The authors have no acknowledgements.

1. Ensaio da preparação da mistura <ol><li> Faça concentrações 100 mmol / L de ações para todos os iniciadores em água de grau molecular e sondas em tampão TE pH 8 [Entero F1A, Entero R1, GPL813TQ 12; HF183-1, BthetR1, BthetP1 3]. Nota: Sondas para os dois alvos são fluorescente etiquetado com diferentes fluoróforos 7 como indicados na Lista de materiais / equipamentos. </li><li> Prepare mistura principal misturando, por reacção planejado, 12 ul digital de mistura de PCR (2x de ações, ver Lista de materiais / equipamentos), 0,216 mL cada um para a frente e primer, 0,06 mL cada sonda fluorescente reversa e 5.016 mL de água livre de nuclease (concentração final : 900 nm cada iniciador, 250 nM cada sonda). Pipeta cima e para baixo pelo menos 10 vezes para misturar ao tomar cuidado para não introduzir bolhas de ar na solução. </li><li> Pipeta de 18 mL mix master (a partir do passo 1.2) para um tubo de PCR regular ou placa, misturando no modelo de DNA 6 ul (extraído como descrito Previously 13) para fazer mistura de ensaio para a geração de gotículas. Se a execução de amostras em duplicado, pipeta 36 ul de mistura principal e 12 molde de ADN em cada poço. Deixe os poços em duplicado correspondentes vazio sobre o prato. Incluir controlos positivos (ver lista de materiais / equipamentos) e não há controles de modelo (NTC) (ou seja, com água de grau molecular usado como modelo). Nota: O controlo positivo é necessário para assegurar que o ensaio é executado correctamente e o CNT é necessário para assegurar que não há contaminação dentro do prato e para definir a linha de base fluorescente mais tarde na análise de dados. usuários de primeira vez são recomendados para usar ambas as amostras de DNA não diluídas e diluídas. </li></ol> 2. Geração Gota e configuração da placa PCR <ol><li> Misture as misturas de ensaio pipetando cima para baixo aproximadamente 15 vezes usando uma pipeta multicanal. Certifique-se de que a ponta da pipeta permanece dentro líquido para evitar que bolhas em excesso dentro da mistura. </li><li> inscartucho de ert 1 (contendo 8 poços) em um suporte de cartucho branco e clique no suporte do cartucho fechada. Cartucho 1 é agora firmemente no lugar e não pode ser desalojado do suporte enquanto que a geração de gotículas. Usando uma pipeta multicanal, gentilmente transferir 20 l de mistura de ensaio para a posição do meio do cartucho marcado &quot;amostra&quot; sem a introdução de bolhas de ar. </li><li> Pipetar em 70 ul de óleo de geração de gotículas para o lado esquerdo do cartucho (marcado &quot;Óleo&quot;). </li><li> cartucho de tampa com uma junta de vedação para garantir que a junta de vedação é realizada de forma uniforme e plana por a quatro carraças na direcção da extremidade do cartucho. Pressione o botão de luz verde sobre o gerador de gotículas de abrir e coloque o cartucho. Pressione o botão verde iluminado novamente para fechar o gerador. Nota: Uma vez que a porta se fecha, o botão fica esmaecido, a porta não pode ser reaberto e geração de gota começa imediatamente continuando por cerca de 1 min. </li><li> Se fazendo mais de 8 reações, lugar de cartuchos 2 em um segundoo suporte do cartucho e branco preparar da mesma maneira como um cartucho enquanto a geração de gotículas está em andamento para economizar tempo total de instalação. </li><li> Abra a porta do gerador de gotículas quando o botão dim iluminada fica verde, indicando a conclusão da geração de gotículas. Retire o suporte do branco cartucho contendo cartucho 1, posta de lado, eo cartucho de lugar 2 para o gerador de gota. </li><li> Remova a junta de cartucho 1 e descarte. Suavemente transferir o volume total (aproximadamente 40 ul) de gotículas geradas a partir da terceira coluna do cartucho (marcado &#39;Gotas&#39;) para uma placa de PCR final (mantido à temperatura ambiente) durante o ciclo térmico. Nota: Não desmarque suporte do cartucho de branco como a ação pode quebrar as gotículas recém-gerados; abrir apenas o suporte do cartucho após as gotículas de ter sido transferido para a placa de final. </li><li> Repita os passos de 2,1-2,7 para amostras adicionais. </li><li> Quando todas as gotículas são na placa de PCR final, colocar uma perfurávelcobertura de alumínio em cima do prato e coloque-o sobre o selador de placa. Definir o cimento a 180 ° C, prima &#39;Play&#39; no selador e deixe selo para 10 seg. </li></ol> 3. ciclos térmicos e Leitura Gota <ol><li> Colocar a placa selada no termociclador, um compatível com a placa de PCR final utilizada no passo 2.7, e uma velocidade de rampa de temperatura de 2,0 ° C / seg. </li><li> Executar programa térmico como se segue: 10 min a 95 ° C, seguido de 40 ciclos de 30 seg a 94 ° C e 60 segundos a 60 ° C, seguido de 10 minutos de espera em 98 ° C (opcional: preensão final em 4 ou 15 ° C). </li><li> Após a conclusão dos ciclos, transferir a placa para um leitor de gota para a medição automática da fluorescência em cada gota em cada poço. Alternativamente, armazenar a placa a 4 ° C durante até 3 dias antes da leitura das gotículas. Certifique-se as gotas são à temperatura ambiente antes de prosseguir com a leitura. <ol><li> Abra o software que acompanha a configuração da leitura gota. Dentroo menu padrão &#39;Setup&#39; contendo um esquema de uma placa de 96 poços vazios, clique duas vezes no poço A1 para abrir o menu que contém três seções: &quot;amostra&quot;, &quot;Ensaio 1 &#39;e&#39; Ensaio 2. &#39; </li><li> Na seção &#39;Sample&#39; digite o ID da amostra na caixa chamada &quot;Nome&quot; e pressione enter ou marque a caixa à direita marcado &quot;Aplicar&quot;. Em seguida, clique no menu drop-down rotulados &#39;Experiment&#39; e escolha &#39;RED&#39; (detecção evento raro) e clique em entrar. </li><li> Mover para a seção indicada &quot;Ensaio 1. &#39; Na seção &#39;Nome&#39; preencher o ensaio (por exemplo, Enterococcus) e clique em entrar. Na caixa abaixo &#39;Tipo&#39; rotulado clique no menu drop-down e escolha &quot;Canal 1 Desconhecido&quot; e clique em entrar. </li><li> Mover para a seção indicada &quot;Ensaio 2. &#39; Na seção &#39;Nome&#39; preencher o ensaio (por exemplo, HF183) e clique em entrar. Na caixa abaixo rotulados &#39;Tipo&#39;, clique no menu suspenso um menud Escolha &#39;Canal 2 Desconhecido &quot;e clique em entrar. Toda a informação de Passos 3.3.2 a 3.3.4 está presente em bem A1. </li><li> Nome todos os poços subsequentes contendo gotículas. Para economizar tempo total de instalação, clique em &quot;Shift&quot; ou &quot;Ctrl&quot;, para escolher vários poços simultaneamente. </li><li> Quando a representação digital do prato espelha a placa física, pressione &quot;OK&quot; na parte inferior direita do menu. No novo menu que aparece no topo do esquema placa, na seção &#39;Modelo&#39; escolha &#39;Salvar como&#39; e o nome e salvar o prato. </li><li> À esquerda da tela, clique em &quot;Executar&quot; e escolha apropriada Set Dye em pop-out janela &quot;Opções de Execução&quot; o. A recolha de dados inicia e é exibida em tempo real no software. </li></ol></li></ol> 4. Análise de Dados e Relatórios <ol><li> Quando o leitor está terminada e uma caixa será exibida informando &#39;Run Complete&#39;, clique em &#39;OK&#39;. Nota: O softWare exibe o arquivo de dados final na seção &quot;Analisar&quot; do software. Neste ponto de vista, o software tem todos os poços na placa selecionados e padrões para trama de dados do &#39;2D Amplitude&#39;. </li><li> Verifique a separação entre as gotículas positivos e negativos. Assegure-se que a fluorescência em todas as gotículas nos poços NTC estão perto da linha de base. </li><li> Clique no botão &#39;Eventos&#39;. À direita do histograma apresentado clique na caixa chamada &quot;Total&quot; ea caixa com o nome &quot;único&quot; na parte inferior para exibir o número total de gotículas aceites por poço. Excluir quaisquer poços contendo &lt;10.000 gotículas 7, mantendo a tecla Ctrl e clicando sobre o bem (s) a ser excluído. </li><li> Clique no botão indicado como &#39;1D Amplitude&#39; para definir o limiar de fluorescência a cerca de um desvio padrão (500-700 unidades de fluorescência) acima das gotas negativos em poços NTC para ambas as metas. No lado esquerdo do ecrã under &quot;Analisar Auto &#39;o que mostra dois botões de limite, escolha o ícone à direita que tem uma linha horizontal rosa contínuo que passa por ele. </li><li> Clique na caixa à esquerda de &quot;Threshold Definir &#39;no âmbito de cada um dos gráficos de amplitude e digite os valores de limite de fluorescência apropriados. As concentrações de alvo em cópia por reacção uL são então calculados automaticamente. Nota: Os limiares não precisam ser idênticas para os diferentes alvos. </li><li> Exportar os resultados em um arquivo .csv, clicando no botão &quot;Exportar&quot; no canto superior esquerdo na tela do 1D Amplitude. No arquivo .csv, multiplicar a concentração alvo exportados por 4 a convertê-lo de cópia do alvo (23S gene de Enterococcus spp., Ou o marcador HF183) por reacção ul para copiar da meta per l modelo de DNA. </li></ol>

