Trabalhar no laboratório Buchanan-Wollaston sobre o perfil do estágio de célula-tipo e de desenvolvimento específico é suportado pelo projeto AGRON-Omics (Grant # LSHG-CT-2006-037704) no-Programa-Quadro 6 º da Comissão Europeia. O trabalho no laboratório de Gifford no tipo de células perfil específico é suportado por um novo BBSRC Investigador de subvenção (BB/H019502/1). Os KC274 KC464 e linhas de Arabidopsis foram obtidos a partir de AAR Webb (Universidade de Cambridge).

1. Geração de protoplastos <ol><li> Material de colheita e corte de folha em 1 mm de largura (Figura 1) com uma lâmina de barbear. Para amostras que contêm mais do que uma única folha de até 15 folhas podem ser facilmente empilhadas antes de cortar. </li><li> Transferir imediatamente tiras de folha em uma placa de Petri 9 centímetros redondo contendo 20 ml de solução A (400 mM de manitol, 20 mM de hidrato de MES, 20 mM de KCl, 10 mM de CaCl2, 2 mM de MgCl2, 0,1% de BSA e 2,5 mM β-mercaptoetanol, pH 5,7) incluindo as enzimas protoplasting (1,2% de celulose de R-10, 0,6% de celulose e 0,4% de RS macerozyme R-10) e RNase e inibidores da transcrição (1 × ProtectRNA e 10 ug / ml de actinomicina D); suavemente separar as tiras de folha e vácuo para se infiltrar 2 × 5 min. </li><li> Prato Petri lugar em um agitador orbital ajustado para 90 rpm à temperatura ambiente e de protoplastos por 3-4 horas. <ol><li> Durante a incubação, as tiras de folhas devem ser separadas umas das outras, através da utilização de umconjunto de pinças planas, em intervalos de meia hora. </li></ol></li><li> Coloque um 70 um coador de células (Fisher Scientific) num tubo de 50 ml e cuidadosamente filtrar a solução através de protoplasting. Isto irá remover as tiras de folha, que serão retidos pelo crivo, permitindo que os protoplastos de passar. </li><li> Lave as tiras de folha com 4 ml de solução A e suavemente filtro através do mesmo crivo. </li><li> Transfira os protoplastos em tubos de fundo redondo e centrifugar a solução de protoplastos a 300 xg durante 5 min para sedimentar os protoplastos. </li><li> Aspirar cuidadosamente fora tanto do sobrenadante quanto possível, sem perturbar os protoplastos. </li><li> Lave os protoplastos com 5 ml de solução A e centrifugar a 300 xg durante 5 min. Remover o sobrenadante </li><li> Ressuspender os protoplastos em um volume apropriado de solução A, usando uma pipeta de Pasteur ou um P1000 ponta de corte. </li></ol> 2. FACS de protoplastos de folha </p&gt; <ol><li> Imediatamente antes da classificação, ressuspender os protoplastos usando uma (não corte) P1000 dica para evitar aglomeração protoplastos juntos. </li><li> Transferir para um tubo de protoplastos de triagem por meio de um filtro de 50 um filcon (BD Biosciences) e dilui-se, conforme adequado, para evitar o entupimento do bocal do classificador de células. Os protoplastos são classificados usando um bico de 100 ^ M a uma pressão de 20 psi (invólucro) e 21-21,5 psi (amostra), de uma frequência de 39,2 kHz e uma taxa de eventos de &lt;4000 (essas configurações são óptimas em um separador de células Influx BD (BD Biosciences) Otimização. nas máquinas de triagem outros celulares podem precisar de ajustes para essas configurações). </li><li> Protoplastos GFP positivas são identificadas usando um laser de árgon de 488 nm e traçando a saída do 580/30 passa-banda do filtro (cor de laranja) em relação ao filtro 530/40 passa-banda (verde). Protoplastos GFP positivas estará no alto 530/low 580 população, com GFP não-protoplastos em baixo 530 / baixo 580 mortos / população e protoplastos morrendo e detritos no alto 580 popumento (Figura 2). <ol><li> Ao classificar os protoplastos a partir de RNA que serão extraídos, protoplastos devem ser separados directamente para pelo menos 4 volumes de um tampão de lise contendo um agente redutor (por exemplo, β-mercaptoetanol). Além disso, o tempo de classificação de uma única amostra deve ser limitado a 20-30 min, e um máximo de duas a três amostras processadas ao mesmo tempo. </li><li> Para visualização dos protoplastos classificados, os protoplastos devem ser separados directamente para, pelo menos, oito volumes da solução A e, subsequentemente, recolhidos por centrifugação a concentrar os protoplastos. </li></ol></li></ol> 3. Resultados representativos Este protocolo descreve um método para a obtenção de protoplastos a partir de folhas de Arabidopsis, que são utilizados para a selecção de células activadas por fluorescência (Figura 1). Geração de protoplastos na presença de RNase e inibidores da transcrição impede o f célulasrom a montagem de uma resposta transcripcional. Isso não tem a conseqüência de dar origem a muitas protoplastos mortos e moribundos, que têm um nível significativo de autofluorescência. Ao classificar os protoplastos preparados com este método, portanto, é muito comum ver várias populações distintas em gráficos dos 580 nm vs 530 nm de fluorescência utilizado para a triagem. Exemplos deste, em conjunto com as portas de triagem utilizadas neste protocolo são mostrados na Figura 3. Protoplastos podem ser classificados em 8 volumes da solução A e recolhido para visualização para verificar o enriquecimento. Figura 2G mostra um exemplo deste utilizando a linha de TP382, que expressa GFP nas células guarda. Exemplos de rendimentos obtidos com este método, antes e depois de amplificação, são mostrados na Tabela 1. Os valores obtidos são suficientes para a amplificação, utilizando o Sistema Ovation Pico WTA (500 pg-50 ng) e, portanto, sanálise ubsequent por qualquer qPCR (figura 4), ​​a sequenciação geração seguinte ou microarray. <img alt="Figura 1" src="/files/ftp_upload/4214/4214fig1.jpg" /> Figura 1. Fluxo geral para o experimento. 1) Colheita deixa de interesse a partir de uma linha de Arabidopsis expressando GFP. 2) rapidamente cortado em ~ 1 mm de largura e imediatamente transferi-los para a solução protoplasting e vácuo infiltrar. 