De tipo selvagem (Mavs + / +) e knockout (Mavs - / -) ratinhos, do tipo selvagem (Mavs + / +) e knockout (Mavs - / -) MEFs foram gentilmente cedidos pelo Dr. J. Chen Zhijian (University of Texas Southwestern Medical Center) 13. Esta publicação é baseado no trabalho financiado por subvenções do NIH (R01 CA134241 e R01 DE021445) e American Cancer Society (RSG-11-162-01-MPC).

Declaração de Ética: Todo o trabalho animal foi realizada sob estrita conformidade com as recomendações do Guia para o Cuidado e Uso de Animais de Laboratório do National Institutes of Health. O protocolo foi aprovado pelo Animal Care e Use Comitê Institucional (IACUC) da Universidade do Sul da Califórnia. 1. Cytokine Gene Expression quantitativa por PCR em tempo real e da secreção por ELISA em ratinhos infectados γHV68 <ol><li> Anestesiar, 6-8 semanas de idade C57BL / 6 (B6) ninhada pareados por sexo (8-12 ratos / grupo) via intraperitoneal injetar 1,5 mg de ketamine/0.12 mg de xilazina e inocular por via intranasal com 40 UFP de γHV68 em 40 mL (infecção detalhado na Dong Feng e 11). Em diferentes pontos de tempo após a infecção, os ratos eutanásia por inalação de CO 2 usando seguido por deslocação cervical. </li><li> Abra o peito com um corte lateral esquerdo ao longo do sternum e cortar as costelas com uma tesoura afiada. Recolha os tecidos pulmonares. </li><li> Recolha de metade do tecido pulmonar (lobo esquerdo) em tubos de 1,5 ml com tampa de rosca estéreis, contendo 500 ul 1,0 milímetros grânulos zircônia / sílica. Adicionar 1 ml de DMEM isento de soro a frio para dentro do tubo e homogeneizar o tecido pulmonar através do grânulo-batida durante 30 segundos. Descontraia tubos no gelo por 2 min e repetir este processo uma vez. </li><li> Centrifugar os tubos (15.000 x g durante 10 min) a 4 ° C, recolhe-se o sobrenadante e medem a produção de citocinas, tal como descrito abaixo. </li><li> Medir citoquinas utilizando estojos de ELISA de citoquinas disponíveis comercialmente de acordo com as instruções do fabricante. </li><li> Recolha a outra metade do tecido pulmonar (lobo direito) para outro tubo contendo talão e adicionar 1 ml de Trizol. Homogeneizar e recolher o sobrenadante como descrito no passo 1.3 e de ARN extracto de acordo com instrução do fabricante. Determinar a concentração de ARN por fazer as leituras de absorvância a 260 e 280 nm. </li&gt; <li> Prepare cDNA com 1 ug de ARN total e a transcriptase inversa de acordo com as instruções do fabricante (o volume total final foi de 20 ul). Diluir cDNA 50 vezes com DNAse e água livre de RNase e realizar quantitativa PCR em tempo real. </li><li> Execute o programa em uma máquina quantitativa PCR em tempo real. Cada reacção contém 0,5 uL de um par de iniciadores específicos para o gene ou os iniciadores de controlo de GAPDH (a concentração de trabalho dos iniciadores foram 10 uM, CE 500 nM para cada iniciador), 5 ul da mistura principal SYBR e 4 ul do diluída cDNA. Calcular ΔΔCt para determinar a quantidade relativa de transcritos de mRNA de citocinas anti-virais. </li></ol> 2. Infecção celular MEF e de citocinas quantificação por ELISA e qRT-PCR <ol><li> Crescer Mavs + / + e Mavs - / - células MEF para sub-confluentes (aproximadamente 80%) Densidade antes do plaqueamento das células. </li><li> Dividir células MEF em 12 nósplacas de ll a 100.000 células / poço (a densidade de células será de cerca de 70% no segundo dia). Realizar infecção γHV68 em triplicado, com uma multiplicidade de infecção (MOI) de 5-10 para sincronizar e maximizar a indução de citoquinas. </li><li> Prepare γHV68 suspensão em meio DMEM completo contendo a quantidade apropriada de vírus (1 ml para cada poço). </li><li> Remover o meio e adicionar γHV68 contendo suspensão de células MEF. </li><li> Colocar a placa na incubadora de cultura de tecidos, balançar a cada 30 min, e permitir um total de 2 horas de incubação. </li><li> Remover meio contendo γHV68, lave uma vez com PBS, e substituir por completo DMEM fresco. </li><li> Em vários pontos de tempo após a infecção, médio safra em 1,5 ml tubos Eppendorf. Lave as células com PBS frio e recolher as células infectadas por digestão com tripsina. </li><li> Medir citocinas antivirais em meio, tal como descrito na etapa 1.5. </li><li> Extrair ARN, preparar ADNc e executar qRT-PCR para determinar a expressão de genes de citoquinas antiviralcomo descrito nas etapas 1,5-1,7. </li></ol> 3. Produção Lentivirus, infecção e Geração de linhas celulares estáveis <ol><li> Dividir células 293T um dia antes da transfecção e permitir que as células atingissem a 40% de confluência no momento da transfecção. </li><li> Transfecção de 10 centímetros prato de células 293T com os plasmídeos de embalagem (1,2 mg de pVSV-G e 6 mg de pDR8.9) e 7,2 mg de pCDH-flag-MAVS ou controle pCDH por precipitação de fosfato de cálcio. </li><li> Substituir médio em 6 a 8 horas após a transfecção com DMEM completo fresco. </li><li> Em 72 horas após a transfecção, recolher o meio contendo lentivírus, centrifugar a 4000 xg durante 15 min, e com o filtro de membrana de 0,22 um. Para aumentar o título de lentivírus, que centrifugar o meio contendo o vírus a 110.000 x g durante 2,5 horas a 4 ° C. Ressuspender cuidadosamente o pellet viral em pequeno volume de meio de interesse. </li><li> Mavs semente - / - células MEF ou a outras células nocaute MEF um dia before infecção em placas de 6 poços a 30-40% de confluência. </li><li> Infectar as células MEF com lentivírus 1 ml e 2 ml de DMEM completo fresco, suplementado com polibreno a uma concentração final de 10 ug / ml. </li><li> Centrifugar a placa a 500 xg a 30 ° C durante 30 minutos e transferir a placa para um incubador de cultura de tecido. </li><li> Substituir meio às 6 horas pós-infecção com DMEM completo fresco. </li><li> Dividir células MEF em 24 horas pós-infecção e adicionar puromicina a uma concentração final de 1 ug / ml em 48 horas pós-infecção para seleccionar células que expressam estavelmente MAVS. </li><li> Manter as células MEF em meio contendo puromicina e verificar a expressão de proteínas por immunoblotting com anticorpos correspondentes. </li><li> As células podem ser utilizadas para a infecção virai, a expressão de genes de citoquinas e ensaios de secreção, tal como descrito no protocolo 2. </li></ol>

