The authors have no acknowledgements.

1. Deney karışımı hazırlanması <ol><li> TE pH 8 tamponu tüm moleküler sınıf su içinde primer ve prob [Entero F1A, Entero R1, GPL813TQ 12 100 mol / L stok konsantrasyonları olun; HF183-1, BthetR1, BthetP1 3]. Not: iki hedef için sondalar floresan Malzemeleri / Ekipman Listesinde belirtildiği gibi farklı fluorophores 7 ile etiketlenir. </li><li> Planlı reaksiyon başına, karıştırarak 12 ul dijital PCR karışımı master karışımı hazırlayın, 0.216 ul ileriye her (2x stok, Malzeme / Ekipman listesi) ve astar, 0.06 ul her floresan prob ters ve nükleaz içermeyen su ul 5,016 (son konsantrasyon : 900 nM herbir primer, 250 nM her sonda). çözelti içinde hava kabarcıkları tanıtmak için dikkatli çekerken karışımı aşağı en az 10 kere pipet ve. </li><li> 6 ul DNA şablonunda karıştırma düzenli PCR tüp ya da plaka içine, (adım 1.2 dan itibaren) Pipet 18 ul ana karışımı (tarif Previou olarak çıkarılankurnaz 13) damlacık üretimi için tahlil karışım yapmak. nüsha halinde numune çalışıyorsa, pipet ana karışımı 36 ul ve her kuyuya 12 ul DNA şablonu. plaka üzerinde gelen çoğaltmak kuyu boş bırakın. Pozitif kumandaları (Malzeme / Ekipman Listesi) ve hiçbir şablon kumandaları (NTC) ekleyin (yani şablon olarak kullanılan moleküler sınıf su ile). Not: Pozitif kontrol deneyi düzgün çalıştığından emin olmak için gereklidir ve NTC plaka içinde herhangi bir kirlenme olmadığından emin olmak için ve veri analizi daha sonra floresan taban ayarlamak gerekir. İlk kez kullananlar hem sulandırılmamış ve seyreltilmiş DNA örnekleri kullanılması tavsiye edilir. </li></ol> 2. Damlacık Nesil ve PCR Plate Kurulumu <ol><li> Çok kanallı pipet kullanarak aşağı yaklaşık 15 kat kadar pipetleme tahlil karışımları karıştırın. pipet ucu karışımı içinde aşırı kabarcıklar yapmaktan kaçınmaya sıvı içinde kalır emin olun. </li><li> insert beyaz bir kartuş tutucu içine kartuşu 1 (içeren 8 kuyu) ve kartuş tutucu kapalı tıklayın. Kartuş 1 sıkıca yerinde şimdi ve damlacıklar üretirken sahibinden yerinden edilemez. Bir çok kanallı pipet kullanarak, yavaşça hava kabarcıkları tanıtan olmadan kartuş işaretli &#39;Örnek&#39; orta pozisyona tahlil karışımı 20 ul aktarın. </li><li> Pipetleyin kartuşunun sol tarafına damlacık oluşturma yağı 70 ul ( &#39;Petrol&#39; işaretli). </li><li> Bir conta conta, düz ve 4 ile eşit tutulan emin yapma kapak kartuş kartuşun kenarına doğru keneler. açın ve kartuşu yerleştirmek için damlacık jeneratör yeşil ışıklı düğmesine basın. Basın jeneratör kapatmak için düğmeye tekrar yeşil-lit. Not: Kapı kapanır sonra, düğmesi soluk, kapı yeniden açılamaz ve damlacık oluşturma hemen yaklaşık 1 dakika boyunca devam başlar. </li><li> bir saniye fazla 8 reaksiyonları, yer kartuş 2 yapıyor,damlacık oluşturma toplam kurulum zaman kazanmak için devam ederken, beyaz kartuş tutucu ve kartuş 1 ile aynı şekilde hazırlayın. </li><li> loş ışıklı buton damlacık nesil tamamlandığını belirten yeşile döndüğünde damlacık jeneratör kapağını açın. damlacık jeneratör üzerine beyaz kartuş 1 içeren kartuş tutucu, kenara, ve yer kartuşunu çıkarın 2. </li><li> kartuşun 1 contayı çıkarın ve atın. Yavaşça ısıl çevrimden (oda sıcaklığında muhafaza edilen) son bir PCR plaka üzerine kartuş ( &#39;damlacıklar&#39; işaretli) üçüncü sütunda elde edilen damlacıkların toplam hacmi (yaklaşık 40 ul) aktarın. Not: Yeni oluşturulan damlacıkların kırılabilir eylem olarak beyaz kartuşu yuvasını unclick etmeyin; damlacıkları son plakasına aktarıldıktan sonra sadece kartuş yuvasını açın. </li><li> Tekrarlayın ek örnekler için 2,1-2,7 adımları. </li><li> Bütün damlacıklar, nihai PCR plaka olduğu zaman, bir delinebilir yerplaka üzerine folyo kapağı ve bir plaka kapatıcı üzerine yerleştirin. mühürleyen 180 ° C, basın &#39;Play&#39; ile mühürleyen ayarlayın ve 10 saniye boyunca mühür verelim. </li></ol> 3. Termal Bisiklet ve Damlacık Okuma <ol><li> termal döngü sızdırmaz plakasını, aşama 2.7&#39;de kullanılan nihai PCR plaka ve 2.0 ° C / saniyenin altındaki bir ısı rampa hızı ile uyumlu olan bir. </li><li> şu şekilde ısı programı çalıştırmak: 10 dakika tutuldu, ardından 94 ° C&#39;de 30 saniye 40 döngü, ardından 95 ° C&#39;de 10 dakika ve 60 ° C&#39;de 60 saniye, isteğe 98 ° C&#39;de (en: son tutma 4 ° C&#39;de ya da 15 ° C). </li><li> bisiklet tamamlanması üzerine, her bir her bir damlacık floresans otomatik olarak belirlenmesi için, bir damlacık Reader plaka aktarın. Seçenek olarak ise, damlacık okuma önce 3 gün süreyle 4 ° C&#39;de plaka saklayın. damlacıklar okuma ile devam etmeden önce oda sıcaklığında olduğundan emin olun. <ol><li> kurulum damlacık okuma eşlik yazılımını açın. İçinde&#39;Örnek&#39;, &#39;Deney 1&#39; ve &#39;Deney 2.&#39;: Boş 96 plaka bir şemasını içeren varsayılan &#39;Ayarlar&#39; menüsü, çift, üç bölümden içeren bir menüyü açmak için de A1 tıklayın </li><li> &#39;Örnek&#39; bölümündeki &#39;Adı&#39; ve enter tuşuna basın veya işaretli sağa onay kutusunu etiketli kutunun içine örnek kimliğini yazın &#39;uygulayın.&#39; Sonraki menü etiketli &#39;Deney&#39; açılır tıklayın ve &#39;KIRMIZI&#39; (nadir bir olay algılama) seçin ve girin tıklayın. </li><li> &#39;Deney 1.&#39; belirtilen bölüme taşıyın &#39;Ad&#39; bölümünde tahlili (örneğin Enterococcus) doldurun ve girin tıklayın. etiketli &#39;Türü&#39; aşağıdaki kutuya açılır menüyü tıklayın ve &#39;Kanal Bilinmeyen 1&#39; seçin ve girin tıklayın. </li><li> &#39;Deney 2.&#39; belirtilen bölüme taşıyın &#39;Ad&#39; bölümünde tahlili (örn HF183) doldurun ve girin tıklayın. etiketli &#39;Türü&#39; aşağıdaki kutuya menü açılır tıklayın&#39;Kanal Bilinmeyen 2&#39; seçin ve girin tıklayın d. 3.3.4 3.3.2 şimdi Adımlar tüm bilgiler A1 kuyusunda sunuyoruz. </li><li> damlacıkları içeren sonraki tüm kuyu adı. toplam kurulum Zaman kazanmak için, aynı anda birden fazla kuyu seçmek için &#39;Shift&#39; veya &#39;Ctrl&#39; tıklayın. </li><li> plaka dijital tasviri menüsünün sağ alt köşesinde fiziksel plaka, &#39;Tamam&#39;a basın aynalar zaman. &#39;Şablon&#39; bölümünde plaka şematik üst kısmında görünen yeni menüsünde, &#39;Farklı Kaydet&#39; ve adını seçin ve plaka kaydedin. </li><li> Ekranın solunda &#39;Çalıştır&#39; ı tıklatın ve pop-out &quot;Run Seçenekleri&quot; penceresinde uygun boya Set seçin. Veri toplama başlatır ve yazılım gerçek zamanlı olarak görüntülenir. </li></ol></li></ol> 4. Veri Analiz ve Raporlama <ol><li> okuyucu bitti ve bir kutu &#39;Tam Run&#39; belirterek göründüğünde, &#39;Tamam&#39; ı tıklatın. Not: Yumuşakware yazılım &#39;Analiz&#39; bölümünün altında son veri dosyasını görüntüler. Bu görüşe göre, yazılım &#39;2B Genlik&#39; veri arsa seçilen tüm plaka kuyular ve varsayılan vardır. </li><li> Pozitif ve negatif damlacıklar arasındaki mesafeyi kontrol edin. NTC kuyularda tüm damlacıkları floresan başlangıca yakın olduğundan emin olun. </li><li> etiketli butonuna tıklayın &#39;Olaylar.&#39; sunulan histogramın sağındaki &#39;Toplam&#39; adlı kutu ve başına kabul görmüş damlacıkların toplam sayısını görüntülemek için alt kısımdaki &quot;tek&quot; adlı kutusunu tıklatın. Ctrl tuşunu basılı tutarak ve hariç tutulacak kuyu (ler) üzerine tıklayarak &lt;10.000 damlacıkları 7 içeren herhangi bir kuyu hariç. </li><li> Her iki hedefler için NTC kuyularda olumsuz damlacıklar üzerinde yaklaşık bir standart sapma (500-700 floresan birimleri) floresan eşik ayarlamak için &#39;1D Genlik&#39; olarak ifade butonuna tıklayın. Ekran un çok sol atİki eşik düğmelerini gösteren &#39;Otomatik Analiz&#39; üzerinden çalışan bir katı pembe yatay çizgi vardır sağdaki simgeyi seçin der. </li><li> genlik grafikleri her birinin altında &#39;Set Eşik&#39; Solundaki kutuya tıklayın ve uygun floresan eşik değerleri girin. ul reaksiyon başına kopya hedef konsantrasyonları daha sonra otomatik olarak hesaplanır. Not: eşikleri farklı hedefler için aynı olması gerekmez. </li><li> 1D Genlik ekranın sol üst köşesindeki &#39;Export&#39; düğmesini tıklayarak bir .csv dosyasına sonuçları ihracat. .csv Dosyası, DNA şablonuna ul başına hedef kopyalamak için ul reaksiyon başına hedefin kopyası (Enterococcus spp 23S geni. Veya HF183 işaretleyici) onu dönüştürmek için 4 tarafından ihraç edilen hedef konsantrasyon çarpın. </li></ol>