<ol>
	<li>Boehm, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+forty-one+microbial+source+tracking+methods:+A+twenty-seven+lab+evaluation+study.">Performance of forty-one microbial source tracking methods: A twenty-seven lab evaluation study.</a> Water Res. 47 (18), 6812-6828 (2013).</li><li>Layton, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+human+fecal+anaerobe-associated+PCR-based+assays+in+a+multi-laboratory+method+evaluation+study.">Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study.</a> Water Res. 47 (18), 6897-6908 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+platform,+reference+material,+and+quantification+model+on+enumeration+of+Enterococcus+by+quantitative+PCR+methods.">Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods.</a> Water Res. 47 (1), 233-241 (2013).</li><li>Sivaganesan, M., Siefring, S., Varma, M., Haugland, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MPN+estimation+of+qPCR+target+sequence+recoveries+from+whole+cell+calibrator+samples.">MPN estimation of qPCR target sequence recoveries from whole cell calibrator samples.</a> J. Microbiol. Methods. 87 (3), 343-349 (2011).</li><li>Huggett, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Digital+MIQE+Guidelines:+Minimum+Information+for+Publication+of+Quantitative+Digital+PCR+Experiments.">The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments.</a> Clin. Chem. 59 (6), 892-902 (2013).</li><li>Cao, Y., Raith, M. R., Griffith, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+digital+PCR+for+simultaneous+quantification+of+general+and+human-associated+fecal+indicators+for+water+quality+assessment.">Droplet digital PCR for simultaneous quantification of general and human-associated fecal indicators for water quality assessment.</a> Water Res. 70, 337-349 (2015).</li><li>Sanders, R., Huggett, J. F., Bushell, C. A., Cowen, S., Scott, D. J., Foy, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+Digital+PCR+for+Absolute+DNA+Quantification.">Evaluation of Digital PCR for Absolute DNA Quantification.</a> Anal. Chem. 83 (17), 6474-6484 (2011).</li><li>Whale, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+microfluidic+digital+PCR+and+conventional+quantitative+PCR+for+measuring+copy+number+variation.">Comparison of microfluidic digital PCR and conventional quantitative PCR for measuring copy number variation.</a> Nucleic Acid Res. 40 (11), 82-89 (2012).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nature Methods. 10 (10), 1003-1005 (2013).</li><li>Morisset, D., &#352;tebih, D., Milavec, M., Gruden, K., &#381;el, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+food+and+feed+aamples+with+droplet+digital+PCR.">Quantitative analysis of food and feed aamples with droplet digital PCR.</a> PLoS One. 8 (5), e62583 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+molecular+community+analysis+methods+for+discerning+fecal+sources+and+human+waste.">Evaluation of molecular community analysis methods for discerning fecal sources and human waste.</a> Water Res. 47 (18), 6862-6872 (2013).</li></ol>