<ol>
	<li>Akira, S., Uematsu, S., Takeuchi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen+recognition+and+innate+immunity.">Pathogen recognition and innate immunity.</a> Cell. 124, 783-801 (2006).</li><li>Kato, H., Takahasi, K., Fujita, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIG-I-like+receptors:+cytoplasmic+sensors+for+non-self+RNA.">RIG-I-like receptors: cytoplasmic sensors for non-self RNA.</a> Immunol. Rev. 243, 91-98 (2011).</li><li>Kawai, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IPS-1,+an+adaptor+triggering+RIG-I-+and+Mda5-mediated+type+I+interferon+induction.">IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction.</a> Nat. Immunol. 6, 981-988 (2005).</li><li>Seth, R. B., Sun, L., Ea, C. K., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+MAVS,+a+mitochondrial+antiviral+signaling+protein+that+activates+NF-kappaB+and+IRF+3.">Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3.</a> Cell. 122, 669-682 (2005).</li><li>Xu, L. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VISA+is+an+adapter+protein+required+for+virus-triggered+IFN-beta+signaling.">VISA is an adapter protein required for virus-triggered IFN-beta signaling.</a> Mol. Cell. 19, 727-740 (2005).</li><li>Meylan, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardif+is+an+adaptor+protein+in+the+RIG-I+antiviral+pathway+and+is+targeted+by+hepatitis+C+virus.">Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus.</a> Nature. 437, 1167-1172 (2005).</li><li>Speck, S. H., Virgin, H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host+and+viral+genetics+of+chronic+infection:+a+mouse+model+of+gamma-herpesvirus+pathogenesis.">Host and viral genetics of chronic infection: a mouse model of gamma-herpesvirus pathogenesis.</a> Curr. Opin. Microbiol. 2, 403-409 (1999).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma-herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+initiate+lytic+replication.">Murine gamma-herpesvirus 68 hijacks MAVS and IKKbeta to initiate lytic replication.</a> PLoS Pathog. , (2010).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma+herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+abrogate+NFkappaB+activation+and+antiviral+cytokine+production.">Murine gamma herpesvirus 68 hijacks MAVS and IKKbeta to abrogate NFkappaB activation and antiviral cytokine production.</a> PLoS Pathog. 7, (2011).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gammaherpesvirus+68+evades+host+cytokine+production+via+replication+transactivator-induced+RelA+degradation.">Murine gammaherpesvirus 68 evades host cytokine production via replication transactivator-induced RelA degradation.</a> J. Virol. 86, 1930-1941 (2012).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+Host-virus+Interaction+in+Lytic+Replication+of+a+Model+Herpesvirus.">Dissecting Host-virus Interaction in Lytic Replication of a Model Herpesvirus.</a> J. Vis. Exp. , (2011).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor+interacting+protein+kinase-3+determines+cellular+necrotic+response+to+TNF-alpha.">Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha.</a> Cell. 137, 1100-1111 (2009).</li><li>Sun, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+specific+and+essential+role+of+MAVS+in+antiviral+innate+immune+responses.">The specific and essential role of MAVS in antiviral innate immune responses.</a> Immunity. 24, 633-642 (2006).</li></ol>