<ol>
	<li>Boehm, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+forty-one+microbial+source+tracking+methods:+A+twenty-seven+lab+evaluation+study.">Performance of forty-one microbial source tracking methods: A twenty-seven lab evaluation study.</a> Water Res. 47 (18), 6812-6828 (2013).</li><li>Layton, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+human+fecal+anaerobe-associated+PCR-based+assays+in+a+multi-laboratory+method+evaluation+study.">Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study.</a> Water Res. 47 (18), 6897-6908 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+platform,+reference+material,+and+quantification+model+on+enumeration+of+Enterococcus+by+quantitative+PCR+methods.">Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods.</a> Water Res. 47 (1), 233-241 (2013).</li><li>Sivaganesan, M., Siefring, S., Varma, M., Haugland, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MPN+estimation+of+qPCR+target+sequence+recoveries+from+whole+cell+calibrator+samples.">MPN estimation of qPCR target sequence recoveries from whole cell calibrator samples.</a> J. Microbiol. Methods. 87 (3), 343-349 (2011).</li><li>Huggett, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Digital+MIQE+Guidelines:+Minimum+Information+for+Publication+of+Quantitative+Digital+PCR+Experiments.">The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments.</a> Clin. Chem. 59 (6), 892-902 (2013).</li><li>Cao, Y., Raith, M. R., Griffith, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+digital+PCR+for+simultaneous+quantification+of+general+and+human-associated+fecal+indicators+for+water+quality+assessment.">Droplet digital PCR for simultaneous quantification of general and human-associated fecal indicators for water quality assessment.</a> Water Res. 70, 337-349 (2015).</li><li>Sanders, R., Huggett, J. F., Bushell, C. A., Cowen, S., Scott, D. J., Foy, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+Digital+PCR+for+Absolute+DNA+Quantification.">Evaluation of Digital PCR for Absolute DNA Quantification.</a> Anal. Chem. 83 (17), 6474-6484 (2011).</li><li>Whale, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+microfluidic+digital+PCR+and+conventional+quantitative+PCR+for+measuring+copy+number+variation.">Comparison of microfluidic digital PCR and conventional quantitative PCR for measuring copy number variation.</a> Nucleic Acid Res. 40 (11), 82-89 (2012).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nature Methods. 10 (10), 1003-1005 (2013).</li><li>Morisset, D., &#352;tebih, D., Milavec, M., Gruden, K., &#381;el, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+food+and+feed+aamples+with+droplet+digital+PCR.">Quantitative analysis of food and feed aamples with droplet digital PCR.</a> PLoS One. 8 (5), e62583 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+molecular+community+analysis+methods+for+discerning+fecal+sources+and+human+waste.">Evaluation of molecular community analysis methods for discerning fecal sources and human waste.</a> Water Res. 47 (18), 6862-6872 (2013).</li></ol>