The authors declare that they have no competing financial interests.

Existem algumas etapas críticas do protocolo. Em primeiro lugar, a mistura das misturas de ensaio pode ser difícil, porque a mistura principal é mais viscoso do que misturas principais qPCR convencionais. vórtex simples pode levar a uma mistura insuficiente, o que conduz por sua vez à distribuição não uniforme de moldes de ADN nas misturas de ensaio e posteriormente nas gotículas. A técnica de mistura-por-pipetagem descrito no protocolo deve ser seguido para garantir a quantificação precisa dPCR. Em segundo ...

Os métodos quantitativos de PCR (qPCR) têm sido amplamente utilizados para a monitorização da qualidade da água de recreio e aplicações de monitorização de origem microbiana, porque eles são mais rápidos, mais flexível e específica em comparação com os métodos baseados em cultura tradicionais. Consequentemente, qPCR é recomendado para a obtenção de resultados de monitorização das águas rápidas para os indicadores fecais gerais, tais como Enterococcus spp. Nos critérios de qualidade revistos USEPA águas de recreio 1. Muitos ensaios qPCR também têm sido desenvolvidos e validados para a identificação de fontes de contaminação fecal em águas ambientais 2. Entre estes, os ensaios HF183 marcadores estão entre os mais utilizados para identificar a contaminação fecal associada a 3 humano. No entanto, os resultados qPCR muitas vezes pode ser tendenciosa, porque dependem de curvas padrão para a quantificação. qPCR quantifica concentrações desconhecidas do alvo em amostras por interpolação seu ciclo de quantificação (CQ) de um standard curva que descreve uma relação linear entre a quantidade Cq e logarítmica de um conjunto de padrões diluído seriadamente. Falta de material de referência confiável e consistente pode, portanto, viés bastante resultados qPCR. Estudos mostraram que os resultados qPCR diferiram em aproximadamente metade de um log usando padrões de diferentes fornecedores 4 e por 2 vezes utilizando diferentes lotes de padrões do mesmo fornecedor 5. A tecnologia digital PCR (dPCR) quantifica uma amostra desconhecida, contando a frequência de positivos em grande número de PCRs em miniatura que são gerados pelo particionamento de um qPCR em massa para milhares ou milhões de nanoliter uniforme ou reações picolitros 6. É referido como PCR gota digitais (isto é, neste artigo) ou PCR câmara digital de, respectivamente, se as divisórias são água-em-óleo de gotículas (isto é, neste artigo) ou pequenas câmaras sobre um chip. A concentração da amostra mais elevada resultará na presença de ADN alvo(PCR daí positiva), numa proporção superior das divisórias, uma relação aproximada pela distribuição de Poisson. Como tal, os resultados binários (PCR positiva ou negativa) são registados e a frequência de gotículas de positivos é usado para calcular as concentrações das amostras desconhecidas directamente através de Poisson aproximação, eliminando a necessidade de uma curva padrão como no qPCR. Esta natureza binária de quantificação PCR digital proporciona vantagens adicionais sobre qPCR 7. Uma vez que a amplificação atrasada pode ainda produzir um PCR positivo, dPCR quantificação seja mais robusto contra inibição que reduz a eficiência de amplificação. Da mesma forma, dPCR quantificação não é afectado pela variabilidade em valores Cq como é qPCR, levando a uma maior precisão da dPCR em comparação com 8-10 qPCR. Além disso, o processo de particionamento garante uma muito pequena quantidade de ADN presente alvo em cada gotícula, minimizando eficazmente competição pelo substrato (durante amplification de alvos diferentes de DNA) que são obstáculos comuns para alcançar duplex (ou seja, um ensaio mede simultaneamente dois alvos de ADN) em qPCR. Como tal, se executado em duplex ou simplex (ou seja, um alvo é medido em um único ensaio) dPCR produz quantificação quase indistinguível de ambos os alvos 7,11. O objetivo do ensaio de PCR digitais (EntHF183 dPCR) descrito neste artigo é a obtenção de quantificação direta simultânea do indicador fecal geral Enterococcus spp. E o marcador HF183 humano-fecal associada a uma melhor precisão, reprodutibilidade e robustez contra a inibição em comparação com seu qPCR homólogos. Este ensaio tem sido usado com sucesso para quantificar a contaminação fecal no ambiente de água doce, água do mar, e vários material fecal 7, mas também pode ser aplicado a quaisquer outros tipos de águas e águas residuais. Este ensaio é uma grande promessa para a análise de sedimentos ou solos devido a eles elevada tolerância à inibição, mas mais testes é necessária devido às complexidades de inibidor mistura nestes tipos de amostras.