3) Incubar por 3-4 horas. 4) cuidadosamente filtrado solução protoplastos através de um peneiro de 70, a transferência para tubos de fundo redondo e protoplastos de pelotas por centrifugação. 5) Imediatamente antes da classificação, protoplastos Ressuspenda e transferir para um tubo de triagem por meio de um filtro de 50 | iM. 6) Classificar GFP positivos e negativos GFP protoplastos viáveis. 7) Os protoplastos podem agora ser analisadas visualmente ou através de técnicas tais como qPCR, sequenciação geração seguinte ou microarray. Figura 2. As linhas KC464, KC274 e TP382 utilizados neste estudo. A) seção transversal de uma folha mostrando KC464 expressão GFP na epiderme adaxial. B) derivado de protoplastos KC464 folhas. C) a secção transversal de uma folha de KC274 mostrando a expressão da GFP na vasculatura. D) Os protoplastos derivados de KC274 folhas. E) TP382 folha que mostra a expressão da GFP em células guarda. F) derivado de protoplastos TP382 folhas. G) Exemplo do enriquecimento obtido por FACS de células que expressam GFP de guarda no fundo complexo de células da folha, mostrando GFP contendo protoplastos a partir da elevada população 530/low 580 de protoplastos derivados de TP382 folhas. AF: imagens de microscópio confocal; G: imagem do microscópio de fluorescência. Barras de escala dentro das imagens são de 50 m. <img alt="Figura 3" src="/files/ftp_upload/4214/4214fig3.jpg" /><html> Figura 3. Típicos FACS parcelas de aquisição de pontos de saída dos 580/30 nm (laranja) vs 530/40 nm (verde) filtros de banda (BD Influx seleccionador de células). Os portões de classificação apresentados são os normalmente usados ​​durante a classificação. A) Ponto de trama Col-4 protoplastos derivados de folhas, protoplasted na ausência de inibidores, que mostram uma única população baixa 530/low 580. B) a partir de wt trama Dot Cl-4 protoplastos derivados de folhas, protoplasted na presença de inibidores, indicando uma mudança na fluorescência 580 devido ao stress e coloração pelos inibidores. CE) Dot parcelas de folha protoplastos derivados a partir das linhas KC74, KC464 e TP382, respectivamente, protoplasted na presença de inibidores, mostrando a GFP contendo populações no alto 530/low 580 populações. As porcentagens dos eventos nos (alta 530/low 580) GFP populações são dadas. <a href="http://www.jove.com/files/ftp_upload/4214/4214fig3large.jpg" target="_blank">Clique aqui para ver maior figura</a> . &quot;fo: manter-together.within-page =&quot; e_content sempre &quot;&gt; <img alt="Figura 4" src="/files/ftp_upload/4214/4214fig4.jpg" /> Figura 4. Expressão da GFP nas fracções representativas de populações fechadas, como mostrado na Figura 3. Duas réplicas biológicas foram obtidos para cada tipo de fracção, amplificado utilizando o Sistema Ovation Pico WTA e qPCR GFP utilizando-se os iniciadores específicos (Tabela 2) foi então realizada. Os valores apresentados são os mais elevados (vermelho), o mais baixo (verde) e média de valores relativos. A população foi elevada 580, neste caso, dividido em dois, baixo 530/low 580 e 530/low alto 580, para o qual apenas uma repetição, biológica foi utilizada para que apenas o valor único é apresentado. ACT2 (At3g18780) foi utilizado como um padrão para todas as amostras. Folha: folha inteira. Unsorted: protoplastos não separados. GFP1: 530/low alto 580 e Rest1: 530/low baixo 580, GFP2: 530/high alto 580 e repouso2: 530/high baixo 580, tal como descrito na Figura 3 e da inserção. Os resultados são a verificação of avaliações ópticas da GFP conteúdo celular nas frações classificadas (2G por exemplo, a figura). <a href="http://www.jove.com/files/ftp_upload/4214/4214fig4large.jpg" target="_blank">Clique aqui para ver maior figura</a> . <table border="1"><tbody><tr><td> Amostra </td><td> No. de folhas </td><td> No. de células </td><td> RNA rendimento (Ng) </td><td> RNA rendimento (Amplificado; ng) </td></tr><tr><td> A folha inteira B folha inteira </td><td> 1 1 </td><td> - - </td><td> 8001 10525 </td><td> 4623 *** 4572 *** </td></tr><tr><td> Protoplastos Unsorted A B protoplastos Unsorted </td><td> 5 5 </td><td> - - </td><td> 2433 2625 </td><td> 1152 *** 3321 *** </td></tr><tr><td> A GFP1 A Rest1 </td><td> 15 </td><td> 6039 (0,39% *) 55389 (6.40% *) </td><td> - ** - ** </td><td> 861 489 </td></tr><tr><td> GFP1 B Rest1 B </td><td> 15 </td><td> 10.783 (0,63% *) 57040 (7,49% *) </td><td> - ** - ** </td><td> 537 420 </td></tr><tr><td> GFP2 Repouso2 </td><td> 15 </td><td> 18.337 (1,49% *) 62.405 (73,49% *) </td><td> - ** - ** </td><td> 360 411 </td></tr></tbody></table> Exemplos Tabela 1. Obtidos utilizando FACS e analisadas com qPCR para determinar que fracção continha vivas que expressam GFP-protoplastos. Também estão incluídos nesta tabela é o rendimento em ng de RNA total, antes e depois de amplificação com o Ovation Pico WTA System (NuGen). GFP1 fracções, GFP2, Rest1 e repouso2 são como mostrado na inserção da Figura 4. * A percentagem de células do tipo de célula total de funcionamento é dado entre parêntesis ao lado do número de células na fracção. Esses percentuais não são correlacionadosoutro para cada amostra como o tipo FACS corre para frações &quot;descanso&quot; foram interrompidos mais cedo do que para frações GFP devido ao número muito maior de células de descanso coletados. ** 50 ng usado como entrada para as reacções de amplificação, como por protocolo do fabricante. <table border="1"><tbody><tr><td> Cartilha </td><td> Seqüência </td></tr><tr><td> mGFP5-ER.fw </td><td> GCCTGAGGGATACGTGCAGGAGA </td></tr><tr><td> mGFP5-ER.rv </td><td> TGGCGGGTCTTGAAGTTGGCT </td></tr><tr><td> ACT2.fw </td><td> GCCATCCAAGCTGTTCTCTC </td></tr><tr><td> ACT2.rv </td><td> GCCATCCAAGCTGTTCTCTC </td></tr></tbody></table> Primers Tabela 2. QPCR.