The authors declare that they have no competing financial interests.

protokolde birkaç kritik adımlar vardır. Ana Karışım, geleneksel qPCR ana karışımları daha viskoz olduğundan ilk deney karışımları karıştırılması zor olabilir. Basit vorteksleme da deney karışımları ve daha sonra damlacıklar DNA şablonları eşit olmayan dağılımına neden olur yeterli karıştırma, neden olabilir. protokol açıklanan karıştırma-by-pipetleme tekniği doğru dPCR ölçümünü sağlamak için takip edilmelidir. İkinci olarak, damlacıklar tek yapılı bir şekle ve boyut...

daha hızlı, daha esnek ve geleneksel kültür temelli yöntemlerle karşılaştırıldığında özel çünkü kantitatif PCR (qPCR) yöntemleri yaygın eğlence su kalitesi izleme ve mikrobiyal kaynak takibi uygulamalarında kullanılmaktadır. Sonuç olarak, qPCR gibi Enterococcus spp gibi genel fekal göstergeler için hızlı su izleme sonuçları elde etmek için tavsiye edilir. Revize USEPA eğlence su kalite kriterleri 1. Birçok qPCR deneyleri de geliştirilmiş ve çevresel sularda 2 fekal kontaminasyon kaynaklarının belirlenmesi için onaylanmıştır. Bunlar arasında, HF183 işaretleyici deneyleri en sık insan ilişkili fekal kontaminasyonu 3 tanımlamak için kullanılan arasındadır. onlar ölçümü için standart eğriler güveniyor Ancak, qPCR sonuçlar genellikle önyargılı olabilir. qPCR bir stan kendi ölçümü döngüsünü (Cq) enterpolasyonlayarak örneklerinde hedefin bilinmeyen konsantrasyonlarını rakamlarlaCq ve seri seyreltilmiş standartların bir dizi logaritmik miktarı arasında doğrusal bir ilişki açıklanır dart eğrisi. güvenilir ve tutarlı standart referans malzeme eksikliği dolayısıyla büyük ölçüde qPCR sonuçlarını taraflı olabilir. Çalışmalar qPCR sonuçları farklı satıcılardan 4 yaklaşık yarım günlük kullanarak standartlarına göre farklılık ve aynı satıcıdan 5&#39;ten standartların farklı toplu kullanarak 2 kat ile gösterdi. Dijital PCR (dPCR) teknolojisi üniforma Nanoliter veya pikolitrelik reaksiyonlar 6 binlerce ya da milyonlarca içine toplu qPCR bölümleme tarafından oluşturulan minyatür PCR&#39;ler çok sayıda pozitif sıklığını sayarak bilinmeyen bir örnek rakamlarla. Bölmeler-içinde-su yağ damlacıkları (örneğin, bu makale) ya da çip küçük fonksiyonlu odalar olması durumunda bu, sırası ile (yani, bu makale) damlacık dijital PCR veya odası, dijital PCR olarak ifade edilir. Daha yüksek bir Örnek konsantrasyonu hedef DNA&#39;nın mevcudiyetinde sonuçlanırbölümleri daha yüksek bir oranda (dolayısıyla pozitif PCR), Poisson dağılımı ile yaklaştırılır bir ilişki. Bu nedenle, ikili sonuçlar (pozitif ya da negatif PCR) kaydedilir ve pozitif damlacıkların frekansı qPCR olarak standart bir eğri olan ihtiyacı ortadan kaldırarak, doğrudan Poisson yaklaşım ile bilinmeyen numune konsantrasyonları hesaplamak için kullanılır. Dijital PCR nicelikleme Bu ikili doğası qPCR 7 üzerinde ek avantajlar sağlamaktadır. gecikmiş amplifikasyon hala olumlu bir PCR sağlayabilir, çünkü dPCR miktar amplifikasyon verimliliği azaltır inhibisyonuna karşı daha sağlamdır. QPCR 8-10 göre dPCR yüksek hassasiyet yol qPCR olarak Benzer şekilde, dPCR miktar Cq değerleri değişkenlik etkilenmez. Buna ek olarak, bölme işlemi etkin bir şekilde amplificatio sırasında (alt-tabaka rekabet en aza indirerek, her damla hedef DNA mevcut çok az miktarda sağlanırqPCR (yani bir tahlil aynı anda iki DNA hedefleri ölçen) duplekslemeyi ulaşmak için ortak engeller farklı DNA hedefleri) n. Bu nedenle, dubleks veya simpleks çalışma (yani bir hedef, tek bir deneyde ölçülen) olmadığını dPCR her iki hedeflerin 7,11 neredeyse ayırt edilemez miktarının üretir. Bu makalede açıklanan dijital PCR deneyi (EntHF183 dPCR) amacı, genel dışkı göstergesi Enterococcus spp Eş zamanlı miktarının elde etmektir. Ve geliştirilmiş hassasiyet, tekrarlanabilirlik ve inhibisyonuna karşı sağlamlığı olan insan dışkı ilişkili HF183 markör olarak qPCR karşılaştırıldığında uzantılarıdır. Bu deney, başarılı bir şekilde, çevresel tatlı su, deniz suyu ve çeşitli dışkı maddesinin 7 dışkı kirlenme ölçülmesi için kullanılmıştır, ama aynı zamanda suları ve atık suların bir diğer türlerine de uygulanabilir. Bu tahlil, kendisine bağlı tortuları veya topraklar analiz etmek için büyük söz sahibidirinhibisyonuna yüksek tolerans s, ancak inhibitör örnekleri, bu tür karışımlar daha fazla test için karmaşıklığı gereklidir.