<table><tbody><tr><td>Low Bind Microtubes</td><td>Costar</td><td>3207</td><td>For storage of reagents, samples/production of master mixes</td></tr><tr><td>Nuclease Free Water</td><td>FisherSci</td><td>BP2484-50</td><td></td></tr><tr><td>TE pH 8 buffer</td><td>FisherSci</td><td>BP2473-100</td><td></td></tr><tr><td>Hardshell 96 Well Plate</td><td>BioRad</td><td>HSP-9601</td><td>For initial master mix and sample inoculation</td></tr><tr><td>Aluminum Sealing Film</td><td>BioRad</td><td>359-0133</td><td>To seal sample plate</td></tr><tr><td>Droplet Generator</td><td>BioRad</td><td>186-3002</td><td></td></tr><tr><td>Droplet Generation Oil</td><td>BioRad</td><td>186-3005</td><td></td></tr><tr><td>Cartridge</td><td>BioRad</td><td>186-4008</td><td></td></tr><tr><td>DG8 Cartridge Holder</td><td>BioRad</td><td>186-3051</td><td></td></tr><tr><td>Gasket</td><td>BioRad</td><td>186-3009</td><td></td></tr><tr><td>20 &amp;#956;l pipet tips</td><td>Rainin</td><td>GP-L10F</td><td>For tansferring sample/master mix to cartidge</td></tr><tr><td>200 &amp;#956;l pipet tips</td><td>Rainin</td><td>GP-L200F</td><td>For transferring droplets to final Twin.Tec Plate</td></tr><tr><td>Twin.Tec 96 Well Plate</td><td>Eppendorf</td><td>951020320</td><td>For final droplets thermal cycling and reading</td></tr><tr><td>Pierceable Heat Seal Foil</td><td>BioRad</td><td>181-4040</td><td>To seal Twin.Tec plate before thermalcycling</td></tr><tr><td>PX1 PCR Plate Sealer</td><td>BioRad</td><td>181-4000</td><td></td></tr><tr><td>CFX96 Thermalcycler</td><td>BioRad</td><td>CFX96 and C1000</td><td>Only the thermal cycler is needed, no optics</td></tr><tr><td>QX100 Droplet Reader</td><td>BioRad</td><td>186-3001</td><td></td></tr><tr><td>Droplet Reader Oil</td><td>BioRad</td><td>186-3004</td><td></td></tr><tr><td>Droplet PCR Supermix&amp;nbsp;</td><td>BioRad</td><td>186-3024</td><td>&lt;em&gt;i.e.&lt;/em&gt; the digital PCR mix in manuscript</td></tr><tr><td>QuantaSoft software (v1.3.2)</td><td>Quantasoft&amp;nbsp;</td><td>QX100&amp;nbsp;</td><td>For viewing, analyzing, and exporting ddPCR data</td></tr><tr><td>Entero Forward Primer (Ent F1A)</td><td>Operon</td><td>GAGAAATTCCAAACGAACTTG</td><td>Alternative vendor can be used</td></tr><tr><td>Entero Reverse Primer (Ent R1)</td><td>Operon</td><td>CAGTGCTCTACCTCCATCATT</td><td>Alternative vendor can be used</td></tr><tr><td>Entero Probe (GPL813TQ)</td><td>Operon</td><td>[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]</td><td>Alternative vendor can be used, but the florophore has to be FAM</td></tr><tr><td>HF183 Forward Primer (HF183-1)</td><td>Operon</td><td>ATCATGAGTTCACATGTCCG</td><td>Alternative vendor can be used</td></tr><tr><td>HF183 Reverse Primer (BthetR1)</td><td>Operon</td><td>CGTAGGAGTTTGGACCGTGT</td><td>Alternative vendor can be used</td></tr><tr><td>HF183 Probe (BthetP1)</td><td>Operon</td><td>[6-HEX]-CTGAGAGGAAGGTCCCCC&lt;br/&gt; ACATTGGA-[BHQ1]</td><td>Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.&amp;nbsp;</td></tr><tr><td>Positive control</td><td></td><td></td><td>Mixture of &lt;em&gt;E. faecalis&lt;/em&gt; genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing &lt;em&gt;E. faecalis&lt;/em&gt; and sequences of the ordered HF183 plasmid, please see Cao &lt;em&gt;et al.&lt;/em&gt; 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available &lt;em&gt;Enterococcus&lt;/em&gt; DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared &lt;em&gt;E. faecalis&lt;/em&gt; genomic DNA.</td></tr></tbody></table>