Os autores declaram não haver conflitos de interesse.

Evasão imune Viral é uma das interações mais dinâmicas e fascinantes interface ofensa viral e de defesa do hospedeiro 9. O anfitrião componentes da imunidade inata são estruturados de tal forma que a transdução de sinal é efetivamente iniciado e transmitido fielmente. Delineando a hierarquia e regulação da cascata de sinalização é um tema de destaque da imunidade inata. Aqui, apresentamos um protocolo para identificar as funções de regulação de um componente imunológico inato, MAVS, na eva...

Estudos recentes têm descrito as cascatas de sinalização em geral montagem de acolhimento respostas imune inata. Residindo dentro de compartimentos distintos, os receptores de reconhecimento de padrões (PRRs) detectar padrões moleculares associados a patógenos (PAMPs) de origem diversa para acionar imune inato sinalização 1. O gene induzida por ácido retinóico I (RIG-I) e antigénio de diferenciação melanoma 5 proteínas (MDA5) são sensores citosólicas que reconhecem espécies de ARN com características estruturais específicas 2. Após a ativação, RIG-I interage com seus MAVS jusante (também conhecido como IPS-1, VISA, e CARDIF) adaptador que, por sua vez, ativa a IKK (IKKαβγ) e relacionadas à IKK quinase (TBK1 e IKKε, também conhecido como Ikki ) complexos 3-6. Quinases imune inata ativadas fosforilam reguladores chave de expressão de genes, incluindo fatores de transcrição e inibidores dos mesmos, e permitir a ativação da transcrição de genes virais de acolhimento (por exemplo, IL6, TNF &amp; #945;, CCL5 e IFNp). Estas cascatas de sinalização constituem respostas inatas intrínsecas potentes imunes que estabelecem um estado anti-microbial para restringir a propagação de patógenos durante os estágios iniciais da infecção. Murino γHV68 está intimamente relacionado com oncogênico SKHV humana e EBV. Assim, a infecção de ratinhos γHV68 fornece um modelo animal pequeno tratável para examinar a resposta imune do hospedeiro à infecção por vírus de herpes gama in vivo 7. Usando γHV68, nosso laboratório revelou uma estratégia complexa pela qual γHV68 seqüestra sediar sinalização imune inato para permitir a infecção viral. Por um lado, γHV68 ativa a via MAVS-IKKβ para promover a ativação da transcrição viral via dirigir IKKβ activado para fosforilar transactivadora replicação (RTA), o fator de transcrição chave viral para γHV68 replicação 8. Por outro lado, a fosforilação IKKβ mediada primos RelA para degradação e termoinates ativação NFkB 9. Como tal, a infecção γHV68 evita eficazmente a produção de citocinas anti-viral. Curiosamente, uma pesquisa utilizando uma biblioteca de γHV68 expressão identificada RTA como uma ligase E3 para induzir a degradação RelA e revogará ativação NFkB 10. Estes resultados descobrir uma estratégia de evasão imune complexa em que os eventos de sinalização imunes a montante são aproveitadas por γHV68 para negar o final da produção de citocinas anti-viral. Aqui nós descrevemos um protocolo para medir a produção de citocinas antiviral em camundongos infectados com γHV68 in vivo e ex viv o. No protocolo que explorar ainda mais a expressão &quot;reconstituído&quot; dos componentes da imunidade inata nos knockout fibroblastos embrionários de transdução lentiviral, que identifica a função das moléculas imunitárias inatas específicos na regulação da produção de citocinas anti-viral. Este protocolo pode ser facilmente adaptada para outras viruses e vias de sinalização.