<table><tbody><tr><td>Low Bind Microtubes</td><td>Costar</td><td>3207</td><td>For storage of reagents, samples/production of master mixes</td></tr><tr><td>Nuclease Free Water</td><td>FisherSci</td><td>BP2484-50</td><td></td></tr><tr><td>TE pH 8 buffer</td><td>FisherSci</td><td>BP2473-100</td><td></td></tr><tr><td>Hardshell 96 Well Plate</td><td>BioRad</td><td>HSP-9601</td><td>For initial master mix and sample inoculation</td></tr><tr><td>Aluminum Sealing Film</td><td>BioRad</td><td>359-0133</td><td>To seal sample plate</td></tr><tr><td>Droplet Generator</td><td>BioRad</td><td>186-3002</td><td></td></tr><tr><td>Droplet Generation Oil</td><td>BioRad</td><td>186-3005</td><td></td></tr><tr><td>Cartridge</td><td>BioRad</td><td>186-4008</td><td></td></tr><tr><td>DG8 Cartridge Holder</td><td>BioRad</td><td>186-3051</td><td></td></tr><tr><td>Gasket</td><td>BioRad</td><td>186-3009</td><td></td></tr><tr><td>20 &amp;#956;l pipet tips</td><td>Rainin</td><td>GP-L10F</td><td>For tansferring sample/master mix to cartidge</td></tr><tr><td>200 &amp;#956;l pipet tips</td><td>Rainin</td><td>GP-L200F</td><td>For transferring droplets to final Twin.Tec Plate</td></tr><tr><td>Twin.Tec 96 Well Plate</td><td>Eppendorf</td><td>951020320</td><td>For final droplets thermal cycling and reading</td></tr><tr><td>Pierceable Heat Seal Foil</td><td>BioRad</td><td>181-4040</td><td>To seal Twin.Tec plate before thermalcycling</td></tr><tr><td>PX1 PCR Plate Sealer</td><td>BioRad</td><td>181-4000</td><td></td></tr><tr><td>CFX96 Thermalcycler</td><td>BioRad</td><td>CFX96 and C1000</td><td>Only the thermal cycler is needed, no optics</td></tr><tr><td>QX100 Droplet Reader</td><td>BioRad</td><td>186-3001</td><td></td></tr><tr><td>Droplet Reader Oil</td><td>BioRad</td><td>186-3004</td><td></td></tr><tr><td>Droplet PCR Supermix&amp;nbsp;</td><td>BioRad</td><td>186-3024</td><td>&lt;em&gt;i.e.&lt;/em&gt; the digital PCR mix in manuscript</td></tr><tr><td>QuantaSoft software (v1.3.2)</td><td>Quantasoft&amp;nbsp;</td><td>QX100&amp;nbsp;</td><td>For viewing, analyzing, and exporting ddPCR data</td></tr><tr><td>Entero Forward Primer (Ent F1A)</td><td>Operon</td><td>GAGAAATTCCAAACGAACTTG</td><td>Alternative vendor can be used</td></tr><tr><td>Entero Reverse Primer (Ent R1)</td><td>Operon</td><td>CAGTGCTCTACCTCCATCATT</td><td>Alternative vendor can be used</td></tr><tr><td>Entero Probe (GPL813TQ)</td><td>Operon</td><td>[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]</td><td>Alternative vendor can be used, but the florophore has to be FAM</td></tr><tr><td>HF183 Forward Primer (HF183-1)</td><td>Operon</td><td>ATCATGAGTTCACATGTCCG</td><td>Alternative vendor can be used</td></tr><tr><td>HF183 Reverse Primer (BthetR1)</td><td>Operon</td><td>CGTAGGAGTTTGGACCGTGT</td><td>Alternative vendor can be used</td></tr><tr><td>HF183 Probe (BthetP1)</td><td>Operon</td><td>[6-HEX]-CTGAGAGGAAGGTCCCCC&lt;br/&gt; ACATTGGA-[BHQ1]</td><td>Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.&amp;nbsp;</td></tr><tr><td>Positive control</td><td></td><td></td><td>Mixture of &lt;em&gt;E. faecalis&lt;/em&gt; genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing &lt;em&gt;E. faecalis&lt;/em&gt; and sequences of the ordered HF183 plasmid, please see Cao &lt;em&gt;et al.&lt;/em&gt; 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available &lt;em&gt;Enterococcus&lt;/em&gt; DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared &lt;em&gt;E. faecalis&lt;/em&gt; genomic DNA.</td></tr></tbody></table>