a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters

Este manuscrito descreve um ensaio de PCR digitais duplex (EntHF183 dPCR) para a quantificação simultânea de Enterococcus spp. E o marcador HF183 fecal-associado humana. O EntHF183 duplex dPCR (referido como EntHF183 dPCR hereon) ensaio utiliza as mesmas sequências de Iniciador e Sonda como as suas congéneres PCR quantitativo (qPCR) individuais publicados. Da mesma forma, os mesmos procedimentos de filtragem de água e extração de DNA como realizados antes da qPCR são seguidos antes de executar dPCR. No entanto, o ensaio dPCR duplex tem várias vantagens sobre os ensaios de qPCR. Mais importante, o ensaio dPCR elimina a necessidade de execução de uma curva padrão e, por conseguinte, a polarização e variabilidade associada, por quantificação directa dos seus alvos. Além disso, embora a impressão duplex (isto é quantificação simultânea) Enterococcus e HF183 em qPCR muitas vezes leva a subestimação grave do alvo menos abundantes em uma amostra, dPCR fornece quantificação consistente de ambos os alvos, aguçarela quantificada individualmente ou simultaneamente na mesma reacção. O ensaio dPCR também é capaz de tolerar concentrações de inibidor de PCR que são uma a duas ordens de magnitude maior do que as toleradas por qPCR. Estas vantagens tornam o ensaio EntHF183 dPCR particularmente atraente porque fornece simultaneamente informações precisas e repetíveis em ambos contaminação geral e associada humano-fecal em águas ambientais, sem a necessidade de executar dois ensaios qPCR separadas. Apesar das suas vantagens sobre qPCR, o limite de quantificação do ensaio superior dPCR com instrumentação actualmente disponível é aproximadamente quatro ordens de grandeza menor do que a alcançável por qPCR. Por conseguinte, a diluição é necessário para a medição de concentrações elevadas de organismos alvo, tais como aqueles tipicamente observado após a derrames de esgoto.

Um bom EntHF183 duplex dPCR execução deve resultar em número relativamente elevado de gotículas aceites (cerca de 10,000-17,000) e diferença relativamente grande (cerca de 5,000) entre os valores de fluorescência para gotas negativos e positivos 7. Invulgarmente baixo número de gotículas provavelmente indica problemas no processo de geração de gotículas, e um limite de exclusão de 10.000 gotículas é sugerida com base em dados empíricos do siste...

Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Este manuscrito descreve um ensaio de PCR digital duplex que pode ser utilizado para quantificar simultaneamente Enterococcus spp. E os marcadores genéticos HF183 como indicadores de contaminação fecal humana em geral e associada-em águas de recreio.

Um ensaio de PCR Duplex Digital para a simultânea Quantificação da<em&gt; Enterococcus spp.</em&gt; Ea Human Fecal-associado HF183 marcador no Waters

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated ...

a-duplex-digital-pcr-assay-for-simultaneous-quantification

Research

JoVE Journal

Environment

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

9.7K visualizações.  Southern California Costal Water Research Project Authority.  Este manuscrito descreve um ensaio de PCR digital duplex que pode ser utilizado para quantificar simultaneamente Enterococcus spp. E os marcadores genéticos HF183 como indicadores de contaminação fecal humana em geral e associada-em águas de recreio. 

Vídeo: A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. Part III. Virus Detection by RT-qPCR

EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. This method was developed with the goal of having a standardized method for use in multiple analytical laboratories during monitoring period 3 of the Unregulated Contaminant Monitoring Rule. Herein we present the protocol for extraction of viral ribonucleic acid (RNA) from water sample concentrates and for quantitatively measuring enterovirus and norovirus concentrations using reverse transcription-quantitative PCR (RT-qPCR). Virus concentrations for the molecular assay are calculated in terms of genomic copies of viral RNA per liter based upon a standard curve. The method uses a number of quality controls to increase data quality and to reduce interlaboratory and intralaboratory variation. The method has been evaluated by examining virus recovery from ground and reagent grade waters seeded with poliovirus type 3 and murine norovirus as a surrogate for human noroviruses. Mean poliovirus recoveries were 20% in groundwaters and 44% in reagent grade water. Mean murine norovirus recoveries with the RT-qPCR assay were 30% in groundwaters and 4% in reagent grade water.

Here we present a procedure to quantify enterovirus and norovirus in environmental and drinking waters using reverse transcription-quantitative PCR. Mean virus recovery from groundwater with this standardized procedure from EPA Method 1615 was 20% for poliovirus and 30% for murine norovirus.

EPA Método 1615. Medição de Enterovirus e Norovirus Ocorrência na água por cultura e RT-qPCR. Parte III. Detecção de vírus por RT-qPCR

EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. This method was developed with the goal of having a ...

Ambiente

Cost-effective Method for Microbial Source Tracking Using Specific Human and Animal Viruses