<ol>
	<li>Efroni, I., Eshed, Y., Lifschitz, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphogenesis+of+Simple+and+Compound+Leaves:+A+Critical+Review.">Morphogenesis of Simple and Compound Leaves: A Critical Review.</a> Plant Cell. 22, 1019-1032 (2010).</li><li>Kleber, R., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+and+Quality+Assessment+of+RNA+From+Cell-Specific+Samples+Obtained+by+Laser+Microdissection.">Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection.</a> Methods Mol. Biol. 323, 367-377 (2006).</li><li>Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Gene+Expression+Map+of+the+Arabidopsis+root.">A Gene Expression Map of the Arabidopsis root.</a> Science. 302, 1956-1960 (2003).</li><li>Warnasooriya, S. N., Montgomery, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+Tissue-+and+Organ-specific+Phytochrome+Responses+using+FACS-assisted+Cell-type+Specific+Expression+Profiling+in+Arabidopsis+thaliana.">Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana.</a> J. Vis. Exp. (39), e1925 (2010).</li><li>Beal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Simple+Method+For+Gene+Expression+and+Chromatin+Profiling+of+Individual+Cell+Types+Within+a+Tissue.">A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue.</a> Dev. Cell. 18, 1030-1040 (2010).</li><li>Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Profiling+translatomes+of+discrete+cell+populations+resolves+altered+cellular+priorities+during+hypoxia+in+Arabidopsis.">Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis.</a> PNAS. 106, 18843-18848 (2009).</li><li>Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dominant+Root+Expression+Patterns+Revealed+in+a+High-Resolution+Spatiotemporal+Expression+Map.">Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map.</a> Science. 318, 801-806 (2007).</li><li>Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-specific+nitrogen+responses+mediate+developmental+plasticity.">Cell-specific nitrogen responses mediate developmental plasticity.</a> PNAS. 105, 803-808 (2008).</li><li>Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+identity+mediates+the+response+of+Arabidopsis+roots+to+abiotic+stress.">Cell identity mediates the response of Arabidopsis roots to abiotic stress.</a> Science. 320, 942-945 (2008).</li><li>Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Auxin+Gradient+and+Maximum+in+the+Arabidopsis+Root+Apex+Shown+by+High-Resolution+Cell-Specific+Analysis+of+IAA+Distribution+and+Synthesis.">An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis.</a> Plant Cell. 21, 1659-1668 (2009).</li><li>Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+map+of+the+Arabidopsis+shoot+apical+meristem+stem+cell+niche.">Gene expression map of the Arabidopsis shoot apical meristem stem cell niche.</a> PNAS. 106, 4941-4946 (2009).</li><li>Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+photosynthesis-related+gene+fusions+is+restricted+by+cell+type+in+transgenic+plants+and+in+transfected+protoplasts.">Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts.</a> PNAS. 87, 816-820 (1990).</li><li>Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+a+strong+Arabidopsis+guard+cell+promoter+and+it's+potential+as+a+research+tool.">Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool.</a> Plant Methods. 4, 6 (2008).</li><li>Gardner, M. J., Baker, A. J., Assie, J. -. M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GAL4+GFP+enhancer+trap+lines+for+analysis+of+stomatal+guard+cell+development+and+gene+expression.">GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression.</a> J. Exp. Bot. 60, 213-226 (2009).</li></ol>

Não há conflitos de interesse declarados.

