSCs) e endoteliais Células Progenitoras Colony Forming (ECFCs)

The umbilical cord is a rich source for progenitor cells with high proliferative potential including mesenchymal stromal cells (also termed mesenchymal ...

Video Bioinformatics Analysis of Human Embryonic Stem Cell Colony Growth

Because video data are complex and are comprised of many images, mining information from video material is difficult to do without the aid of computer software.  Video bioinformatics is a powerful quantitative approach for extracting spatio-temporal data from video images using computer software to perform dating mining and analysis. In this article, we introduce a video bioinformatics method for quantifying the growth of human embryonic stem cells (hESC) by analyzing time-lapse videos collected in a Nikon BioStation CT incubator equipped with a camera for video imaging. In our experiments, hESC colonies that were attached to Matrigel were filmed for 48 hours in the BioStation CT.  To determine the rate of growth of these colonies, recipes were developed using CL-Quant software which enables users to extract various types of data from video images.  To accurately evaluate colony growth, three recipes were created. The first segmented the image into the colony and background, the second enhanced the image to define colonies throughout the video sequence accurately, and the third measured the number of pixels in the colony over time.  The three recipes were run in sequence on video data collected in a BioStation CT to analyze the rate of growth of individual hESC colonies over 48 hours. To verify the truthfulness of the CL-Quant recipes, the same data were analyzed manually using Adobe Photoshop software. When the data obtained using the CL-Quant recipes and Photoshop were compared, results were virtually identical, indicating the CL-Quant recipes were truthful. The method described here could be applied to any video data to measure growth rates of hESC or other cells that grow in colonies. In addition, other video bioinformatics recipes can be developed in the future for other cell processes such as migration, apoptosis, and cell adhesion.  

Video bioinformatics is the automated processing, analysis, understanding, and data mining of biological spatio-temporal data extracted from microscopic videos. The purpose of this article is to demonstrate a method for measuring human embryonic stem cell colony growth using a video bioinformatics method.

Vídeo Bioinformática Análise de Crescimento Humano embrionárias Colony Stem Cell

Because video data are complex and are comprised of many images, mining information from video material is difficult to do without the aid of computer ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant interest in deriving a pure population of lineage-committed oligodendrocyte precursor cells (OPCs) for transplantation. OPCs are characterized by the activity of the transcription factor Olig2 and surface expression of a proteoglycan NG2. Using the GFP-Olig2 (G-Olig2) mouse embryonic stem cell (mESC) reporter line, we optimized conditions for the differentiation of mESCs into GFP+Olig2+NG2+ OPCs. In our protocol, we first describe the generation of embryoid bodies (EBs) from mESCs. Second, we describe treatment of mESC-derived EBs with small molecules: (1) retinoic acid (RA) and (2) a sonic hedgehog (Shh) agonist purmorphamine (Pur) under defined culture conditions to direct EB differentiation into the oligodendroglial lineage. By this approach, OPCs can be obtained with high efficiency (&gt;80%) in a time period of 30 days. Cells derived from mESCs in this protocol are phenotypically similar to OPCs derived from primary tissue culture. The mESC-derived OPCs do not show the spiking property described for a subpopulation of brain OPCs in situ. To study this electrophysiological property, we describe the generation of spiking mESC-derived OPCs by ectopically expressing NaV1.2 subunit. The spiking and nonspiking cells obtained from this protocol will help advance functional studies on the two subpopulations of OPCs.

We describe a small molecule-based protocol for differentiation of mouse embryonic stem cells into oligodendrocyte precursor cells (OPCs). This protocol generates Olig2+NG2+ OPCs with high efficiency by 30 days of differentiation. We also describe a method to generate "spiking" OPCs that can fire action potentials.

Diferenciação de células-tronco embrionárias em precursores oligodendroglial

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three embryonic germ layers (1). Directed differentiation of hESCs into specific cell types has generated much interest in the field of regenerative medicine (e.g., (2-5)), and methods for determining the in vivo fate of selected or manipulated hESCs are essential to this endeavor. We have adapted a highly efficient teratoma formation assay for this purpose. A small number of specifically selected hESCs is mixed with undifferentiated wild type hESCs and Phaseolus vulgaris lectin to form a cell pellet. This is grafted beneath the kidney capsule in an immunodeficient mouse. As few as 2.5 x 105 hESCs are needed to form a 16 cm3 teratoma within 8-12 weeks. The fate of the originally selected hESCs can then be determined by immunohistochemistry. This method provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Directed differentiation of hESCs into specific cells has generated much interest in regenerative medicine. We provide a concise, step-by-step protocol for determining the in vivo fate of selected hESCs that provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Mapeamento de destino de células estaminais embrionárias humanas por formação de teratomas

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three ...

Efficient Derivation of Human Cardiac Precursors and Cardiomyocytes from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based transplantation or by cardiac tissue engineering1-3. Cardiomyocytes become terminally-differentiated soon after birth and lose their ability to proliferate. There is no evidence that stem/progenitor cells derived from other sources, such as the bone marrow or the cord blood, are able to give rise to the contractile heart muscle cells following transplantation into the heart1-3. The need to regenerate or repair the damaged heart muscle has not been met by adult stem cell therapy, either endogenous or via cell delivery1-3. The genetically stable human embryonic stem cells (hESCs) have unlimited expansion ability and unrestricted plasticity, proffering a pluripotent reservoir for in vitro derivation of large supplies of human somatic cells that are restricted to the lineage in need of repair and regeneration4,5. Due to the prevalence of cardiovascular disease worldwide and acute shortage of donor organs, there is intense interest in developing hESC-based therapies as an alternative approach. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity6-8 (see a schematic in Fig. 1A). In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic9-11. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules12 (see a schematic in Fig. 1B). After screening a variety of small molecules and growth factors, we found that such defined conditions rendered nicotinamide (NAM) sufficient to induce the specification of cardiomesoderm direct from pluripotent hESCs that further progressed to cardioblasts that generated human beating cardiomyocytes with high efficiency (Fig. 2). We defined conditions for induction of cardioblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human cardiac cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of cardioblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human cardiac progenitors and functional cardiomyocytes for cardiovascular repair.

Derivação eficiente dos recursos humanos Precursores cardíaca e Cardiomyocytes pluripotentes a partir de células estaminais embrionárias humanas com a indução de moléculas pequenas

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based ...

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells (iPSCs) Using Retroviral Vector with GFP

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has been previously shown that human somatic cells can be reprogrammed to pluripotency by ectopic expression of four transcription factors (Oct4, Sox2, Klf4 and Myc) and become induced pluripotent stem cells (iPSCs)2-4 . Like hESCs, human iPSCs are pluripotent and a potential source for autologous cells. Here we describe the protocol to reprogram human fibroblast cells with the four reprogramming factors cloned into GFP-containing retroviral backbone4. Using the following protocol, we generate human iPSCs in 3-4 weeks under human ESC culture condition. Human iPSC colonies closely resemble hESCs in morphology and display the loss of GFP fluorescence as a result of retroviral transgene silencing. iPSC colonies isolated mechanically under a fluorescence microscope behave in a similar fashion as hESCs. In these cells, we detect the expression of multiple pluripotency genes and surface markers.

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells iPSCs Using Retroviral Vector with GFP

A method to generate human induced pluripotent stem cells (iPSCs) via retrovirus-mediated ectopic expression of OCT4, SOX2, KLF4 and MYC is described. A practical way to identify human iPSC colonies based on GFP expression is also discussed.

Reprogramação de células somáticas humanas em células tronco pluripotentes induzidas (iPSCs) usando vetor retroviral com GFP

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has ...