<table border="0" cellpadding="0" cellspacing="0" width="684">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">Mouse CCL5 ELISA kit</td>
			<td style="width:211px;">R&#38;D systems</td>
			<td style="width:223px;"><a href="http://www.rndsystems.com/Products/DY478">DY478</a></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">1.0 mm Zirconia/Silica beads</td>
			<td style="width:211px;">BioSpec Products</td>
			<td style="width:223px;">11079110z</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">TRIzol</td>
			<td style="width:211px;">Invitrogen</td>
			<td style="width:223px;"><a href="http://products.invitrogen.com/ivgn/en/US/adirect/invitrogen?cmd=catProductDetail&amp;productID=15596018">15596-018</a></td>
		</tr>
		<tr height="79">
			<td height="98" rowspan="2" style="height:98px;width:251px;">SuperScript II Reverse Transcriptase</td>
			<td rowspan="2" style="width:211px;">Invitrogen</td>
			<td rowspan="2" style="width:223px;">18064-014</td>
		</tr>
		<tr height="19">
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">CCL5 quantitative real-time PCR primers</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">CCTGCTGCTTTGCCTACCTCTC</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">ACACACTTGGCGGTTCCTTCGA</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

dissecting innate immune signaling in viral evasion of cytokine production

Em resposta a uma infecção virai, a resposta imune inata hospedeiro é activado para sobre-regular a expressão do gene e a produção de citocinas anti-virais. Por outro lado, os vírus evoluíram estratégias complexas para iludir e explorar anfitrião sinalização imune para a sobrevivência e propagação. Evasão imune viral, o que implica a defesa do hospedeiro e evasão viral, fornece uma das interfaces mais fascinantes e dinâmicas para discernir a interação hospedeiro-vírus. Estes estudos avançar nossa compreensão na regulação imune inata e pavimentar o caminho para desenvolver novas terapias antivirais. Murino γHV68 é um agente patogénico natural de roedores murino. γHV68 infecção de camundongos fornece um modelo animal pequeno tratável para examinar a resposta antiviral para SKHV humana e EBV dos quais perturbação da in vivo interações vírus-hospedeiro não é aplicável. Aqui nós descrevemos um protocolo para determinar a produção de citocinas anti-viral. Este protocolo pode ser adaptado para outros virusa e vias de sinalização. Recentemente, descobrimos que γHV68 seqüestra MAVS e IKKβ, principais componentes inatos sinalização imunes a jusante da cytosolic RIG-I e MDA5, revogar ativação NFkB e produção de citocinas anti-viral. Especificamente, a infecção activa γHV68 IKKβ e que IKKβ activado fosforila RelA para acelerar a degradação RelA. Como tal, γ HV68 desacopla eficazmente a activação de NFkB do seu montante IKKβ activado, eliminando a expressão do gene de citocinas anti-viral. Este estudo elucida uma estratégia em que o complexo de activação imune inata a montante é interceptado por um agente patogénico virai de anular a activação da transcrição imediatamente a jusante e evitar a produção de citocinas anti-viral.

Três figuras representativas são mostradas, incluindo a produção de citocinas nos pulmões de Mavs γHV68 infectadas + / + e Mavs-/ - rato, a secreção de citocinas e a expressão do gene de nível Mavs γHV68 infectadas + / + e Mavs - / - MEFs, e níveis de mRNA das citocinas de Mavs γHV68 infectados - / - MEFs &quot;reconstituído&quot; com MAVS. Estas experiências representativas utilizam camundongos knockout de...

Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

Nós descrevemos um protocolo para medir a produção de citocinas antiviral em camundongos infectados com um vírus do herpes modelo murino herpesvírus gama 68 (γ HV68) que está intimamente relacionada ao sarcoma-associado herpesvírus de Kaposi humana (SKHV) e vírus Epstein-Barr (EBV). Utilizando linhagens de camundongos geneticamente modificados e fibroblastos de rato embrionárias (MEFs), avaliou-se a produção de citocinas anti-viral in vivo e ex vivo. &quot;Reconstituição&quot; a expressão de componentes da imunidade inata em eliminatórias fibroblastos embrionários de transdução lentiviral, nós identificar mais moléculas imunes inatas específicas e dissecar os principais eventos de sinalização que diferencialmente regulam a produção de citocinas anti-viral.

Dissecando imunitário inatas Sinalização em Evasion Viral da produção de citocinas

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

dissecting-innate-immune-signaling-viral-evasion-cytokine

Research

JoVE Journal

Immunology and Infection

10.4K visualizações.  Keck School of Medicine, University of Southern California.  Nós descrevemos um protocolo para medir a produção de citocinas antiviral em camundongos infectados com um vírus do herpes modelo murino herpesvírus gama 68 (γ HV68) que está intimamente relacionada ao sarcoma-associado herpesvírus de Kaposi humana (SKHV) e vírus Epstein-Barr (EBV). Utilizando linhagens de camundongos geneticamente modificados e fibroblastos de rato embrionár...

Vídeo: Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

Production and Titering of Recombinant Adeno-associated Viral Vectors

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently being tested in human clinical trials. Wild-type AAV is a non-pathogenic member of the parvoviridae family and inherently replication-deficient. The broad transduction profile, low immune response as well as the strong and persistent transgene expression achieved with these vectors has made them a popular and versatile tool for in vitro and in vivo gene delivery. rAAVs can be easily and cheaply produced in the laboratory and, based on their favourable safety profile, are generally given a low safety classification. Here, we describe a method for the production and titering of chimeric rAAVs containing the capsid proteins of both AAV1 and AAV2. The use of these so-called chimeric vectors combines the benefits of both parental serotypes such as high titres stocks (AAV1) and purification by affinity chromatography (AAV2). These AAV serotypes are the best studied of all AAV serotypes, and individually have a broad infectivity pattern. The chimeric vectors described here should have the infectious properties of AAV1 and AAV2 and can thus be expected to infect a large range of tissues, including neurons, skeletal muscle, pancreas, kidney among others. The method described here uses heparin column purification, a method believed to give a higher viral titer and cleaner viral preparation than other purification methods, such as centrifugation through a caesium chloride gradient. Additionally, we describe how these vectors can be quickly and easily titered to give accurate reading of the number of infectious particles produced.

Recombinant adeno-associated virus (rAAVs) vectors are becoming increasingly valuable for in vivo studies in animals. We describe how rAAVs can be produced in the laboratory and how these vectors can be titered to give an accurate reading of the number of infectious particles produced.

Produção e titulação de adeno-associados recombinantes Vetores Virais

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

Imunologia e Infecção

Quantification of the Respiratory Burst Response as an Indicator of Innate Immune Health in Zebrafish

The phagocyte respiratory burst is part of the innate immune response to pathogen infection and involves the production of reactive oxygen species (ROS). ROS are toxic and function to kill phagocytized microorganisms. In vivo quantification of phagocyte-derived ROS provides information regarding an organism's ability to mount a robust innate immune response. Here we describe a protocol to quantify and compare ROS in whole zebrafish embryos upon chemical induction of the phagocyte respiratory burst. This method makes use of a non-fluorescent compound that becomes fluorescent upon oxidation by ROS. Individual zebrafish embryos are pipetted into the wells of a microplate and incubated in this fluorogenic substrate with or without a chemical inducer of the respiratory burst. Fluorescence in each well is quantified at desired time points using a microplate reader. Fluorescence readings are adjusted to eliminate background fluorescence and then compared using an unpaired t-test. This method allows for comparison of the respiratory burst potential of zebrafish embryos at different developmental stages and in response to experimental manipulations such as protein knockdown, overexpression, or treatment with pharmacological agents. This method can also be used to monitor the respiratory burst response in whole dissected kidneys or cell preparations from kidneys of adult zebrafish and some other fish species. We believe that the relative simplicity and adaptability of this protocol will complement existing protocols and will be of interest to researchers who seek to better understand the innate immune response.