Nós descrevemos um método que permite o uso de plantas de Arabidopsis expressando GFP nas folhas para a produção de protoplastos e subsequente separação de células utilizando FACS. Este método produz uma quantidade suficiente de RNA a serem utilizados para a amplificação e subsequente análise, portanto, por um ou outro ou qPCR microarray. As fracções são classificados altamente enriquecido para GFP contendo células, como demonstrado por qPCR (figura 2). Para obter altos rendimentos de protoplastos vivos é crítico para trabalhar rapidamente durante os passos iniciais do processo, até que as tiras de folha ter sido vácuo infiltrada com a solução de protoplastos contendo inibidor. Em adição, ao gerar um tiras de folha milímetros, é muito importante para cortar ou cortar as folhas em vez de &quot;talhar&quot; ou triture-los, como isso leva a danos excessivos e, assim, um menor rendimento de protoplastos. A diferença fundamental entre o método descrito aqui e outro publisheMétodos d é a utilização de inibidores de RNase e inibidores da transcrição. A maioria dos métodos são desenvolvidos em raízes de Arabidopsis, a partir de protoplastos que podem ser gerados com mais facilidade. No entanto, quando se trabalha com folhas, com excepção mesófilo, é necessário aumentar o tempo de geração de protoplastos. Por isso, é importante incluir estes inibidores para proteger contra as alterações na expressão de genes, como resultado do tratamento de protoplastos geração própria (dados não mostrados). No entanto, a presença de agentes inibidores leva a uma incapacidade para montar uma resposta de transcrição, quer por comutação de genes ligado ou desligado, o que é susceptível de fazer os protoplastos mais vulnerável, pois isso leva a uma perda de plasticidade com que para contrariar as tensões do protoplasting procedimento. Usámos o método aqui descrito com sucesso com um certo número de linhas que expressam GFP-Arabidopsis. Importante, nós têm utilizado este método com linhas GFP expressando GFP ou fortemente emdo núcleo, ou muito mais fraca de uma maneira non-localized/diffuse citosólica, como é o caso com os KC464 KC274 e linhas utilizadas aqui. Ambos os tipos de linhas são compatíveis com o método de produzir e as fracções altamente enriquecidas de GFP-expressando protoplastos (Figura 2 e 3). O método pode ser facilmente adaptado a outras fluoróforos, embora o fluoróforo deve ser seleccionada para a fluorescência, que é significativamente diferente da autofluorescência das células mortas / a morrer, a fim de preservar a capacidade para seleccionar células vivas.

<table border="1"><tbody><tr><td> Nome do reagente </td><td> Companhia </td><td> Número de catálogo </td></tr><tr><td> Celulase R-10 </td><td> Melford </td><td> C8001 </td></tr><tr><td> Celulase RS </td><td> Melford </td><td> C8003 </td></tr><tr><td> Macerozyme R-10 </td><td> Melford </td><td> M8002 </td></tr><tr><td> BSA </td><td> Sigma-Aldrich </td><td> A3912 </td></tr><tr><td> ProtectRNA </td><td> Sigma-Aldrich </td><td> R7397 </td></tr><tr><td> Actinomicina D </td><td> Sigma-Aldrich </td><td> A1410 </td></tr><tr><td> 70 filtro de células mM </td><td> Pescador </td><td> FB35181 </td></tr><tr><td> 50 um copo do tipo filcon filtros </td><td> BD Biosciences </td><td> 340630 </td></tr></tbody></table>

cell specific analysis of arabidopsis leaves using fluorescence activated cell sorting