Microbial contamination of the environment represents a significant health risk. Classical bacterial fecal indicators have shown to have significant limitations, viruses are more resistant to many inactivation processes and standard fecal indicators do not inform on the source of contamination. The development of cost-effective methods for the concentration of viruses from water and molecular assays facilitates the applicability of viruses as indicators of fecal contamination and as microbial source tracking (MST) tools. Adenoviruses and polyomaviruses are DNA viruses infecting specific vertebrate species including humans and are persistently excreted in feces and/or urine in all geographical areas studied. In previous studies, we suggested the quantification of human adenoviruses (HAdV) and JC polyomaviruses (JCPyV) by quantitative PCR (qPCR) as an index of human fecal contamination. Recently, we have developed qPCR assays for the specific quantification of porcine adenoviruses (PAdV) and bovine polyomaviruses (BPyV) as animal fecal markers of contamination with sensitivities of 1-10 genome copies per test tube. In this study, we present the procedure to be followed to identify the source of contamination in water samples using these tools. As example of representative results, analysis of viruses in ground water presenting high levels of nitrates is shown.
Detection of viruses in low or moderately polluted waters requires the concentration of the viruses from at least several liters of water into a much smaller volume, a procedure that usually includes two concentration steps in series. This somewhat cumbersome procedure and the variability observed in viral recoveries significantly hamper the simultaneous processing of a large number of water samples.
In order to eliminate the bottleneck caused by the two-step procedures we have applied a one-step protocol developed in previous studies and applicable to a diversity of water matrices. The procedure includes: acidification of ten-liter water samples, flocculation by skimmed milk, gravity sedimentation of the flocculated materials, collection of the precipitate and centrifugation, resuspension of the precipitate in 10 ml phosphate buffer. The viral concentrate is used for the extraction of viral nucleic acids and the specific adenoviruses and polyomaviruses of interest are quantified by qPCR. High number of samples may be simultaneously analyzed using this low-cost concentration method.
The procedure has been applied to the analysis of bathing waters, seawater and river water and in this study, we present results analyzing groundwater samples. This high-throughput quantitative method is reliable, straightforward, and cost-effective.

The study describes a cost-effective method for the identification of the source of fecal/urine contamination or contamination by nitrates in water using qPCR for the specific quantification of human/porcine/bovine DNA viruses, adenoviruses and polyomaviruses, proposed as MST tools.

Relação custo-benefício Método de Rastreamento Fonte microbiana, utilizando específicas Vírus Humano e Animal

Microbial contamination of the environment represents a significant health risk. Classical bacterial fecal indicators have shown to have significant ...

Imunologia e Infecção

Multiplex Detection of Bacteria in Complex Clinical and Environmental Samples using Oligonucleotide-coupled Fluorescent Microspheres

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated to a microbiota dominated by a number of bacterial species, including Gardnerella vaginalis, Atopobium vaginae, and others1-3. This condition is associated with a range of negative health outcomes, including HIV acquisition4, and it can be difficult to manage clinically5. Furthermore, diagnosis of BV has relied on the use of Gram stains of vaginal swab smears that are scored on various numerical criteria6,7. While this diagnostic is simple, inexpensive, and well suited to resource-limited settings, it can suffer from problems related to subjective interpretations and it does not give a detailed profile of the composition of the vaginal microbiota8. Recent deep sequencing efforts have revealed a rich, diverse vaginal microbiota with clear differences between samples taken from individuals that are diagnosed with BV compared to those individuals that are considered normal9,10, which has resulted in the identification of a number of potential targets for molecular diagnosis of BV11,12. These studies have provided a wealth of useful information, but deep sequencing is not yet practical as a diagnostic method in a clinical setting. We have recently described a method for rapidly profiling the vaginal microbiota in a multiplex format using oligonucleotide-coupled fluorescent beads with detection on a Luminex platform13. This method, like current Gram stain-based methods, is rapid and simple but adds the additional advantage of exploiting molecular knowledge arising from sequencing studies in probe design. This method therefore provides a way to profile the major microorganisms that are present in a vaginal swab that can be used to diagnose BV with high specificity and sensitivity compared to Gram stain while providing additional information on species presence and abundance in a semi-quantitative and rapid manner. This multiplex method is expandable well beyond the range of current quantitative PCR assays for particular organisms, which is currently limited to 5 or 6 different assays in a single sample14. Importantly, the method is not limited to the detection of bacteria in vaginal swabs and can be easily adapted to rapidly profile nearly any microbial community of interest. For example, we have recently begun to apply this methodology to the development of diagnostic tools for use in wastewater treatment plants.

We describe a multiplex method for the detection of microorganisms within a sample using oligonucleotide-coupled fluorescent beads. Amplicon from all organisms within a sample is hybridized to a panel of probe-coupled beads. A Luminex or Bio-Plex instrument is used to query each bead for bead type and hybridization signal.

Detecção de multiplex de bactérias em amostras clínicas e Complexo Ambiental utilizando Oligonucleotídeos-coupled microesferas fluorescentes

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated ...

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation into thousands of nano-sized water-in-oil individual reactions. Recently, ddPCR has become one of the most accurate and sensitive tools for circulating tumor DNA (ctDNA) detection. One of the major limitations of the standard ddPCR technique is the restricted number of mutations that can be screened per reaction, as specific hydrolysis probes recognizing each possible allelic version are required. An alternative methodology, the drop-off ddPCR, increases throughput, since it requires only a single pair of probes to detect and quantify potentially all genetic alterations in the targeted region. Drop-off ddPCR displays comparable sensitivity to conventional ddPCR assays with the advantage of detecting a greater number of mutations in a single reaction. It is cost-effective, conserves precious sample material, and can also be used as a discovery tool when mutations are not known a priori.

Here, we present a protocol to accurately quantify multiple genetic alterations of a target region in a single reaction using drop-off ddPCR and a unique pair of hydrolysis probes.

Reação em Cadeia da Polimerase Digital de Gota Única para Detecção Abrangente e Simultânea de Mutações em Regiões de Hotspot

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation ...

Genética

A Modified EPA Method 1623 that Uses Tangential Flow Hollow-fiber Ultrafiltration and Heat Dissociation Steps to Detect Waterborne Cryptosporidium and Giardia spp.

