All animal usage procedures were in accordance with ethical guidelines laid down by the local governing body (Regierungspr&#228;sidium Karlsruhe, Karlsruhe, Germany).
1. Preparation of siRNA/PEI Complex
 
The siRNA/PEI complex solution is prepared using manufacturer&#39;s directions as follows:
<ol>
	<li>Solution A: Dilute the desired amount of siRNA with sterile water (if necessary) up to a quarter of the end volume and dilute this further with 10% glucose solu...

<ol>
	<li>Hylden, J. L., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrathecal+morphine+in+mice:+a+new+technique.">Intrathecal morphine in mice: a new technique.</a> Eur. J. Pharmacol. 67, 313-316 (1980).</li><li>Stokes, J. A., Corr, M., Yaksh, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+tactile+allodynia+following+intrathecal+puncture+in+mouse:+contributions+of+Toll-like+receptor+signaling.">Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling.</a> Neurosci. Lett. 504, 215-218 (2011).</li><li>Goula, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+intravenous+delivery+of+transgenes+to+mouse+lung.">Polyethylenimine-based intravenous delivery of transgenes to mouse lung.</a> Gene Ther. , 1291-1295 (1998).</li><li>Fairbanks, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+delivery+of+analgesics+in+experimental+models+of+pain+and+analgesia.">Spinal delivery of analgesics in experimental models of pain and analgesia.</a> Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).</li><li>Hohmann, A. G., Tsou, K., Walker, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cannabinoid+modulation+of+wide+dynamic+range+neurons+in+the+lumbar+dorsal+horn+of+the+rat+by+spinally+administered+WIN55,212-2.">Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2.</a> Neurosci. Lett. 257, 119-122 (1998).</li><li>Song, Z. H., Takemori, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+spinal+kappa+opioid+receptors+in+the+antinociception+produced+by+intrathecally+administered+corticotropin-releasing+factor+in+mice.">Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice.</a> J. Pharmacol. Exp. Ther. 254, 363-368 (1990).</li><li>Trang, T., Sutak, M., Jhamandas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+cannabinoid+(CB1)-receptors+in+the+development+and+maintenance+of+opioid+tolerance.">Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance.</a> Neuroscience. , 1275-1288 (2007).</li><li>Yaksh, T. L., Rudy, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chronic+catheterization+of+the+spinal+subarachnoid+space.">Chronic catheterization of the spinal subarachnoid space.</a> Physiol. Behav. 17, 1031-1036 (1976).</li><li>Tappe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+scaffolding+protein+Homer1a+protects+against+chronic+inflammatory+pain.">Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain.</a> Nat. Med. , 677-681 (2006).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+the+Cav3.2+T-type+calcium+channel+gene+in+sensory+neurons+demonstrates+its+major+role+in+nociception.">Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception.</a> EMBO J. 24, 315-324 (2005).</li><li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+to+dorsal+root+ganglia+by+intrathecal+injection:+effects+on+regeneration+of+peripheral+nerves.">Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves.</a> Mol. Ther. 12, 314-320 (2005).</li><li>Wigdor, S., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+and+systemic+morphine-induced+antinociception+in+mice:+contribution+of+descending+serotonergic+and+noradrenergic+pathways.">Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways.</a> J. Pharmacol. Exp. Ther. 242, 90-95 (1987).</li></ol>

The authors declare no competing financial interests.

Thus, the above-described technique of intrathecal needle injections is efficacious, fast, specifically-localized, and nondestructive. Technically, the most critical aspect of this procedure is the point of needle insertion into the groove. It is crucial that this procedure is done with very calm hands and patience. Like many surgical procedures, training improves the rate of successful injection. This is also important because during an actual experiment, this technique does not provide an obvious indicator to directly ...