Após o início do primórdio foliar, acúmulo de biomassa é controlado principalmente pela proliferação celular e expansão das folhas 1. No entanto, a folha de Arabidopsis é um órgão complexo composto de muitos tipos diferentes de células e estruturas diversas. Ao mesmo tempo, a folha de crescimento contém células em diferentes fases de desenvolvimento, com as células mais afastadas do pecíolo sendo o primeiro a parar de se expandir e passar por um senescência. Células diferentes dentro da folha são, portanto, dividindo, alongando ou diferenciação; ativo, estressado ou morto, e / ou responder a estímulos em sub-conjuntos de seu tipo de celular a qualquer momento. Isso faz estudo genômico da folha desafiador: por exemplo, quando da análise de dados de expressão de folhas inteiras, os sinais de redes genéticas que operam em diferentes zonas de resposta celular ou tipos de células serão confundidos, resultando em um perfil imprecisa sendo gerado. Para resolver isso, sárias métodos foram descritos, que permitem estudos de expressão de genes específicos de células. Estes incluem a laser de captura de microdissecção (LCM) 2 ou plantas que expressam GFP utilizados para a geração e selecção de protoplasto de células activadas por fluorescência subsequente (FACS) 3,4, o sistema descrito recentemente para a precipitação nuclear INTACT 5 e imunoprecipitação de polissomas 6. FACS tem sido usado com sucesso para um certo número de estudos, incluindo o que mostra que a identidade da célula e a distância a partir da ponta da raiz teve um efeito significativo sobre os perfis de expressão de um grande número de genes de 3,7. FACS de linhas de GFP também têm sido utilizados para demonstrar a célula-regulação transcricional específica durante as respostas de raiz de azoto e de desenvolvimento de raízes laterais 8, 9 da distribuição de sal estresse auxina na raiz 10 e para criar um mapa de expressão do gene do meristema apical Arabidopsis 11. EmboraFACS tenha sido previamente utilizado para classificar protoplastos de folha de Arabidopsis derivados baseados em autofluorescência 12,13, até agora o uso de FACS das linhas de Arabidopsis expressando GFP nas folhas tem sido muito limitado 4. No protocolo seguinte descreve-se um método para a obtenção de protoplastos de folha de Arabidopsis que são compatíveis com FACS e minimizar o impacto do regime de produção de protoplastos. Demonstramos o método de utilizar a linha de Arabidopsis KC464, que expressam GFP na epiderme adaxial 14, a linha de KC274, que expressam GFP no tecido vascular 14 e a linha de Arabidopsis TP382, que expressam GFP um duplo construto ligado a um sinal de localização nuclear, em as células guarda (dados não mostrados), Figura 2. Estamos actualmente a utilização deste método para estudar tanto a expressão específica do tipo de células durante o desenvolvimento e o stress, bem como as populações de células heterogéneas em várias fases da senescência.

Watch this Scientific Journal Video about Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting at JoVE.com

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

Um método para produzir<em&gt; Arabidopsis</em&gt; Protoplastos de folha que são compatíveis com a classificação de células activadas por fluorescência (FACS), permitindo estudos de populações de células específicas. Este método é compatível com qualquer<em&gt; Arabidopsis</em&gt; Linha que expressa GFP em um subconjunto de células.

Análise de célula específico<em&gt; Arabidopsis</em&gt; Folhas utilizando ordenação células activadas por fluorescência

After initiation of the leaf primordium, biomass accumulation is controlled mainly by cell proliferation and expansion in the leaves1. However, the ...

cell-specific-analysis-arabidopsis-leaves-using-fluorescence

Research

JoVE Journal

Biology

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

15.1K visualizações.  University of Warwick. Um método para produzir Arabidopsis Protoplastos de folha que são compatíveis com a classificação de células activadas por fluorescência (FACS), permitindo estudos de populações de células específicas. Este método é compatível com qualquer Arabidopsis Linha que expressa GFP em um subconjunto de células.

Vídeo: Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

Separação de células de fluorescência Activated de Protoplastos Usina

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

Biologia

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called photoreceptors to sense and adapt to light. The red/far-red light-absorbing phytochrome photoreceptors have been studied extensively. Phytochromes exist as a family of proteins with distinct and overlapping functions in all higher plant systems in which they have been studied1. Phytochrome-mediated light responses, which range from seed germination through flowering and senescence, are often localized to specific plant tissues or organs2. Despite the discovery and elucidation of individual and redundant phytochrome functions through mutational analyses, conclusive reports on distinct sites of photoperception and the molecular mechanisms of localized pools of phytochromes that mediate spatial-specific phytochrome responses are limited. We designed experiments based on the hypotheses that specific sites of phytochrome photoperception regulate tissue- and organ-specific aspects of photomorphogenesis, and that localized phytochrome pools engage distinct subsets of downstream target genes in cell-to-cell signaling. We developed a biochemical approach to selectively reduce functional phytochromes in an organ- or tissue-specific manner within transgenic plants. Our studies are based on a bipartite enhancer-trap approach that results in transactivation of the expression of a gene under control of the Upstream Activation Sequence (UAS) element by the transcriptional activator GAL43. The biliverdin reductase (BVR) gene under the control of the UAS is silently maintained in the absence of GAL4 transactivation in the UAS-BVR parent4. Genetic crosses between a UAS-BVR transgenic line and a GAL4-GFP enhancer trap line result in specific expression of the BVR gene in cells marked by GFP expression4. BVR accumulation in Arabidopsis plants results in phytochrome chromophore deficiency in planta5-7. Thus, transgenic plants that we have produced exhibit GAL4-dependent activation of the BVR gene, resulting in the biochemical inactivation of phytochrome, as well as GAL4-dependent GFP expression. Photobiological and molecular genetic analyses of BVR transgenic lines are yielding insight into tissue- and organ-specific phytochrome-mediated responses that have been associated with corresponding sites of photoperception4, 7, 8. Fluorescence Activated Cell Sorting (FACS) of GFP-positive, enhancer-trap-induced BVR-expressing plant protoplasts coupled with cell-type-specific gene expression profiling through microarray analysis is being used to identify putative downstream target genes involved in mediating spatial-specific phytochrome responses. This research is expanding our understanding of sites of light perception, the mechanisms through which various tissues or organs cooperate in light-regulated plant growth and development, and advancing the molecular dissection of complex phytochrome-mediated cell-to-cell signaling cascades.