a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters

Bu yazının Enterococcus spp eşzamanlı ölçümü. Ve insan fekal-ilişkili HF183 işaretleyici için bir dubleks dijital PCR testi (EntHF183 dPCR) açıklar. EntHF183 dubleks dPCR (EntHF183 dPCR olarak anılacaktır buradan sonra) deneyi yayınlanmış bireysel kantitatif PCR (qPCR) meslektaşlarıyla aynı primer ve prob dizileri kullanır. Aynı şekilde, önce qPCR uygulandı aynı su filtreleme ve DNA ekstraksiyon prosedürleri dPCR çalıştırmadan önce takip edilmektedir. Ancak, dubleks dPCR tahlil qPCR deneyleri üzerinde birçok avantajı vardır. En önemlisi, dPCR tahlil hedefleri doğrudan ölçümü ile dolayısıyla standart bir eğri çalışan ve ihtiyacını, ilgili önyargı ve değişkenliği, ortadan kaldırır. QPCR (yani eşzamanlı kantifikasyon) enterokokların ve HF183 arkalı önlü ise ek olarak, çoğu kez bir numunede daha az bol hedefin ciddi küçümsenmesi yol açar, dPCR hem hedeflerin tutarlı ölçümü sağlar, uyandırmakona aynı reaksiyonda eş zamanlı olarak tek başına ya da miktarı. dPCR deneyi de qPCR tolere daha yüksek büyüklükte bir ya da iki emirler PCR inhibitörü konsantrasyonları tolere edebilmektedir. aynı anda iki ayrı qPCR deneyleri çalıştırmak için gerek kalmadan çevre sularda hem genel hem de insan-ilişkili fekal kontaminasyon doğru ve tekrarlanabilir bilgi sağlar, çünkü bu avantajlar EntHF183 dPCR tahlil özellikle çekici olun. qPCR üzerindeki avantajlara rağmen, şu anda mevcut cihaz olan dPCR deneyinde üst miktar sınırı yaklaşık qPCR elde edilebilenden daha düşük bir magnitüd dört işlemlerdir. Sonuç olarak, seyreltme, tipik pis su sızıntıları ardından gözlenen hedef organizmaların yüksek konsantrasyonlarının ölçümü için gereklidir.

İyi bir EntHF183 dupleks dPCR çalıştırma kabul damlacıklar (yaklaşık 10,000-17,000) ve negatif ve pozitif damlacıklar 7 floresans değerleri arasında nispeten daha büyük bir fark (yaklaşık 5.000) nispeten yüksek sayıda neden olmalıdır. damlaların alışılmadık az sayıda büyük olasılıkla damlacık oluşturma sürecinde sorunları gösterir ve 10.000 damlacıkların bir kesim bu makalede kullanılan damlacık dPCR sisteminden ampirik v...

Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Bu yazıda, aynı anda Enterococcus spp ölçmek için kullanılabilecek bir çift yönlü dijital PCR deneyi. Ve eğlence sularda genel olarak insan ilişkili dışkı kirlenme göstergeleri olarak HF183 genetik işaretleyiciler açıklanmaktadır.

Eşzamanlı Niceleme için Dubleks Dijital PCR Testi<em&gt; Enterococcus spp.</em&gt; Ve Waters İnsan Fekal ilişkili HF183 Marker

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated ...

a-duplex-digital-pcr-assay-for-simultaneous-quantification

Research

JoVE Journal

Environment

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

9.7K Görüntüleme.  Southern California Costal Water Research Project Authority.  Bu yazıda, aynı anda Enterococcus spp ölçmek için kullanılabilecek bir çift yönlü dijital PCR deneyi. Ve eğlence sularda genel olarak insan ilişkili dışkı kirlenme göstergeleri olarak HF183 genetik işaretleyiciler açıklanmaktadır. 

Video: A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. Part III. Virus Detection by RT-qPCR

EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. This method was developed with the goal of having a standardized method for use in multiple analytical laboratories during monitoring period 3 of the Unregulated Contaminant Monitoring Rule. Herein we present the protocol for extraction of viral ribonucleic acid (RNA) from water sample concentrates and for quantitatively measuring enterovirus and norovirus concentrations using reverse transcription-quantitative PCR (RT-qPCR). Virus concentrations for the molecular assay are calculated in terms of genomic copies of viral RNA per liter based upon a standard curve. The method uses a number of quality controls to increase data quality and to reduce interlaboratory and intralaboratory variation. The method has been evaluated by examining virus recovery from ground and reagent grade waters seeded with poliovirus type 3 and murine norovirus as a surrogate for human noroviruses. Mean poliovirus recoveries were 20% in groundwaters and 44% in reagent grade water. Mean murine norovirus recoveries with the RT-qPCR assay were 30% in groundwaters and 4% in reagent grade water.

Here we present a procedure to quantify enterovirus and norovirus in environmental and drinking waters using reverse transcription-quantitative PCR. Mean virus recovery from groundwater with this standardized procedure from EPA Method 1615 was 20% for poliovirus and 30% for murine norovirus.

Enterovirüs Kültür ve RT-qPCR Su Norovirus Oluşum EPA Method 1615 Ölçümü. Bölüm III. RT-qPCR Virüs Algılama

EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. This method was developed with the goal of having a ...