Cryptosporidium and Giardia species are two of the most prevalent protozoa that cause waterborne diarrheal disease outbreaks worldwide. To better characterize the prevalence of these pathogens, EPA Method 1623 was developed and used to monitor levels of these organisms in US drinking water supplies 12. The method has three main parts; the first is the sample concentration in which at least 10 L of raw surface water is filtered. The organisms and trapped debris are then eluted from the filter and centrifuged to further concentrate the sample. The second part of the method uses an immunomagnetic separation procedure where the concentrated water sample is applied to immunomagnetic beads that specifically bind to the Cryptosporidium oocysts and Giardia cysts allowing for specific removal of the parasites from the concentrated debris. These (oo)cysts are then detached from the magnetic beads by an acid dissociation procedure. The final part of the method is the immunofluorescence staining and enumeration where (oo)cysts are applied to a slide, stained, and enumerated by microscopy.
Method 1623 has four listed sample concentration systems to capture Cryptosporidium oocysts and Giardia cysts in water: Envirochek filters (Pall Corporation, Ann Arbor, MI), Envirochek HV filters (Pall Corporation), Filta-Max filters (IDEXX, Westbrook, MA), or Continuous Flow Centrifugation (Haemonetics, Braintree, MA). However, Cryptosporidium and Giardia (oo)cyst recoveries have varied greatly depending on the source water matrix and filters used1,14. A new tangential flow hollow-fiber ultrafiltration (HFUF) system has recently been shown to be more efficient and more robust at recovering Cryptosporidium oocysts and Giardia cysts from various water matrices; moreover, it is less expensive than other capsule filter options and can concentrate multiple pathogens simultaneously1-3,5-8,10,11. In addition, previous studies by Hill and colleagues demonstrated that the HFUF significantly improved Cryptosporidium oocysts recoveries when directly compared with the Envirochek HV filters4. Additional modifications to the current methods have also been reported to improve method performance. Replacing the acid dissociation procedure with heat dissociation was shown to be more effective at separating Cryptosporidium from the magnetic beads in some matrices9,13 .
This protocol describes a modified Method 1623 that uses the new HFUF filtration system with the heat dissociation step. The use of HFUF with this modified Method is a less expensive alternative to current EPA Method 1623 filtration options and provides more flexibility by allowing the concentration of multiple organisms.

A Modified EPA Method 1623 that Uses Tangential Flow Hollow-fiber Ultrafiltration and Heat Dissociation Steps to Detect Waterborne Cryptosporidium and Giardia spp.

This protocol describes the use of a tangential flow hollow-fiber ultrafiltration sample concentration system and a heat dissociation as alternative steps for the detection of waterborne Cryptosporidium and Giardia species using EPA Method 1623.

Uma variante do método EPA 1623 que usa fluxo tangencial ultrafiltração de fibra oca e Passos de calor de dissociação para detectar Waterborne<em&gt; Cryptosporidium</em&gt; E<em&gt; Giardia spp.</em

Cryptosporidium and Giardia species are two of the most prevalent protozoa that cause waterborne diarrheal disease outbreaks worldwide. To better ...

Capture of Environmental DNA (eDNA) from Water Samples by Flocculation

The analysis of environmental DNA (eDNA) has become a widely used approach to problem solving in species management. The detection of cryptic species including invasive and (or) species at risk is the goal, typically accomplished by testing water and sediment for the presence of characteristic DNA signatures. Reliable and efficient procedures for the capture of eDNA are required, especially those that can be performed easily in the field by personnel with limited training and citizen scientists. The capture of eDNA using membrane filtration is widely used currently. This approach has inherent issues that include the choice of filter material and porosity, filter fouling, and time required on site for the process to be performed. Flocculation offers an alternative that can be easily implemented and applied to sampling regimes that strive to cover broad territories in limited time.

Capture of Environmental DNA eDNA from Water Samples by Flocculation

Environmental DNA (eDNA) is typically captured from water samples using alcohol precipitation, filtration, or flocculation. Presented here is an alternative protocol that uses lanthanum chloride to enable collection of dissolved and particulate-bound nucleic acids from water samples containing eukaryotic cells, prokaryotic cells, and virus.

The analysis of environmental DNA (eDNA) has become a widely used approach to problem solving in species management. The detection of cryptic species ...

Development and Testing of Species-specific Quantitative PCR Assays for Environmental DNA Applications

New, non-invasive methods for detecting and monitoring species presence are being developed to aid in fisheries and wildlife conservation management. The use of environmental DNA (eDNA) samples for detecting macrobiota is one such group of methods that is rapidly becoming popular and being implemented in national management programs. Here we focus on the development of species-specific targeted assays for probe-based quantitative PCR (qPCR) applications. Using probe-based qPCR offers greater specificity than is possible with primers alone. Furthermore, the ability to quantify the amount of DNA in a sample can be useful in our understanding of the ecology of eDNA and the interpretation of eDNA detection patterns in the field. Careful consideration is needed in the development and testing of these assays to ensure the sensitivity and specificity of detecting the target species from an environmental sample. In this protocol we will delineate the steps needed to design and test probe-based assays for the detection of a target species; including creation of sequence databases, assay design, assay selection and optimization, testing assay performance, and field validation. Following these steps will help achieve an efficient, sensitive, and specific assay that can be used with confidence. We demonstrate this process with our assay designed for populations of the mucket (Actinonaias ligamentina), a freshwater mussel species found in the Clinch River, USA.