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

The molecular basis of spatial-specific phytochrome responses is being investigated using transgenic plants that exhibit tissue- and organ-specific phytochrome deficiencies. The isolation of specific cells exhibiting induced phytochrome chromophore depletion by Fluorescence-Activated Cell Sorting followed by microarray analyses is being utilized to identify genes involved in spatial-specific phytochrome responses.

Investigando Tecido e órgãos específicos Responses Fitocromo usando FACS assistida Célula tipo Profiling expressão específica no Arabidopsis thaliana</em

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called ...

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting (LIMACS): a Novel Method to Analyze Protein-lipid Interaction

The analysis of lipid protein interaction is difficult because lipids are embedded in cell membranes and therefore, inaccessible to most purification procedures. As an alternative, lipids can be coated on flat surfaces as used for lipid ELISA and Plasmon resonance spectroscopy. However, surface coating lipids do not form microdomain structures, which may be important for the lipid binding properties. Further, these methods do not allow for the purification of larger amounts of proteins binding to their target lipids.
 To overcome these limitations of testing lipid protein interaction and to purify lipid binding proteins we developed a novel method termed lipid vesicle-mediated affinity chromatography using magnetic-activated cell sorting (LIMACS). In this method, lipid vesicles are prepared with the target lipid and phosphatidylserine as the anchor lipid for Annexin V MACS. Phosphatidylserine is a ubiquitous cell membrane phospholipid that shows high affinity to the protein Annexin V. Using magnetic beads conjugated to Annexin V the phosphatidylserine-containing lipid vesicles will bind to the magnetic beads. When the lipid vesicles are incubated with a cell lysate the protein binding to the target lipid will also be bound to the beads and can be co-purified using MACS. This method can also be used to test if recombinant proteins reconstitute a protein complex binding to the target lipid. 
 We have used this method to show the interaction of atypical PKC (aPKC) with the sphingolipid ceramide and to co-purify prostate apoptosis response 4 (PAR-4), a protein binding to ceramide-associated aPKC. We have also used this method for the reconstitution of a ceramide-associated complex of recombinant aPKC with the cell polarity-related proteins Par6 and Cdc42. Since lipid vesicles can be prepared with a variety of sphingo- or phospholipids, LIMACS offers a versatile test for lipid-protein interaction in a lipid environment that resembles closely that of the cell membrane. Additional lipid protein complexes can be identified using proteomics analysis of lipid binding protein co-purified with the lipid vesicles.

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting LIMACS: a Novel Method to Analyze Protein-lipid Interaction

To test the interaction of a protein with its target lipid we used MACS and Annexin V-conjugated magnetic beads and lipid vesicles synthesized from the target lipid and Annexin V-binding phosphatidylserine. Proteins bound to the target lipid are co-purified and analyzed after elution from the beads.

Cromatografia de afinidade lipídica mediada por vesículas com separação de células Magnetic Ativado (LIMACS): um novo método para analisar proteínas lipídios Interação

The analysis of lipid protein interaction is difficult because lipids are embedded in cell membranes and therefore, inaccessible to most purification ...

Bromodeoxyuridine (BrdU) Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification of bacterial taxa that transform specific pools of DOC in nature poses a technical challenge. 
Here we describe an approach that couples bromodeoxyuridine (BrdU) incorporation, fluorescence activated cell sorting (FACS), and 16S rRNA gene-based molecular analysis that allows culture-independent identification of bacterioplankton capable of degrading a specific DOC compound in aquatic environments. Triplicate bacterioplankton microcosms are set up to receive both BrdU and a model DOC compound (DOC amendments), or only BrdU (no-addition control). BrdU substitutes the positions of thymidine in newly synthesized bacterial DNA and BrdU-labeled DNA can be readily immunodetected 1,2. Through a 24-hr incubation, bacterioplankton that are able to use the added DOC compound are expected to be selectively activated, and therefore have higher levels of BrdU incorporation (HI cells) than non-responsive cells in the DOC amendments and cells in no-addition controls (low BrdU incorporation cells, LI cells). After fluorescence immunodetection, HI cells are distinguished and physically separated from the LI cells by fluorescence activated cell sorting (FACS) 3. Sorted DOC-responsive cells (HI cells) are extracted for DNA and taxonomically identified through subsequent 16S rRNA gene-based analyses including PCR, clone library construction and sequencing.

Bromodeoxyuridine BrdU Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Environmental bacterioplankton are incubated with a model dissolved organic carbon (DOC) compound and a DNA labeling reagent, bromodeoxyuridine (BrdU). Afterward, DOC-degrading cells are separated from the bulk community based on their elevated BrdU incorporation using fluorescence activated cell sorting (FACS). These cells are then identified by subsequent molecular analyses.

Bromodeoxiuridina Labeling (BrdU) e separação de células subseqüentes Fluorescence Activated de Cultura independente de Identificação de carbono orgânico dissolvido de degradação bacterioplâncton

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification ...