Çevre

Cost-effective Method for Microbial Source Tracking Using Specific Human and Animal Viruses

Microbial contamination of the environment represents a significant health risk. Classical bacterial fecal indicators have shown to have significant limitations, viruses are more resistant to many inactivation processes and standard fecal indicators do not inform on the source of contamination. The development of cost-effective methods for the concentration of viruses from water and molecular assays facilitates the applicability of viruses as indicators of fecal contamination and as microbial source tracking (MST) tools. Adenoviruses and polyomaviruses are DNA viruses infecting specific vertebrate species including humans and are persistently excreted in feces and/or urine in all geographical areas studied. In previous studies, we suggested the quantification of human adenoviruses (HAdV) and JC polyomaviruses (JCPyV) by quantitative PCR (qPCR) as an index of human fecal contamination. Recently, we have developed qPCR assays for the specific quantification of porcine adenoviruses (PAdV) and bovine polyomaviruses (BPyV) as animal fecal markers of contamination with sensitivities of 1-10 genome copies per test tube. In this study, we present the procedure to be followed to identify the source of contamination in water samples using these tools. As example of representative results, analysis of viruses in ground water presenting high levels of nitrates is shown.
Detection of viruses in low or moderately polluted waters requires the concentration of the viruses from at least several liters of water into a much smaller volume, a procedure that usually includes two concentration steps in series. This somewhat cumbersome procedure and the variability observed in viral recoveries significantly hamper the simultaneous processing of a large number of water samples.
In order to eliminate the bottleneck caused by the two-step procedures we have applied a one-step protocol developed in previous studies and applicable to a diversity of water matrices. The procedure includes: acidification of ten-liter water samples, flocculation by skimmed milk, gravity sedimentation of the flocculated materials, collection of the precipitate and centrifugation, resuspension of the precipitate in 10 ml phosphate buffer. The viral concentrate is used for the extraction of viral nucleic acids and the specific adenoviruses and polyomaviruses of interest are quantified by qPCR. High number of samples may be simultaneously analyzed using this low-cost concentration method.
The procedure has been applied to the analysis of bathing waters, seawater and river water and in this study, we present results analyzing groundwater samples. This high-throughput quantitative method is reliable, straightforward, and cost-effective.

The study describes a cost-effective method for the identification of the source of fecal/urine contamination or contamination by nitrates in water using qPCR for the specific quantification of human/porcine/bovine DNA viruses, adenoviruses and polyomaviruses, proposed as MST tools.

Özgül İnsan ve Hayvan Virüsler Mikrobiyal Kaynak Takip için maliyet-etkin Yöntemi

Microbial contamination of the environment represents a significant health risk. Classical bacterial fecal indicators have shown to have significant ...

İmmünoloji ve Enfeksiyon

Multiplex Detection of Bacteria in Complex Clinical and Environmental Samples using Oligonucleotide-coupled Fluorescent Microspheres

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated to a microbiota dominated by a number of bacterial species, including Gardnerella vaginalis, Atopobium vaginae, and others1-3. This condition is associated with a range of negative health outcomes, including HIV acquisition4, and it can be difficult to manage clinically5. Furthermore, diagnosis of BV has relied on the use of Gram stains of vaginal swab smears that are scored on various numerical criteria6,7. While this diagnostic is simple, inexpensive, and well suited to resource-limited settings, it can suffer from problems related to subjective interpretations and it does not give a detailed profile of the composition of the vaginal microbiota8. Recent deep sequencing efforts have revealed a rich, diverse vaginal microbiota with clear differences between samples taken from individuals that are diagnosed with BV compared to those individuals that are considered normal9,10, which has resulted in the identification of a number of potential targets for molecular diagnosis of BV11,12. These studies have provided a wealth of useful information, but deep sequencing is not yet practical as a diagnostic method in a clinical setting. We have recently described a method for rapidly profiling the vaginal microbiota in a multiplex format using oligonucleotide-coupled fluorescent beads with detection on a Luminex platform13. This method, like current Gram stain-based methods, is rapid and simple but adds the additional advantage of exploiting molecular knowledge arising from sequencing studies in probe design. This method therefore provides a way to profile the major microorganisms that are present in a vaginal swab that can be used to diagnose BV with high specificity and sensitivity compared to Gram stain while providing additional information on species presence and abundance in a semi-quantitative and rapid manner. This multiplex method is expandable well beyond the range of current quantitative PCR assays for particular organisms, which is currently limited to 5 or 6 different assays in a single sample14. Importantly, the method is not limited to the detection of bacteria in vaginal swabs and can be easily adapted to rapidly profile nearly any microbial community of interest. For example, we have recently begun to apply this methodology to the development of diagnostic tools for use in wastewater treatment plants.

We describe a multiplex method for the detection of microorganisms within a sample using oligonucleotide-coupled fluorescent beads. Amplicon from all organisms within a sample is hybridized to a panel of probe-coupled beads. A Luminex or Bio-Plex instrument is used to query each bead for bead type and hybridization signal.

Oligonükleotid çiftli Floresan Mikroküreler kullanarak Kompleksi Klinik ve Çevre Örneklerinde Bakterilerin Multiplex Algılama

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated ...

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation into thousands of nano-sized water-in-oil individual reactions. Recently, ddPCR has become one of the most accurate and sensitive tools for circulating tumor DNA (ctDNA) detection. One of the major limitations of the standard ddPCR technique is the restricted number of mutations that can be screened per reaction, as specific hydrolysis probes recognizing each possible allelic version are required. An alternative methodology, the drop-off ddPCR, increases throughput, since it requires only a single pair of probes to detect and quantify potentially all genetic alterations in the targeted region. Drop-off ddPCR displays comparable sensitivity to conventional ddPCR assays with the advantage of detecting a greater number of mutations in a single reaction. It is cost-effective, conserves precious sample material, and can also be used as a discovery tool when mutations are not known a priori.