The innate immune response protects organisms against pathogen infection. A critical component of the innate immune response, the phagocyte respiratory burst, generates reactive oxygen species that kill invading microorganisms. We describe a respiratory burst assay that quantifies reactive oxygen species produced when the innate immune response is chemically induced.

Quantificação da Resposta explosão respiratória como um indicador da imunitário inatas Saúde em Zebrafish

The phagocyte respiratory burst is part of the innate immune response to  pathogen infection and involves the production of reactive oxygen species (ROS). ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Macrophages are key phagocytic innate immune cells. When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the pathogen, produce various cytokines and chemokines to recruit and stimulate other immune cells, and present antigens to stimulate the adaptive immune response. Thus, being able to efficiently manipulate macrophages with techniques such as RNA-interference (RNAi) is critical to our ability to investigate this important innate immune cell. However, macrophages can be technically challenging to transfect and can exhibit inefficient RNAi-induced gene knockdown. In this protocol, we describe methods to efficiently transfect two mouse macrophage cell lines (RAW264.7 and J774A.1) with siRNA using the Amaxa Nucleofector 96-well Shuttle System and describe procedures to maximize the effect of siRNA on gene knockdown. Moreover, the described methods are adapted to work in 96-well format, allowing for medium and high-throughput studies. To demonstrate the utility of this approach, we describe experiments that utilize RNAi to inhibit genes that regulate lipopolysaccharide (LPS)-induced cytokine production.

In this protocol, we describe methods to efficiently transfect murine macrophage cell lines with siRNAs using the Amaxa Nucleofector 96-well Shuttle System, stimulate the macrophages with lipopolysaccharide, and monitor the effects on inflammatory cytokine production.

Usando RNA-interferência para investigar a imunitário inatas de resposta em macrófagos

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of causing systemic disease in both fish and humans. A better understanding of S. iniae disease pathogenesis requires an appropriate model system. The genetic tractability and the optical transparency of the early developmental stages of zebrafish allow for the generation and non-invasive imaging of transgenic lines with fluorescently tagged immune cells. The adaptive immune system is not fully functional until several weeks post fertilization, but zebrafish larvae have a conserved vertebrate innate immune system with both neutrophils and macrophages. Thus, the generation of a larval infection model allows the study of the specific contribution of innate immunity in controlling S. iniae infection.
The site of microinjection will determine whether an infection is systemic or initially localized. Here, we present our protocols for otic vesicle injection of zebrafish aged 2-3 days post fertilization as well as our techniques for fluorescent confocal imaging of infection. A localized infection site allows observation of initial microbe invasion, recruitment of host cells and dissemination of infection. Our findings using the zebrafish larval model of S. iniae infection indicate that zebrafish can be used to examine the differing contributions of host neutrophils and macrophages in localized bacterial infections. In addition, we describe how photolabeling of immune cells can be used to track individual host cell fate during the course of infection.

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

Here, we present a protocol for the generation and imaging of a localized bacterial infection in the zebrafish otic vesicle.

Imagem não invasivo do imunitário inatas Response em um modelo de peixe-zebra larval de<em&gt; Streptococcus iniae</em&gt; Infection

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of ...

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research is deciphering how these dynamic protein complexes act to integrate signals from multiple sources in order to direct a specific biological response, and how this becomes deregulated in many disease settings. Despite the importance of this key biochemical mechanism, there is a lack of experimental techniques that can facilitate the specific and sensitive deconvolution of these multi-molecular signaling complexes.
Here this shortcoming is addressed through the combination of a protein complementation assay with a conformation-specific nanobody, which we have termed Bimolecular Complementation Affinity Purification (BiCAP). This novel technique facilitates the specific isolation and downstream proteomic characterization of any pair of interacting proteins, to the exclusion of un-complexed individual proteins and complexes formed with competing binding partners. 
The BiCAP technique is adaptable to a wide array of downstream experimental assays, and the high degree of specificity afforded by this technique allows more nuanced investigations into the mechanics of protein complex assembly than is currently possible using standard affinity purification techniques.

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification BiCAP

This manuscript describes the protocol for Bimolecular Complementation Affinity Purification (BiCAP). This novel method facilitates the specific isolation and downstream proteomic characterization of any two interacting proteins, while excluding un-complexed individual proteins as well as complexes formed with competing binding partners.

Dissecando a proteínas multi sinalização complexos pela purificação da afinidade de complementação Bimolecular (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research ...