Optimized Staining and Proliferation Modeling Methods for Cell Division Monitoring using Cell Tracking Dyes

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of different cell types in vitro and in vivo.1-5 Although there are literally thousands of publications using such dyes, some of the most commonly encountered cell tracking applications include monitoring of:
<ol>
	<li>stem and progenitor cell quiescence, proliferation and/or differentiation6-8</li>
	<li>antigen-driven membrane transfer9 and/or precursor cell proliferation3,4,10-18 and</li>
	<li>immune regulatory and effector cell function1,18-21.</li>
</ol>
Commercially available cell tracking dyes vary widely in their chemistries and fluorescence properties but the great majority fall into one of two classes based on their mechanism of cell labeling. "Membrane dyes", typified by PKH26, are highly lipophilic dyes that partition stably but non-covalently into cell membranes1,2,11. "Protein dyes", typified by CFSE, are amino-reactive dyes that form stable covalent bonds with cell proteins4,16,18. Each class has its own advantages and limitations. The key to their successful use, particularly in multicolor studies where multiple dyes are used to track different cell types, is therefore to understand the critical issues enabling optimal use of each class2-4,16,18,24.
The protocols included here highlight three common causes of poor or variable results when using cell-tracking dyes. These are:
<ol>
	<li>Failure to achieve bright, uniform, reproducible labeling. This is a necessary starting point for any cell tracking study but requires attention to different variables when using membrane dyes than when using protein dyes or equilibrium binding reagents such as antibodies.</li>
	<li>Suboptimal fluorochrome combinations and/or failure to include critical compensation controls. Tracking dye fluorescence is typically 102 - 103 times brighter than antibody fluorescence. It is therefore essential to verify that the presence of tracking dye does not compromise the ability to detect other probes being used.</li>
	<li>Failure to obtain a good fit with peak modeling software. Such software allows quantitative comparison of proliferative responses across different populations or stimuli based on precursor frequency or other metrics. Obtaining a good fit, however, requires exclusion of dead/dying cells that can distort dye dilution profiles and matching of the assumptions underlying the model with characteristics of the observed dye dilution profile.</li>
</ol>
Examples given here illustrate how these variables can affect results when using membrane and/or protein dyes to monitor cell proliferation.

Successful use of cell tracking dyes to monitor immune cell function and proliferation involves several critical steps. We describe methods for: 1) obtaining bright, uniform, reproducible label-ing with membrane dyes; 2) selecting fluorochromes and data acquisition conditions; and 3) choosing a model to quantify cell proliferation based on dye dilution.

Optimizado coloração e Proliferação Métodos de Modelagem para Monitoramento Divisão Celular usando Corantes Rastreamento celulares

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of ...

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting (FACS)

Cancer-associated fibroblasts (CAFs) are the most prominent cell type within the tumor stroma of many cancers, in particular breast carcinoma, and their prominent presence is often associated with poor prognosis1,2. CAFs are an activated subpopulation of stromal fibroblasts, many of which express the myofibroblast marker &alpha;-SMA3. CAFs originate from local tissue fibroblasts as well as from bone marrow-derived cells recruited into the developing tumor and adopt a CAF phenotype under the influence of the tumor microenvironment4. CAFs were shown to facilitate tumor initiation, growth and progression through signaling that promotes tumor cell proliferation, angiogenesis, and invasion5-8. We demonstrated that CAFs enhance tumor growth by mediating tumor-promoting inflammation, starting at the earliest pre-neoplastic stages9. Despite increasing evidence of the key role CAFs play in facilitating tumor growth, studying CAFs has been an on-going challenge due to the lack of CAF-specific markers and the vast heterogeneity of these cells, with many subtypes co-existing in the tumor microenvironment10. Moreover, studying fibroblasts in vitro is hindered by the fact that their gene expression profile is often altered in tissue culture11,12 . To address this problem and to allow unbiased gene expression profiling of fibroblasts from fresh mouse and human tissues, we developed a method based on previous protocols for Fluorescence-Activated Cell Sorting (FACS)13,14. Our approach relies on utilizing PDGFR&alpha; as a surface marker to isolate fibroblasts from fresh mouse and human tissue. PDGFR&alpha; is abundantly expressed by both normal fibroblasts and CAFs9,15 . This method allows isolation of pure populations of normal fibroblasts and CAFs, including, but not restricted to &alpha;-SMA+ activated myofibroblasts. Isolated fibroblasts can then be used for characterization and comparison of the evolution of gene expression that occurs in CAFs during tumorigenesis. Indeed, we and others reported expression profiling of fibroblasts isolated by cell sorting16. This protocol was successfully performed to isolate and profile highly enriched populations of fibroblasts from skin, mammary, pancreas and lung tissues. Moreover, our method also allows culturing of sorted cells, in order to perform functional experiments and to avoid contamination by tumor cells, which is often a big obstacle when trying to culture CAFs.

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting FACS

Cancer Associated Fibroblasts (CAFs) facilitate tumor initiation, growth and progression through signaling that promotes proliferation, angiogenesis, and inflammation. Here we describe a method to isolate pure populations of normal fibroblasts and CAFs from fresh mouse and human tissues by cell sorting, using PDGFR&#x03B1; as a surface marker.

Isolamento de fibroblastos normais e associados ao câncer de tecidos frescos, classificando células activadas por fluorescência (FACS)

Cancer-associated fibroblasts (CAFs) are the most prominent cell type within the tumor stroma of many cancers, in particular breast carcinoma, and their ...