The spinal cord is a very important center in a variety of key biological processes and physiological functions, including processing and transmission of painful (nociceptive) inputs4-7. Various experimental techniques have been developed to facilitate pharmacological modulation of the spinal cord, such as chronic implantation of intrathecal catheters8, spinal cord microinjection, and intrathecal needle injection9. Each technique has its own advantages and drawbacks, and depending on the experiment paradigm one technique might be more suitable than the others. Whereas chronic implantation of intrathecal catheters is readily feasible in rat, this method is very difficult in the mouse, given size restrictions. Success rate is very low and motor deficits often occur due to the bulky presence of a catheter in the severely confined subdural space in the mouse. Moreover, long term delivery of drugs is rendered due to frequent clotting of chronically implanted catheters. Finally, immune reactions are common.
These problems can be circumvented using the method of acute intrathecal injection via a needle in the absence of a preimplanted catheter, which enables a fast and anatomically limited application of drugs and reagents to the spinal cords in mice. This method fully retains the benefits of intrathecal delivery over other systemic delivery routes (e.g. oral, intravenous, intraperitoneal, etc.) such as specificity of spinal modulation, which permits reduced dosages and limit side effects, as well as ability to deliver substances do not&#160;normally do not cross the blood brain barrier since during intrathecal injection, the needle is inserted between the dura mater and the spinal cord. Importantly however, in comparison to other methods of intrathecal delivery, the intrathecal needle injection method is the least invasive, allowing numerous applications in the same animal without causing any considerable tissue damage or evoking immune reaction due to implantation of foreign material. However, it requires technical skills for a very precise targeting of the needle to permit efficacy.
Here, we visually demonstrate the method for achieving an optimal rate of success for specifically targeting the lumbar spinal cord. The site of injection that is chosen in this experiment is the groove between L5 and L6 vertebrate column, near to where the spinal cord ends, to minimize the possibility of damaging the spine. Moreover, we demonstrate the use of this technique to knock down genes in the spinal cord using siRNAs.

<table border="0" cellpadding="0" cellspacing="0" width="1012">
	<colgroup>
		<col /> 
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:283px;">in vivo-jetPEI</td>
			<td style="width:255px;">Polyplus</td>
			<td style="width:288px;">201-10G</td>
			<td style="width:188px;"> </td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 siRNA</td>
			<td>Santa Cruz</td>
			<td>sc-36832</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Control siRNA-A</td>
			<td>Santa Cruz</td>
			<td>sc-37007</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-&#223;-Tubulin III antibody</td>
			<td>Sigma</td>
			<td>T2200</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-WAVE1 antibody</td>
			<td>R&#38;D Systems</td>
			<td>AF5514</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Fast green dye</td>
			<td>Sigma</td>
			<td>F-7252</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isoflurane</td>
			<td>Baxter</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isoflurane setup</td>
			<td>Dr&#228;ger L&#252;beck</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Shaver</td>
			<td>Wella</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Hamilton syringe Gastight 1702</td>
			<td>Hamilton</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">30G 1/2, 0,3 * 13mm Needle</td>
			<td>BD Microlance</td>
			<td>304000</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Microscope Leica MS5</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 forward primer for qRT-PCR</td>
			<td>Sigma</td>
			<td></td>
			<td>cacagagcctcaggacagg</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 reversed primer for qRT-PCR</td>
			<td>Sigma</td>
			<td></td>
			<td>cttttcaccaacggcatctt</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">FastStart Essential DNA Green Master</td>
			<td>Roche</td>
			<td>6402712001</td>
			<td></td>
		</tr>
	</tbody>
</table>

in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter implantation. The technical limitation of this surgical technique lies in the finesse of the hands. The injection is rapid, especially for a trained experimenter, and since tissue disruption with this technique is minimal, repeated injections are possible; moreover immune reaction to foreign tools (e.g. catheter) does not occur, thereby giving a better and more specific read out of spinal cord modulation. Since the application of the substance is largely limited to the target region of the spinal cord, drugs do not need to be applied in large dosages, and more importantly unwanted effects on other tissue, as observed with a systemic delivery, could be circumvented1,2. Moreover, we combine this technique with in vivo transfection of nucleic acid with the help of polyethylenimine (PEI) reagent3, which provides tremendous versatility for studying spinal functions via delivery of pharmacological agents as well as gene, RNA, and protein modulators.

In order to illustrate a successful injection, we performed this technique using Fast Green FCF dye in adult C57Bl6 mice (8-10 weeks of age). The animal was allowed to recover for a few minutes after the injection to provide enough time for the dye to spread and then killed with an overdose of CO2. Subsequently, the vertebrate column was dissected and the spinal cord was exposed. The blue puncta corresponding to the diffused dye, marked the injection site. No sign of injury to the spinal cord could be seen, co...

Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

This report describes a simple and rapid technique of intrathecal needle puncture for a localized transfection of siRNA in the lumbar spinal cord in mouse under short lasting light anesthesia.

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter ...

in-vivo-sirna-transfection-gene-knockdown-spinal-cord-via-rapid

Research

JoVE Journal

Biology

45.9K visualizações.  University of Heidelberg.  Este relatório descreve uma técnica simples e rápida de punção intratecal para a transfecção localizada de siRNA na medula espinhal lombar em rato sob anestesia luz de curta duração. 