Environmental DNA assays require rigorous design, testing, optimization and validation before the collection of field data can begin. Here, we present a protocol to take users through each step of designing a species-specific, probe-based qPCR assay for the detection and quantification of a target species DNA from environmental samples.

Desenvolvimento e teste de ensaios quantitativos de PCR específicos para aplicações de DNA ambiental

New, non-invasive methods for detecting and monitoring species presence are being developed to aid in fisheries and wildlife conservation management. The ...

Foodborne Pathogen Screening Using Magneto-fluorescent Nanosensor: Rapid Detection of E. Coli O157:H7

Enterohemorrhagic Escherichia coli O157:H7 has been linked to both waterborne and foodborne illnesses, and remains a threat despite the food- and water-screening methods used currently. While conventional bacterial detection methods, such as polymerase chain reaction (PCR) and enzyme-linked immunosorbent assays (ELISA) can specifically detect pathogenic contaminants, they require extensive sample preparation and lengthy waiting periods. In addition, these practices demand sophisticated laboratory instruments and settings, and must be executed by trained professionals. Herein, a protocol is proposed for a simpler diagnostic technique that features the unique combination of magnetic and fluorescent parameters in a nanoparticle-based platform. The proposed multiparametric magneto-fluorescent nanosensors (MFnS) can detect E. coli O157:H7 contamination with as little as 1 colony-forming unit present in solution within less than 1 h. Furthermore, the ability of MFnS to remain highly functional in complex media such as milk and lake water has been verified. Additional specificity assays were also used to demonstrate the ability of MFnS to only detect the specific target bacteria, even in the presence of similar bacterial species. The pairing of magnetic and fluorescent modalities allows for the detection and quantification of pathogen contamination in a wide range of concentrations, exhibiting its high performance in both early- and late-stage contamination detection. The effectiveness, affordability, and portability of the MFnS make them an ideal candidate for point-of-care screening for bacterial contaminants in a wide range of settings, from aquatic reservoirs to commercially packaged foods.

Foodborne Pathogen Screening Using Magneto-fluorescent Nanosensor: Rapid Detection of E. Coli O157:H7

The overall goal of this protocol is to synthesize functional nanosensors for the portable, cost-effective, and rapid detection of specifically targeted pathogenic bacteria through a combination of magnetic relaxation and fluorescence emission modalities.

Patógeno de origem alimentar rastreio usando Nanosensor Magneto-fluorescente: Rápida detecção de Escherichia Coli O157: H7

Enterohemorrhagic Escherichia coli O157:H7 has been linked to both waterborne and foodborne illnesses, and remains a threat despite the food- and ...

Amplification of Escherichia coli in a Continuous-Flow-PCR Microfluidic Chip and Its Detection with a Capillary Electrophoresis System

Polymerase chain reaction (PCR) is a traditional method employed for the amplification of a target gene that has played an important role in biomolecular diagnostics. However, traditional PCR is very time-consuming because of the low-temperature variation efficiency. This work proposes a continuous-flow-PCR (CF-PCR) system based on a microfluidic chip. The amplification time can be greatly reduced by running the PCR solution into a microchannel placed on heaters set at different temperatures. Moreover, as capillary electrophoresis (CE) is an ideal way to differentiate positive and false-positive PCR products, a CE system was built to achieve efficient separation of the DNA fragments. This paper describes the process of amplification of Escherichia coli (E. coli) by the CF-PCR system built in-house and the detection of the PCR products by CE. The results demonstrate that the target gene of E. coli was successfully amplified within 10 min, indicating that these two systems can be used for the rapid amplification and detection of nucleic acids.

Amplification of Escherichia coli in a Continuous-Flow-PCR Microfluidic Chip and Its Detection with a Capillary Electrophoresis System

This protocol describes how to build a continuous-flow-polymerase chain system based on a microfluidic chip and how to build a capillary electrophoresis system in the lab. It presents a simple method for the analysis of nucleic acids in the lab.

Amplificação de Escherichia coli em um chip microfluídico de PCR em fluxo contínuo e sua detecção com um sistema de eletroforese capilar

Polymerase chain reaction (PCR) is a traditional method employed for the amplification of a target gene that has played an important role in biomolecular ...

Bioengenharia

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. coli O157:H7 by targeting ORF Z3276. With this assay, we can detect as low as a few copies of the genome of DNA of E. coli O157:H7. The sensitivity and specificity of the assay were confirmed by intensive validation tests with a large number of E. coli O157:H7 strains (n = 369) and non-O157 strains (n = 112). Furthermore, we have combined propidium monoazide (PMA) procedure with the newly developed qPCR protocol for selective detection of live cells from dead cells. Amplification of DNA from PMA-treated dead cells was almost completely inhibited in contrast to virtually unaffected amplification of DNA from PMA-treated live cells. Additionally, the protocol has been modified and adapted to a 96-well plate format for an easy and consistent handling of a large number of samples. This method is expected to have an impact on accurate microbiological and epidemiological monitoring of food safety and environmental source.

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A qPCR assay was developed for detection of Escherichia coli O157:H7 targeting a unique genetic marker, Z3276. The qPCR was combined with propidium monoazide (PMA) treatment for live cell detection. This protocol has been modified and adapted to a 96-well plate format for easy and consistent handling of numerous samples

Detecção de Vivo<em&gt; Escherichia coli</em&gt; O157: H7 Células por PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

Um ensaio de PCR Duplex Digital para a simultânea Quantificação da

Resumo

Explore mais vídeos

Capítulos neste vídeo