Single Cell Micro-aspiration as an Alternative Strategy to Fluorescence-activated Cell Sorting for Giant Virus Mixture Separation

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or fluorescence activated cell sorting (FACS) applied to the viral population. However, when the viruses in the mixture have similar morphologic properties and one of the viruses multiplies slowly, the presence of two viruses is discovered at the stage of genome assembly and the viruses cannot be separated for further characterization. To solve this problem, we developed a single cell micro-aspiration procedure that allows for separation and cloning of highly similar viruses. In the present work, we present how this alternative strategy allowed us to separate the small viral subpopulations of Clandestinovirus ST1 and Usurpativirus LCD7, giant viruses that grow slowly and do not lead to amoebal lysis compared to the lytic and fast-growing Faustovirus. Purity control was assessed by specific gene amplification and viruses were produced for further characterization.

Here, we describe a single cell micro-aspiration method for the separation of infected amoebae. In order to separate viral subpopulations in Vermamoeba vermiformis infected by Faustoviruses and unknown giant viruses, we developed the protocol detailed below and demonstrated its ability to separate two low-abundance novel giant viruses.

Micro-aspiração de célula única como uma estratégia alternativa à classificação celular ativada por fluorescência para separação de mistura de vírus gigante

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or ...

Fluorescence-Activated Cell Sorting for the Isolation of Scleractinian Cell Populations

Coral reefs are under threat due to anthropogenic stressors. The biological response of coral to these stressors may occur at a cellular level, but the mechanisms are not well understood. To investigate coral response to stressors, we need tools for analyzing cellular responses. In particular, we need tools that facilitate the application of functional assays to better understand how cell populations are reacting to stress. In the current study, we use fluorescence-activated cell sorting (FACS) to isolate and separate different cell populations in stony corals. This protocol includes: (1) the separation of coral tissues from the skeleton, (2) creation of a single cell suspension, (3) labeling the coral cells using various markers for flow cytometry, and (4) gating and cell sorting strategies. This method will enable researchers to work on corals at the cellular level for analysis, functional assays, and gene expression studies of different cell populations.

Corals create biodiverse ecosystems important for both humans and marine organisms. However, we still do not understand the full potential and function of many coral cells. Here, we present a protocol developed for the isolation, labeling, and separation of stony coral cell populations.

Classificação celular ativada pela fluorescência para o isolamento de populações celulares escleracianas

Coral reefs are under threat due to anthropogenic stressors. The biological response of coral to these stressors may occur at a cellular level, but the ...

Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids potential pitfalls caused by the heterogeneity of tissues and unleashes the powerful transcriptome analysis. The protocol described here demonstrates how to use the Translating Ribosome Affinity Purification (TRAP) method to isolate ribosome-bound RNAs from a small amount of EGFP-expressing cells in a complex tissue without cell sorting. This protocol is suitable for isolating cell-type-specific RNAs using the recently available NuTRAP mouse model and could also be used to isolate RNAs from any EGFP-expressing cells.

This protocol aims to isolate cell-type-specific translating ribosomal mRNAs using the NuTRAP mouse model.

Isole RNAs específicos do tipo celular de amostras de tecido heterogêneo congeladas sem triagem celular

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids ...

Fluorescence Lifetime Macro Imager for Biomedical Applications

This paper presents a new photoluminescence lifetime imager designed to map the molecular oxygen (O2) concentration in different phosphorescent samples ranging from solid-state, O2-sensitive coatings to live animal tissue samples stained with soluble O2-sensitive probes. In particular, the nanoparticle-based near-infrared probe NanO2-IR, which is excitable with a 625 nm light-emitting diode (LED) and emits at 760 nm, was used. The imaging system is based on the Timepix3 camera (Tpx3Cam) and the opto-mechanical adaptor, which also houses an image intensifier. O2 phosphorescence lifetime imaging microscopy (PLIM) is commonly required for various studies, but current platforms have limitations in their accuracy, general flexibility, and usability.
The system presented here is a fast and highly sensitive imager, which is built on an integrated optical sensor and readout chip module, Tpx3Cam. It is shown to produce high-intensity phosphorescence signals and stable lifetime values from surface-stained intestinal tissue samples or intraluminally stained fragments of the large intestine and allows the detailed mapping of tissue O2 levels in about 20 s or less. Initial experiments on the imaging of hypoxia in grafted tumors in unconscious animals are also presented. We also describe how the imager can be re-configured for use with O2-sensitive materials based on Pt-porphyrin dyes using a 390 nm LED for the excitation and a bandpass 650 nm filter for emission. Overall, the PLIM imager was found to produce accurate quantitative measurements of lifetime values for the probes used and respective two-dimensional maps of the O2 concentration. It is also useful for the metabolic imaging of ex vivo tissue models and live animals.

This paper describes the use of a new, fast optical imager for the macroscopic photoluminescence lifetime imaging of long decay emitting samples. The integration, image acquisition, and analysis procedures are described, along with the preparation and characterization of the sensor materials for the imaging and the application of the imager in studying biological samples.

Fluorescence Lifetime Macro Imager para aplicações biomédicas

This paper presents a new photoluminescence lifetime imager designed to map the molecular oxygen (O2) concentration in different phosphorescent samples ...