Single-cell Analysis of Immunophenotype and Cytokine Production in Peripheral Whole Blood via Mass Cytometry

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies in an attempt to understand the precise mechanisms that lead to the breakdown of self-tolerance and subsequent autoimmunity. Approaches thus far have been based on the study of one specific aspect of the immune system (a single or few cell types or cytokines), and do not offer a global assessment of complex autoimmune disease. While patient sera-based studies have afforded important insights into autoimmunity, they do not provide the specific cellular source of the dysregulated cytokines detected. A comprehensive single-cell approach to evaluate cytokine production in multiple immune cell subsets, within the context of &#34;intrinsic&#34; patient-specific plasma circulating factors, is described here. This approach enables monitoring of the patient-specific immune phenotype (surface markers) and function (cytokines), either in its native &#34;intrinsic pathogenic&#34; disease state, or in the presence of therapeutic agents (in vivo or ex vivo).

Here we describe a single-cell proteomic approach to evaluate immune phenotypic and functional (intracellular cytokine induction) alterations in peripheral whole blood samples, analyzed via mass cytometry.

Análise de célula única do imunofenótipo e produção de citocinas no sangue periférico através de citometria de massa

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies ...

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence rates of S. aureus infection climbing annually, there is a demand for additional research in its&#160;pathogenicity. Animal models of infectious disease advance our understanding of the host-pathogen response and lead to the development of effective therapeutics. Neutrophils play a primary role in the innate immune response that controls S. aureus infections by forming an abscess to wall off the infection and facilitate bacterial clearance; the number of neutrophils that infiltrate an S. aureus skin infection often correlates with disease outcome. LysM-EGFP mice, which possess the enhanced green fluorescent protein (EGFP) inserted in the Lysozyme M (LysM) promoter region (expressed primarily by neutrophils), when used in conjunction with in vivo whole animal fluorescence imaging (FLI) provide&#160;a means of quantifying neutrophil emigration noninvasively and longitudinally into wounded skin. When combined with a bioluminescent S. aureus strain and sequential in vivo whole animal bioluminescent imaging (BLI), it is possible to longitudinally monitor both the neutrophil recruitment dynamics and in vivo bacterial burden at the site of infection in anesthetized mice from onset of infection to resolution or death. Mice are more resistant to a number of virulence factors produced by S. aureus that facilitate effective colonization and infection in humans. Immunodeficient mice provide a more sensitive animal model to examine persistent S. aureus infections and the ability of therapeutics to boost innate immune responses. Herein, we characterize responses in LysM-EGFP mice that have been bred to MyD88-deficient mice (LysM-EGFP&#215;MyD88-/- mice) along with wild-type LysM-EGFP mice to investigate S. aureus skin wound infection. Multispectral simultaneous detection enabled study of neutrophil recruitment dynamics by using in vivo FLI, bacterial burden by using in vivo BLI, and wound healing longitudinally and noninvasively over time.

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

An approach is described for real-time detection of the innate immune response to cutaneous wounding and Staphylococcus aureus infection of mice. By comparing LysM-EGFP mice (which possess fluorescent neutrophils) with a LysM-EGFP crossbred immunodeficient mouse strain, we advance our understanding of infection and the development of approaches to combat infection.

Um modelo do rato para avaliar a resposta imune inata à infecção de Staphylococcus aureus

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence ...

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal host-microbe interactions. It is well established that different commensals exhibit a different potential to stimulate the host intestinal immune system. Such investigations involve vertebrate animals, especially rodents. Since increasing ethical concerns are linked with experiments involving vertebrates, there is a high demand for invertebrate replacements models. 
Here, we provide a Galleria mellonella oral administration model using commensal non-pathogenic bacteria and the possible assessment of the immunogenic potential of commensals on the G. mellonella immune system. We demonstrate that G. mellonella is a useful alternative invertebrate replacement model that allows the analysis of commensals with different immunogenic potential such as Bacteroides vulgatus and Escherichia coli. Interestingly, the bacteria exhibited no killing effect on the larvae, which is similar to mammals. The immune responses of G. mellonella were comparable with vertebrate innate immune responses and involve recognition of the bacteria and production of antimicrobial molecules. We propose that G. mellonella was able to restore previous microbiota balance, which is well known from healthy mammalian individuals. Although providing comparable innate immune responses in both G. mellonella and vertebrates, G. mellonella does not harbor an adaptive immune system. Since the investigated components of the innate immune system are evolutionary conserved, the model allows a prescreening and first analysis of bacterial immunogenic properties.

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

Here, we provide a detailed protocol for an oral administration model using Galleria mellonella larvae and how to characterize induced innate immune responses. Using this protocol, researchers without practical experience will be able to use the G. mellonella force-feeding method.

Um modelo de administração Oral Galleria mellonella para respostas imunes Study Commensal-Induced inata

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal ...

Isolation of Tonsillar Mononuclear Cells to Study Ex Vivo Innate Immune Responses in a Human Mucosal Lymphoid Tissue

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal immunity, because they can model host-pathogen interactions in the tissue. While isolated cells derived from tissues were the first cell culture model, their use has been neglected because tissue can be hard to obtain. In the present protocol, we explain how to easily process and culture tonsillar mononuclear cells (TMCs) from healthy human tonsils to study innate immune responses upon activation, mimicking viral infection in mucosal tissues. Isolation of TMCs from the tonsils is quick, because the tonsils barely have any epithelium and yield up to billions of all major immune cell types. This method allows detection of cytokine production using several techniques, including immunoassays, qPCR, microscopy, flow cytometry, etc., similar to the use of peripheral mononuclear cells (PBMCs) from blood. Furthermore, TMCs show a higher sensitivity to drug testing than PBMCs, which needs to be considered for future toxicity assays. Thus, ex vivo TMCs cultures are an easy and accessible mucosal model.

In the present protocol, we explain how to easily process and culture tonsillar mononuclear cells from healthy humans undergoing partial surgical tonsillectomy to study innate immune responses upon activation, mimicking viral infection in mucosal tissues.

Isolamento de células mononucleares tonsiláres para estudar respostas imunes inatas ex vivo em um tecido linfoide mucosal humano

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal ...

Microfluidic Co-Culture Models for Dissecting the Immune Response in in vitro Tumor Microenvironments

Complex disease models demand cutting-edge tools able to deliver physiologically and pathologically relevant, actionable insights, and unveil otherwise invisible processes. Advanced cell assays closely mimicking in vivo scenery are establishing themselves as novel ways to visualize and measure the bidirectional tumor-host interplay influencing the progression of cancer. Here we describe two versatile protocols to recreate highly controllable 2D and 3D co-cultures in microdevices, mimicking the complexity of the tumor microenvironment (TME), under natural and therapy-induced immunosurveillance. In section 1, an experimental setting is provided to monitor crosstalk between adherent tumor cells and floating immune populations, by bright field time-lapse microscopy. As an applicative scenario, we analyze the effects of anti-cancer treatments, such as the so-called immunogenic cancer cell death inducers on the recruitment and activation of immune cells. In section 2, 3D tumor-immune microenvironments are assembled in a competitive layout. Differential immune infiltration is monitored by fluorescence snapshots up to 72 h, to evaluate combination therapeutic strategies. In both settings, image processing steps are illustrated to extract a plethora of immune cell parameters (e.g., immune cell migration and interaction, response to therapeutic agents). These simple and powerful methods can be further tailored to simulate the complexity of the TME encompassing the heterogeneity and plasticity of cancer, stromal and immune cells subtypes, as well as their reciprocal interactions as drivers of cancer evolution. The compliance of these rapidly evolving technologies with live-cell high-content imaging can lead to the generation of large informative datasets, bringing forth new challenges. Indeed, the triangle &#39;&#39;co-cultures/microscopy/advanced data analysis&#34; sets the path towards a precise problem parametrization that may assist tailor-made therapeutic protocols. We expect that future integration of cancer-immune on-a-chip with artificial intelligence for high-throughput processing will synergize a large step forward in leveraging the capabilities as predictive and preclinical tools for precision and personalized oncology.

In the age of immunotherapy and single-cell genomic profiling, cancer biology requires novel in vitro and computational tools for investigating the tumor-immune interface in a proper spatiotemporal context. We describe protocols to exploit tumor-immune microfluidic co-cultures in 2D and 3D settings, compatible with dynamic, multiparametric monitoring of cellular functions.

Modelos de Co-Cultura Microfluídica para Dissecar a Resposta Imune em Microambientes Tumorais in vitro

Complex disease models demand cutting-edge tools able to deliver physiologically and pathologically relevant, actionable insights, and unveil otherwise ...