Here, we present a protocol to accurately quantify multiple genetic alterations of a target region in a single reaction using drop-off ddPCR and a unique pair of hydrolysis probes.

Tek damlacık dijital polimeraz zincir tepkimesi mutasyonlar Hotspot bölgelerde kapsamlı ve eşzamanlı algılanması için

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation ...

Genetik

A Modified EPA Method 1623 that Uses Tangential Flow Hollow-fiber Ultrafiltration and Heat Dissociation Steps to Detect Waterborne Cryptosporidium and Giardia spp.

Cryptosporidium and Giardia species are two of the most prevalent protozoa that cause waterborne diarrheal disease outbreaks worldwide. To better characterize the prevalence of these pathogens, EPA Method 1623 was developed and used to monitor levels of these organisms in US drinking water supplies 12. The method has three main parts; the first is the sample concentration in which at least 10 L of raw surface water is filtered. The organisms and trapped debris are then eluted from the filter and centrifuged to further concentrate the sample. The second part of the method uses an immunomagnetic separation procedure where the concentrated water sample is applied to immunomagnetic beads that specifically bind to the Cryptosporidium oocysts and Giardia cysts allowing for specific removal of the parasites from the concentrated debris. These (oo)cysts are then detached from the magnetic beads by an acid dissociation procedure. The final part of the method is the immunofluorescence staining and enumeration where (oo)cysts are applied to a slide, stained, and enumerated by microscopy.
Method 1623 has four listed sample concentration systems to capture Cryptosporidium oocysts and Giardia cysts in water: Envirochek filters (Pall Corporation, Ann Arbor, MI), Envirochek HV filters (Pall Corporation), Filta-Max filters (IDEXX, Westbrook, MA), or Continuous Flow Centrifugation (Haemonetics, Braintree, MA). However, Cryptosporidium and Giardia (oo)cyst recoveries have varied greatly depending on the source water matrix and filters used1,14. A new tangential flow hollow-fiber ultrafiltration (HFUF) system has recently been shown to be more efficient and more robust at recovering Cryptosporidium oocysts and Giardia cysts from various water matrices; moreover, it is less expensive than other capsule filter options and can concentrate multiple pathogens simultaneously1-3,5-8,10,11. In addition, previous studies by Hill and colleagues demonstrated that the HFUF significantly improved Cryptosporidium oocysts recoveries when directly compared with the Envirochek HV filters4. Additional modifications to the current methods have also been reported to improve method performance. Replacing the acid dissociation procedure with heat dissociation was shown to be more effective at separating Cryptosporidium from the magnetic beads in some matrices9,13 .
This protocol describes a modified Method 1623 that uses the new HFUF filtration system with the heat dissociation step. The use of HFUF with this modified Method is a less expensive alternative to current EPA Method 1623 filtration options and provides more flexibility by allowing the concentration of multiple organisms.

A Modified EPA Method 1623 that Uses Tangential Flow Hollow-fiber Ultrafiltration and Heat Dissociation Steps to Detect Waterborne Cryptosporidium and Giardia spp.

This protocol describes the use of a tangential flow hollow-fiber ultrafiltration sample concentration system and a heat dissociation as alternative steps for the detection of waterborne Cryptosporidium and Giardia species using EPA Method 1623.

Su bazlı Algılamak için Teğet Akış Hollow-fiber Ultrafiltrasyon ve Isı Disosiyasyon Adımlar kullanır A Modifiye EPA Method 1623<em&gt; Cryptosporidium</em&gt; Ve<em&gt; Giardia spp.</em

Cryptosporidium and Giardia species are two of the most prevalent protozoa that cause waterborne diarrheal disease outbreaks worldwide. To better ...

Capture of Environmental DNA (eDNA) from Water Samples by Flocculation

The analysis of environmental DNA (eDNA) has become a widely used approach to problem solving in species management. The detection of cryptic species including invasive and (or) species at risk is the goal, typically accomplished by testing water and sediment for the presence of characteristic DNA signatures. Reliable and efficient procedures for the capture of eDNA are required, especially those that can be performed easily in the field by personnel with limited training and citizen scientists. The capture of eDNA using membrane filtration is widely used currently. This approach has inherent issues that include the choice of filter material and porosity, filter fouling, and time required on site for the process to be performed. Flocculation offers an alternative that can be easily implemented and applied to sampling regimes that strive to cover broad territories in limited time.

Capture of Environmental DNA eDNA from Water Samples by Flocculation

Environmental DNA (eDNA) is typically captured from water samples using alcohol precipitation, filtration, or flocculation. Presented here is an alternative protocol that uses lanthanum chloride to enable collection of dissolved and particulate-bound nucleic acids from water samples containing eukaryotic cells, prokaryotic cells, and virus.

The analysis of environmental DNA (eDNA) has become a widely used approach to problem solving in species management. The detection of cryptic species ...

Development and Testing of Species-specific Quantitative PCR Assays for Environmental DNA Applications

New, non-invasive methods for detecting and monitoring species presence are being developed to aid in fisheries and wildlife conservation management. The use of environmental DNA (eDNA) samples for detecting macrobiota is one such group of methods that is rapidly becoming popular and being implemented in national management programs. Here we focus on the development of species-specific targeted assays for probe-based quantitative PCR (qPCR) applications. Using probe-based qPCR offers greater specificity than is possible with primers alone. Furthermore, the ability to quantify the amount of DNA in a sample can be useful in our understanding of the ecology of eDNA and the interpretation of eDNA detection patterns in the field. Careful consideration is needed in the development and testing of these assays to ensure the sensitivity and specificity of detecting the target species from an environmental sample. In this protocol we will delineate the steps needed to design and test probe-based assays for the detection of a target species; including creation of sequence databases, assay design, assay selection and optimization, testing assay performance, and field validation. Following these steps will help achieve an efficient, sensitive, and specific assay that can be used with confidence. We demonstrate this process with our assay designed for populations of the mucket (Actinonaias ligamentina), a freshwater mussel species found in the Clinch River, USA.

Environmental DNA assays require rigorous design, testing, optimization and validation before the collection of field data can begin. Here, we present a protocol to take users through each step of designing a species-specific, probe-based qPCR assay for the detection and quantification of a target species DNA from environmental samples.

ÇevreSEL DNA Uygulamaları için Türlere Özgü Nicel PCR Testlerinin Geliştirilmesi ve Testi

New, non-invasive methods for detecting and monitoring species presence are being developed to aid in fisheries and wildlife conservation management. The ...

Foodborne Pathogen Screening Using Magneto-fluorescent Nanosensor: Rapid Detection of E. Coli O157:H7

Enterohemorrhagic Escherichia coli O157:H7 has been linked to both waterborne and foodborne illnesses, and remains a threat despite the food- and water-screening methods used currently. While conventional bacterial detection methods, such as polymerase chain reaction (PCR) and enzyme-linked immunosorbent assays (ELISA) can specifically detect pathogenic contaminants, they require extensive sample preparation and lengthy waiting periods. In addition, these practices demand sophisticated laboratory instruments and settings, and must be executed by trained professionals. Herein, a protocol is proposed for a simpler diagnostic technique that features the unique combination of magnetic and fluorescent parameters in a nanoparticle-based platform. The proposed multiparametric magneto-fluorescent nanosensors (MFnS) can detect E. coli O157:H7 contamination with as little as 1 colony-forming unit present in solution within less than 1 h. Furthermore, the ability of MFnS to remain highly functional in complex media such as milk and lake water has been verified. Additional specificity assays were also used to demonstrate the ability of MFnS to only detect the specific target bacteria, even in the presence of similar bacterial species. The pairing of magnetic and fluorescent modalities allows for the detection and quantification of pathogen contamination in a wide range of concentrations, exhibiting its high performance in both early- and late-stage contamination detection. The effectiveness, affordability, and portability of the MFnS make them an ideal candidate for point-of-care screening for bacterial contaminants in a wide range of settings, from aquatic reservoirs to commercially packaged foods.

Foodborne Pathogen Screening Using Magneto-fluorescent Nanosensor: Rapid Detection of E. Coli O157:H7

The overall goal of this protocol is to synthesize functional nanosensors for the portable, cost-effective, and rapid detection of specifically targeted pathogenic bacteria through a combination of magnetic relaxation and fluorescence emission modalities.

Gıda kaynaklı patojen tarama kullanarak Manyeto-floresan Nanosensor: E. Coli O157: H7 hızlı tespiti

Enterohemorrhagic Escherichia coli O157:H7 has been linked to both waterborne and foodborne illnesses, and remains a threat despite the food- and ...

Amplification of Escherichia coli in a Continuous-Flow-PCR Microfluidic Chip and Its Detection with a Capillary Electrophoresis System

Polymerase chain reaction (PCR) is a traditional method employed for the amplification of a target gene that has played an important role in biomolecular diagnostics. However, traditional PCR is very time-consuming because of the low-temperature variation efficiency. This work proposes a continuous-flow-PCR (CF-PCR) system based on a microfluidic chip. The amplification time can be greatly reduced by running the PCR solution into a microchannel placed on heaters set at different temperatures. Moreover, as capillary electrophoresis (CE) is an ideal way to differentiate positive and false-positive PCR products, a CE system was built to achieve efficient separation of the DNA fragments. This paper describes the process of amplification of Escherichia coli (E. coli) by the CF-PCR system built in-house and the detection of the PCR products by CE. The results demonstrate that the target gene of E. coli was successfully amplified within 10 min, indicating that these two systems can be used for the rapid amplification and detection of nucleic acids.

Amplification of Escherichia coli in a Continuous-Flow-PCR Microfluidic Chip and Its Detection with a Capillary Electrophoresis System

This protocol describes how to build a continuous-flow-polymerase chain system based on a microfluidic chip and how to build a capillary electrophoresis system in the lab. It presents a simple method for the analysis of nucleic acids in the lab.

Escherichia coli'nin Sürekli Akış-PCR Mikroakışkan Çipinde Amplifikasyonu ve Kapiler Elektroforez Sistemi ile Tespiti

Polymerase chain reaction (PCR) is a traditional method employed for the amplification of a target gene that has played an important role in biomolecular ...

Biyomühendislik

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. coli O157:H7 by targeting ORF Z3276. With this assay, we can detect as low as a few copies of the genome of DNA of E. coli O157:H7. The sensitivity and specificity of the assay were confirmed by intensive validation tests with a large number of E. coli O157:H7 strains (n = 369) and non-O157 strains (n = 112). Furthermore, we have combined propidium monoazide (PMA) procedure with the newly developed qPCR protocol for selective detection of live cells from dead cells. Amplification of DNA from PMA-treated dead cells was almost completely inhibited in contrast to virtually unaffected amplification of DNA from PMA-treated live cells. Additionally, the protocol has been modified and adapted to a 96-well plate format for an easy and consistent handling of a large number of samples. This method is expected to have an impact on accurate microbiological and epidemiological monitoring of food safety and environmental source.

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A qPCR assay was developed for detection of Escherichia coli O157:H7 targeting a unique genetic marker, Z3276. The qPCR was combined with propidium monoazide (PMA) treatment for live cell detection. This protocol has been modified and adapted to a 96-well plate format for easy and consistent handling of numerous samples

Live Algılama<em&gt; Escherichia coli</em&gt; O157: PMA-qPCR H7 Hücreler

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

Eşzamanlı Niceleme için Dubleks Dijital PCR Testi

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler