The authors have no acknowledgements.

1. Assay Mixture Preparation
<ol>
	<li>Make 100 &#181;mol/L stock concentrations for all primers in molecular grade water and probes in TE pH 8 buffer [Entero F1A, Entero R1, GPL813TQ 12; HF183-1, BthetR1, BthetP13]. 
	Note: Probes for the two targets are fluorescently labeled with different fluorophores7 as indicated in List of Materials/Equipment.</li>
	<li>Prepare master mix by mixing, per reaction planned, 12 &#181;l digital PCR mix (2x stock, see List of Materials/Equipment), 0.216 &#181;l each forward and reverse primer, 0.06 &#181;l each fluorescent probe, and 5.016 &#181;l nuclease free water (final concentration: 900 nM each primer, 250 nM each probe). Pipette up and down at least 10 times to mix while taking caution not to introduce air bubbles in the solution.</li>
	<li>Pipette 18 &#181;l master mix (from step 1.2) into a regular PCR tube or plate, mixing in 6 &#181;l DNA template (extracted as described previously13) to make assay mixture for droplet generation. If running samples in duplicate, pipet 36 &#181;l of master mix and 12 &#181;l DNA template into each well. Leave the corresponding replicate wells empty on the plate. Include positive controls (see List of Materials/Equipment) and no template controls (NTC) (i.e. with molecular grade water used as the template). 
	Note: Positive control is necessary to ensure the assay is running properly and the NTC is necessary to ensure there is no contamination within the plate and to set the fluorescent baseline later in data analysis. First time users are recommended to use both undiluted and diluted DNA samples.</li>
</ol>
2. Droplet Generation and PCR Plate Setup
<ol>
	<li>Mix the assay mixtures by pipetting up down approximately 15 times using a multichannel pipet. Ensure that the pipet tip stays within liquid to avoid making excess bubbles within the mixture.</li>
	<li>Insert cartridge 1 (containing 8 wells) into a white cartridge holder and click the cartridge holder shut. Cartridge 1 is now firmly in place and cannot be dislodged from the holder while generating droplets. Using a multichannel pipet, gently transfer 20 &#181;l of assay mixture into the middle position of the cartridge marked &#39;Sample&#39; without introducing air bubbles.</li>
	<li>Pipet in 70 &#181;l of droplet generation oil to the left side of the cartridge (marked &#39;Oil&#39;).</li>
	<li>Cover cartridge with a gasket making sure the gasket is flat and held evenly by the 4 ticks toward the edge of the cartridge. Press the green-lit button on the droplet generator to open and place the cartridge. Press green-lit button again to close the generator. 
	Note: Once the door closes, the button is dimmed, the door cannot be reopened and droplet generation begins immediately continuing for approximately 1 min.</li>
	<li>If doing more than 8 reactions, place cartridge 2 in a second white cartridge holder and prepare in the same manner as cartridge 1 while the droplet generation is in progress to save total setup time.</li>
	<li>Open the droplet generator door when the dim lit button turns green indicating completion of droplet generation. Remove the white cartridge holder containing cartridge 1, set aside, and place cartridge 2 onto the droplet generator.</li>
	<li>Remove the gasket from cartridge 1 and discard. Gently transfer the total volume (approximately 40 &#181;l) of generated droplets from the third column of the cartridge (marked &#39;Droplets&#39;) onto a final PCR plate (maintained at room temperature) for thermal cycling. 
	Note: Do not unclick the white cartridge holder as the action may break the newly generated droplets; only open the cartridge holder after the droplets have been transferred to the final plate.</li>
	<li>Repeat steps 2.1-2.7 for additional samples.</li>
	<li>When all the droplets are in the final PCR plate, place a pierceable foil cover on top of the plate and place it on a plate sealer. Set the sealer to 180 &#176;C, press &#39;Play&#39; on the sealer and let seal for 10 sec.</li>
</ol>
3. Thermal Cycling and Droplet Reading
<ol>
	<li>Place the sealed plate on the thermal cycler, one compatible with the final PCR plate used in step 2.7, and a temperature ramping speed of 2.0 &#176;C/sec.</li>
	<li>Run thermal program as follows: 10 min at 95 &#176;C, followed by 40 cycles of 30 sec at 94 &#176;C and 60 sec at 60 &#176;C, followed by a 10 min hold at 98 &#176;C (optional: final hold at 4 or 15 &#176;C).</li>
	<li>Upon completion of cycling, transfer the plate to a Droplet Reader for automatic measurement of fluorescence in each droplet in each well. Alternatively, store the plate at 4 &#176;C for up to 3 days before droplet reading. Ensure the droplets are at room temperature before proceeding with reading.
	<ol>
		<li>Open the accompanying software to setup the droplet reading. In the default &#39;Setup&#39; menu containing a schematic of an empty 96 well plate, double click on well A1 to open the menu containing three sections: &#39;Sample,&#39; &#39;Assay 1&#39; and &#39;Assay 2.&#39;</li>
		<li>In the &#39;Sample&#39; section type the sample ID into the box labeled &#39;Name&#39; and press enter or check the box to the right marked &#39;Apply.&#39; Next, click the drop down menu labeled &#39;Experiment&#39; and choose &#39;RED&#39; (rare event detection) and click enter.</li>
		<li>Move to the section denoted &#39;Assay 1.&#39; In the &#39;Name&#39; section fill out the assay (e.g. Enterococcus) and click enter. In the box below labeled &#39;Type&#39; click the drop down menu and choose &#39;Channel 1 Unknown&#39; and click enter.</li>
		<li>Move to the section denoted &#39;Assay 2.&#39; In the &#39;Name&#39; section fill out the assay (e.g. HF183) and click enter. In the box below labeled &#39;Type&#39; click the drop down menu and choose &#39;Channel 2 Unknown&#39; and click enter. All the information from Steps 3.3.2 to 3.3.4 is now present in well A1.</li>
		<li>Name all subsequent wells containing droplets. To save total setup time, click &#39;Shift&#39; or &#39;Ctrl,&#39; to choose multiple wells simultaneously.</li>
		<li>When the digital depiction of the plate mirrors the physical plate, press &#39;OK&#39; at the bottom right of the menu. In the new menu that appears at the top of the plate schematic, under the &#39;Template&#39; section choose &#39;Save As&#39; and name and save the plate.</li>
		<li>To the left of the screen click &#39;Run&#39; and select appropriate Dye Set in the pop-out &#8220;Run Options&#8221; window. Data collection initiates and is displayed in real time in the software.</li>
	</ol>
	</li>
</ol>
4. Data Analysis and Reporting
<ol>
	<li>When the reader is finished and a box appears stating &#39;Run Complete&#39;, click &#39;OK&#39;. 
	Note: The software displays the final data file under the &#39;Analyze&#39; section of the software. In this view, the software has all the wells in the plate selected and defaults to the &#39;2D Amplitude&#39; data plot.</li>
	<li>Check the separation between the positive and negative droplets. Ensure that the fluorescence in all droplets in the NTC wells are near baseline.</li>
	<li>Click on the button labeled &#39;Events.&#39; To the right of the presented histogram click the box named &#8216;Total&#8217; and the box named &#8220;single&#8221; at the bottom to display the total number of accepted droplets per well. Exclude any wells containing &#60;10,000 droplets7 by holding the Ctrl key and clicking on the well(s) to be excluded.</li>
	<li>Click on the button denoted as &#39;1D Amplitude&#39; to set the fluorescent threshold at approximately one standard deviation (500-700 fluorescence units) above the negative droplets in NTC wells for both targets. At the very left of the screen under the &#39;Auto Analyze&#39; showing two threshold buttons, choose the icon to the right that has a solid pink horizontal line running through it.</li>
	<li>Click in the box to the left of &#39;Set Threshold&#39; under each of the amplitude graphs and enter the appropriate fluorescence threshold values. The target concentrations in copy per &#181;l reaction are then automatically calculated. 
	Note: The thresholds do not need to be identical for the different targets.</li>
	<li>Export the results in a .csv file by clicking the &#39;Export&#39; button in the upper left hand corner on the 1D Amplitude screen. In the .csv file, multiply the exported target concentration by 4 to convert it from copy of target (23S gene of Enterococcus spp. or the HF183 marker) per &#181;l reaction to copy of target per &#181;l DNA template.</li>
</ol>

<ol>
	<li>Boehm, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+forty-one+microbial+source+tracking+methods:+A+twenty-seven+lab+evaluation+study.">Performance of forty-one microbial source tracking methods: A twenty-seven lab evaluation study.</a> Water Res. 47 (18), 6812-6828 (2013).</li><li>Layton, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+human+fecal+anaerobe-associated+PCR-based+assays+in+a+multi-laboratory+method+evaluation+study.">Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study.</a> Water Res. 47 (18), 6897-6908 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+platform,+reference+material,+and+quantification+model+on+enumeration+of+Enterococcus+by+quantitative+PCR+methods.">Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods.</a> Water Res. 47 (1), 233-241 (2013).</li><li>Sivaganesan, M., Siefring, S., Varma, M., Haugland, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MPN+estimation+of+qPCR+target+sequence+recoveries+from+whole+cell+calibrator+samples.">MPN estimation of qPCR target sequence recoveries from whole cell calibrator samples.</a> J. Microbiol. Methods. 87 (3), 343-349 (2011).</li><li>Huggett, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Digital+MIQE+Guidelines:+Minimum+Information+for+Publication+of+Quantitative+Digital+PCR+Experiments.">The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments.</a> Clin. Chem. 59 (6), 892-902 (2013).</li><li>Cao, Y., Raith, M. R., Griffith, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+digital+PCR+for+simultaneous+quantification+of+general+and+human-associated+fecal+indicators+for+water+quality+assessment.">Droplet digital PCR for simultaneous quantification of general and human-associated fecal indicators for water quality assessment.</a> Water Res. 70, 337-349 (2015).</li><li>Sanders, R., Huggett, J. F., Bushell, C. A., Cowen, S., Scott, D. J., Foy, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+Digital+PCR+for+Absolute+DNA+Quantification.">Evaluation of Digital PCR for Absolute DNA Quantification.</a> Anal. Chem. 83 (17), 6474-6484 (2011).</li><li>Whale, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+microfluidic+digital+PCR+and+conventional+quantitative+PCR+for+measuring+copy+number+variation.">Comparison of microfluidic digital PCR and conventional quantitative PCR for measuring copy number variation.</a> Nucleic Acid Res. 40 (11), 82-89 (2012).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nature Methods. 10 (10), 1003-1005 (2013).</li><li>Morisset, D., &#352;tebih, D., Milavec, M., Gruden, K., &#381;el, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+food+and+feed+aamples+with+droplet+digital+PCR.">Quantitative analysis of food and feed aamples with droplet digital PCR.</a> PLoS One. 8 (5), e62583 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+molecular+community+analysis+methods+for+discerning+fecal+sources+and+human+waste.">Evaluation of molecular community analysis methods for discerning fecal sources and human waste.</a> Water Res. 47 (18), 6862-6872 (2013).</li></ol>

The authors declare that they have no competing financial interests.

There are a few critical steps in the protocol. First, mixing of the assay mixtures can be difficult because the master mix is more viscous than conventional qPCR master mixes. Simple vortexing may lead to insufficient mixing, which in turn leads to non-uniform distribution of DNA templates in the assay mixtures and subsequently in the droplets. The mixing-by-pipetting technique described in the protocol must be followed to ensure accurate dPCR quantification. Second, it is important to ensure droplets are generated at a...

Quantitative PCR (qPCR) methods have been widely used for recreational water quality monitoring and microbial source tracking applications because they are faster, more flexible and specific compared to traditional culture-based methods. Consequently, qPCR is recommended for achieving rapid water monitoring results for general fecal indicators such as Enterococcus spp. in the revised USEPA recreational water quality criteria1. Many qPCR assays have also been developed and validated for identifying sources of fecal contamination in environmental waters2. Among these, the HF183 marker assays are among the most frequently used for identifying human-associated fecal contamination3.
However, qPCR results can often be biased because they rely on standard curves for quantification. qPCR quantifies unknown concentrations of target in samples by interpolating their quantification cycle (Cq) from a standard curve that describes a linear relationship between Cq and logarithmic quantity of a set of serially-diluted standards. Lack of reliable and consistent standard reference material can therefore greatly bias qPCR results. Studies showed that qPCR results differed by approximately half a log using standards from different vendors4 and by 2-fold using different batches of standards from the same vendor5.
Digital PCR (dPCR) technology quantifies an unknown sample by counting the frequency of positives in large numbers of miniature PCRs that are generated by partitioning a bulk qPCR into thousands or millions of uniform nanoliter or picoliter reactions6. It is referred as droplet digital PCR (i.e., this article) or chamber digital PCR, respectively, if the partitions are water-in-oil droplets (i.e., this article) or small chambers on a chip. A higher sample concentration will result in presence of target DNA (hence positive PCR) in a higher proportion of partitions, a relationship approximated by Poisson distribution. As such, the binary results (positive or negative PCR) are recorded and the frequency of positive droplets is used to calculate unknown sample concentrations directly via Poisson approximation, eliminating the need for a standard curve as in qPCR.
This binary nature of digital PCR quantification provides additional advantages over qPCR7. Because delayed amplification can still yield a positive PCR, dPCR quantification is more robust against inhibition that reduces amplification efficiency. Similarly, dPCR quantification is not affected by variability in Cq values as is qPCR, leading to higher precision of dPCR compared to qPCR8-10.
In addition, the partitioning process ensures a very small amount of target DNA present in each droplet, effectively minimizing substrate competition (during amplification of different DNA targets) that are common obstacles to achieving duplexing (i.e. an assay simultaneously measures two DNA targets) in qPCR. As such, whether run in duplex or simplex (i.e. one target is measured in a single assay) dPCR produces nearly indistinguishable quantification of both targets7,11.
The goal of the digital PCR assay (EntHF183 dPCR) described in this article is to obtain simultaneous direct quantification of the general fecal indicator Enterococcus spp. and the human-fecal associated HF183 marker with improved precision, reproducibility and robustness against inhibition compared to its qPCR counterparts. This assay has been successfully used for quantifying fecal contamination in environmental freshwater, marine water, and various fecal material7, but can also be applied to any other types of waters and wastewaters. This assay holds great promise for analyzing sediments or soils due to its high tolerance to inhibition, but further testing is required because of complexities of inhibitor mixes in these types of samples.

<table><tbody><tr><td>Low Bind Microtubes</td><td>Costar</td><td>3207</td><td>For storage of reagents, samples/production of master mixes</td></tr><tr><td>Nuclease Free Water</td><td>FisherSci</td><td>BP2484-50</td><td></td></tr><tr><td>TE pH 8 buffer</td><td>FisherSci</td><td>BP2473-100</td><td></td></tr><tr><td>Hardshell 96 Well Plate</td><td>BioRad</td><td>HSP-9601</td><td>For initial master mix and sample inoculation</td></tr><tr><td>Aluminum Sealing Film</td><td>BioRad</td><td>359-0133</td><td>To seal sample plate</td></tr><tr><td>Droplet Generator</td><td>BioRad</td><td>186-3002</td><td></td></tr><tr><td>Droplet Generation Oil</td><td>BioRad</td><td>186-3005</td><td></td></tr><tr><td>Cartridge</td><td>BioRad</td><td>186-4008</td><td></td></tr><tr><td>DG8 Cartridge Holder</td><td>BioRad</td><td>186-3051</td><td></td></tr><tr><td>Gasket</td><td>BioRad</td><td>186-3009</td><td></td></tr><tr><td>20 &amp;#956;l pipet tips</td><td>Rainin</td><td>GP-L10F</td><td>For tansferring sample/master mix to cartidge</td></tr><tr><td>200 &amp;#956;l pipet tips</td><td>Rainin</td><td>GP-L200F</td><td>For transferring droplets to final Twin.Tec Plate</td></tr><tr><td>Twin.Tec 96 Well Plate</td><td>Eppendorf</td><td>951020320</td><td>For final droplets thermal cycling and reading</td></tr><tr><td>Pierceable Heat Seal Foil</td><td>BioRad</td><td>181-4040</td><td>To seal Twin.Tec plate before thermalcycling</td></tr><tr><td>PX1 PCR Plate Sealer</td><td>BioRad</td><td>181-4000</td><td></td></tr><tr><td>CFX96 Thermalcycler</td><td>BioRad</td><td>CFX96 and C1000</td><td>Only the thermal cycler is needed, no optics</td></tr><tr><td>QX100 Droplet Reader</td><td>BioRad</td><td>186-3001</td><td></td></tr><tr><td>Droplet Reader Oil</td><td>BioRad</td><td>186-3004</td><td></td></tr><tr><td>Droplet PCR Supermix&amp;nbsp;</td><td>BioRad</td><td>186-3024</td><td>&lt;em&gt;i.e.&lt;/em&gt; the digital PCR mix in manuscript</td></tr><tr><td>QuantaSoft software (v1.3.2)</td><td>Quantasoft&amp;nbsp;</td><td>QX100&amp;nbsp;</td><td>For viewing, analyzing, and exporting ddPCR data</td></tr><tr><td>Entero Forward Primer (Ent F1A)</td><td>Operon</td><td>GAGAAATTCCAAACGAACTTG</td><td>Alternative vendor can be used</td></tr><tr><td>Entero Reverse Primer (Ent R1)</td><td>Operon</td><td>CAGTGCTCTACCTCCATCATT</td><td>Alternative vendor can be used</td></tr><tr><td>Entero Probe (GPL813TQ)</td><td>Operon</td><td>[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]</td><td>Alternative vendor can be used, but the florophore has to be FAM</td></tr><tr><td>HF183 Forward Primer (HF183-1)</td><td>Operon</td><td>ATCATGAGTTCACATGTCCG</td><td>Alternative vendor can be used</td></tr><tr><td>HF183 Reverse Primer (BthetR1)</td><td>Operon</td><td>CGTAGGAGTTTGGACCGTGT</td><td>Alternative vendor can be used</td></tr><tr><td>HF183 Probe (BthetP1)</td><td>Operon</td><td>[6-HEX]-CTGAGAGGAAGGTCCCCC&lt;br/&gt; ACATTGGA-[BHQ1]</td><td>Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.&amp;nbsp;</td></tr><tr><td>Positive control</td><td></td><td></td><td>Mixture of &lt;em&gt;E. faecalis&lt;/em&gt; genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing &lt;em&gt;E. faecalis&lt;/em&gt; and sequences of the ordered HF183 plasmid, please see Cao &lt;em&gt;et al.&lt;/em&gt; 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available &lt;em&gt;Enterococcus&lt;/em&gt; DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared &lt;em&gt;E. faecalis&lt;/em&gt; genomic DNA.</td></tr></tbody></table>

a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated HF183 marker. The EntHF183 duplex dPCR (referred as EntHF183 dPCR hereon) assay uses the same primer and probe sequences as its published individual quantitative PCR (qPCR) counterparts. Likewise, the same water filtration and DNA extraction procedures as performed prior to qPCR are followed prior to running dPCR. However, the duplex dPCR assay has several advantages over the qPCR assays. Most important, the dPCR assay eliminates the need for running a standard curve and hence, the associated bias and variability, by direct quantification of its targets. In addition, while duplexing (i.e. simultaneous quantification) Enterococcus and HF183 in qPCR often leads to severe underestimation of the less abundant target in a sample, dPCR provides consistent quantification of both targets, whether quantified individually or simultaneously in the same reaction. The dPCR assay is also able to tolerate PCR inhibitor concentrations that are one to two orders of magnitude higher than those tolerated by qPCR. These advantages make the EntHF183 dPCR assay particularly attractive because it simultaneously provides accurate and repeatable information on both general and human-associated fecal contamination in environmental waters without the need to run two separate qPCR assays. Despite its advantages over qPCR, the upper quantification limit of the dPCR assay with currently available instrumentation is approximately four orders of magnitude lower than that achievable by qPCR. Consequently, dilution is needed for measurement of high concentrations of target organisms such as those typically observed following sewage spills.

A good EntHF183 duplex dPCR run should result in relatively high number of accepted droplets (ca. 10,000-17,000) and relatively large difference (ca. 5,000) between fluorescence values for negative and positive droplets7. Unusually low number of droplets likely indicates issues in the droplet generation process, and a cutoff of 10,000 droplets is suggested based on empirical data from the droplet dPCR system used in this article. A weaker separation (i.e.<...

Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

This manuscript describes a duplex digital PCR assay that can be used to simultaneously quantify Enterococcus spp. and the HF183 genetic markers as indicators of general and human-associated fecal contamination in recreational waters.

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated ...

a-duplex-digital-pcr-assay-for-simultaneous-quantification

Research

JoVE Journal

Environment

9.7K Views.  Southern California Costal Water Research Project Authority. This manuscript describes a duplex digital PCR assay that can be used to simultaneously quantify Enterococcus spp. and the HF183 genetic markers as indicators of general and human-associated fecal contamination in recreational waters.

Video: A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. Part III. Virus Detection by RT-qPCR

EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. This method was developed with the goal of having a standardized method for use in multiple analytical laboratories during monitoring period 3 of the Unregulated Contaminant Monitoring Rule. Herein we present the protocol for extraction of viral ribonucleic acid (RNA) from water sample concentrates and for quantitatively measuring enterovirus and norovirus concentrations using reverse transcription-quantitative PCR (RT-qPCR). Virus concentrations for the molecular assay are calculated in terms of genomic copies of viral RNA per liter based upon a standard curve. The method uses a number of quality controls to increase data quality and to reduce interlaboratory and intralaboratory variation. The method has been evaluated by examining virus recovery from ground and reagent grade waters seeded with poliovirus type 3 and murine norovirus as a surrogate for human noroviruses. Mean poliovirus recoveries were 20% in groundwaters and 44% in reagent grade water. Mean murine norovirus recoveries with the RT-qPCR assay were 30% in groundwaters and 4% in reagent grade water.

Here we present a procedure to quantify enterovirus and norovirus in environmental and drinking waters using reverse transcription-quantitative PCR. Mean virus recovery from groundwater with this standardized procedure from EPA Method 1615 was 20% for poliovirus and 30% for murine norovirus.

EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. This method was developed with the goal of having a ...

Cost-effective Method for Microbial Source Tracking Using Specific Human and Animal Viruses

Microbial contamination of the environment represents a significant health risk. Classical bacterial fecal indicators have shown to have significant limitations, viruses are more resistant to many inactivation processes and standard fecal indicators do not inform on the source of contamination. The development of cost-effective methods for the concentration of viruses from water and molecular assays facilitates the applicability of viruses as indicators of fecal contamination and as microbial source tracking (MST) tools. Adenoviruses and polyomaviruses are DNA viruses infecting specific vertebrate species including humans and are persistently excreted in feces and/or urine in all geographical areas studied. In previous studies, we suggested the quantification of human adenoviruses (HAdV) and JC polyomaviruses (JCPyV) by quantitative PCR (qPCR) as an index of human fecal contamination. Recently, we have developed qPCR assays for the specific quantification of porcine adenoviruses (PAdV) and bovine polyomaviruses (BPyV) as animal fecal markers of contamination with sensitivities of 1-10 genome copies per test tube. In this study, we present the procedure to be followed to identify the source of contamination in water samples using these tools. As example of representative results, analysis of viruses in ground water presenting high levels of nitrates is shown.
Detection of viruses in low or moderately polluted waters requires the concentration of the viruses from at least several liters of water into a much smaller volume, a procedure that usually includes two concentration steps in series. This somewhat cumbersome procedure and the variability observed in viral recoveries significantly hamper the simultaneous processing of a large number of water samples.
In order to eliminate the bottleneck caused by the two-step procedures we have applied a one-step protocol developed in previous studies and applicable to a diversity of water matrices. The procedure includes: acidification of ten-liter water samples, flocculation by skimmed milk, gravity sedimentation of the flocculated materials, collection of the precipitate and centrifugation, resuspension of the precipitate in 10 ml phosphate buffer. The viral concentrate is used for the extraction of viral nucleic acids and the specific adenoviruses and polyomaviruses of interest are quantified by qPCR. High number of samples may be simultaneously analyzed using this low-cost concentration method.
The procedure has been applied to the analysis of bathing waters, seawater and river water and in this study, we present results analyzing groundwater samples. This high-throughput quantitative method is reliable, straightforward, and cost-effective.

The study describes a cost-effective method for the identification of the source of fecal/urine contamination or contamination by nitrates in water using qPCR for the specific quantification of human/porcine/bovine DNA viruses, adenoviruses and polyomaviruses, proposed as MST tools.

Microbial contamination of the environment represents a significant health risk. Classical bacterial fecal indicators have shown to have significant ...

Immunology and Infection

Multiplex Detection of Bacteria in Complex Clinical and Environmental Samples using Oligonucleotide-coupled Fluorescent Microspheres

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated to a microbiota dominated by a number of bacterial species, including Gardnerella vaginalis, Atopobium vaginae, and others1-3. This condition is associated with a range of negative health outcomes, including HIV acquisition4, and it can be difficult to manage clinically5. Furthermore, diagnosis of BV has relied on the use of Gram stains of vaginal swab smears that are scored on various numerical criteria6,7. While this diagnostic is simple, inexpensive, and well suited to resource-limited settings, it can suffer from problems related to subjective interpretations and it does not give a detailed profile of the composition of the vaginal microbiota8. Recent deep sequencing efforts have revealed a rich, diverse vaginal microbiota with clear differences between samples taken from individuals that are diagnosed with BV compared to those individuals that are considered normal9,10, which has resulted in the identification of a number of potential targets for molecular diagnosis of BV11,12. These studies have provided a wealth of useful information, but deep sequencing is not yet practical as a diagnostic method in a clinical setting. We have recently described a method for rapidly profiling the vaginal microbiota in a multiplex format using oligonucleotide-coupled fluorescent beads with detection on a Luminex platform13. This method, like current Gram stain-based methods, is rapid and simple but adds the additional advantage of exploiting molecular knowledge arising from sequencing studies in probe design. This method therefore provides a way to profile the major microorganisms that are present in a vaginal swab that can be used to diagnose BV with high specificity and sensitivity compared to Gram stain while providing additional information on species presence and abundance in a semi-quantitative and rapid manner. This multiplex method is expandable well beyond the range of current quantitative PCR assays for particular organisms, which is currently limited to 5 or 6 different assays in a single sample14. Importantly, the method is not limited to the detection of bacteria in vaginal swabs and can be easily adapted to rapidly profile nearly any microbial community of interest. For example, we have recently begun to apply this methodology to the development of diagnostic tools for use in wastewater treatment plants.

We describe a multiplex method for the detection of microorganisms within a sample using oligonucleotide-coupled fluorescent beads. Amplicon from all organisms within a sample is hybridized to a panel of probe-coupled beads. A Luminex or Bio-Plex instrument is used to query each bead for bead type and hybridization signal.

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated ...

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation into thousands of nano-sized water-in-oil individual reactions. Recently, ddPCR has become one of the most accurate and sensitive tools for circulating tumor DNA (ctDNA) detection. One of the major limitations of the standard ddPCR technique is the restricted number of mutations that can be screened per reaction, as specific hydrolysis probes recognizing each possible allelic version are required. An alternative methodology, the drop-off ddPCR, increases throughput, since it requires only a single pair of probes to detect and quantify potentially all genetic alterations in the targeted region. Drop-off ddPCR displays comparable sensitivity to conventional ddPCR assays with the advantage of detecting a greater number of mutations in a single reaction. It is cost-effective, conserves precious sample material, and can also be used as a discovery tool when mutations are not known a priori.

Here, we present a protocol to accurately quantify multiple genetic alterations of a target region in a single reaction using drop-off ddPCR and a unique pair of hydrolysis probes.

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation ...

Genetics

A Modified EPA Method 1623 that Uses Tangential Flow Hollow-fiber Ultrafiltration and Heat Dissociation Steps to Detect Waterborne Cryptosporidium and Giardia spp.

Cryptosporidium and Giardia species are two of the most prevalent protozoa that cause waterborne diarrheal disease outbreaks worldwide. To better characterize the prevalence of these pathogens, EPA Method 1623 was developed and used to monitor levels of these organisms in US drinking water supplies 12. The method has three main parts; the first is the sample concentration in which at least 10 L of raw surface water is filtered. The organisms and trapped debris are then eluted from the filter and centrifuged to further concentrate the sample. The second part of the method uses an immunomagnetic separation procedure where the concentrated water sample is applied to immunomagnetic beads that specifically bind to the Cryptosporidium oocysts and Giardia cysts allowing for specific removal of the parasites from the concentrated debris. These (oo)cysts are then detached from the magnetic beads by an acid dissociation procedure. The final part of the method is the immunofluorescence staining and enumeration where (oo)cysts are applied to a slide, stained, and enumerated by microscopy.
Method 1623 has four listed sample concentration systems to capture Cryptosporidium oocysts and Giardia cysts in water: Envirochek filters (Pall Corporation, Ann Arbor, MI), Envirochek HV filters (Pall Corporation), Filta-Max filters (IDEXX, Westbrook, MA), or Continuous Flow Centrifugation (Haemonetics, Braintree, MA). However, Cryptosporidium and Giardia (oo)cyst recoveries have varied greatly depending on the source water matrix and filters used1,14. A new tangential flow hollow-fiber ultrafiltration (HFUF) system has recently been shown to be more efficient and more robust at recovering Cryptosporidium oocysts and Giardia cysts from various water matrices; moreover, it is less expensive than other capsule filter options and can concentrate multiple pathogens simultaneously1-3,5-8,10,11. In addition, previous studies by Hill and colleagues demonstrated that the HFUF significantly improved Cryptosporidium oocysts recoveries when directly compared with the Envirochek HV filters4. Additional modifications to the current methods have also been reported to improve method performance. Replacing the acid dissociation procedure with heat dissociation was shown to be more effective at separating Cryptosporidium from the magnetic beads in some matrices9,13 .
This protocol describes a modified Method 1623 that uses the new HFUF filtration system with the heat dissociation step. The use of HFUF with this modified Method is a less expensive alternative to current EPA Method 1623 filtration options and provides more flexibility by allowing the concentration of multiple organisms.

A Modified EPA Method 1623 that Uses Tangential Flow Hollow-fiber Ultrafiltration and Heat Dissociation Steps to Detect Waterborne Cryptosporidium and Giardia spp.

This protocol describes the use of a tangential flow hollow-fiber ultrafiltration sample concentration system and a heat dissociation as alternative steps for the detection of waterborne Cryptosporidium and Giardia species using EPA Method 1623.

Cryptosporidium and Giardia species are two of the most prevalent protozoa that cause waterborne diarrheal disease outbreaks worldwide. To better ...

Capture of Environmental DNA (eDNA) from Water Samples by Flocculation

The analysis of environmental DNA (eDNA) has become a widely used approach to problem solving in species management. The detection of cryptic species including invasive and (or) species at risk is the goal, typically accomplished by testing water and sediment for the presence of characteristic DNA signatures. Reliable and efficient procedures for the capture of eDNA are required, especially those that can be performed easily in the field by personnel with limited training and citizen scientists. The capture of eDNA using membrane filtration is widely used currently. This approach has inherent issues that include the choice of filter material and porosity, filter fouling, and time required on site for the process to be performed. Flocculation offers an alternative that can be easily implemented and applied to sampling regimes that strive to cover broad territories in limited time.

Capture of Environmental DNA eDNA from Water Samples by Flocculation

Environmental DNA (eDNA) is typically captured from water samples using alcohol precipitation, filtration, or flocculation. Presented here is an alternative protocol that uses lanthanum chloride to enable collection of dissolved and particulate-bound nucleic acids from water samples containing eukaryotic cells, prokaryotic cells, and virus.

The analysis of environmental DNA (eDNA) has become a widely used approach to problem solving in species management. The detection of cryptic species ...

Development and Testing of Species-specific Quantitative PCR Assays for Environmental DNA Applications

New, non-invasive methods for detecting and monitoring species presence are being developed to aid in fisheries and wildlife conservation management. The use of environmental DNA (eDNA) samples for detecting macrobiota is one such group of methods that is rapidly becoming popular and being implemented in national management programs. Here we focus on the development of species-specific targeted assays for probe-based quantitative PCR (qPCR) applications. Using probe-based qPCR offers greater specificity than is possible with primers alone. Furthermore, the ability to quantify the amount of DNA in a sample can be useful in our understanding of the ecology of eDNA and the interpretation of eDNA detection patterns in the field. Careful consideration is needed in the development and testing of these assays to ensure the sensitivity and specificity of detecting the target species from an environmental sample. In this protocol we will delineate the steps needed to design and test probe-based assays for the detection of a target species; including creation of sequence databases, assay design, assay selection and optimization, testing assay performance, and field validation. Following these steps will help achieve an efficient, sensitive, and specific assay that can be used with confidence. We demonstrate this process with our assay designed for populations of the mucket (Actinonaias ligamentina), a freshwater mussel species found in the Clinch River, USA.

Environmental DNA assays require rigorous design, testing, optimization and validation before the collection of field data can begin. Here, we present a protocol to take users through each step of designing a species-specific, probe-based qPCR assay for the detection and quantification of a target species DNA from environmental samples.

New, non-invasive methods for detecting and monitoring species presence are being developed to aid in fisheries and wildlife conservation management. The ...

Foodborne Pathogen Screening Using Magneto-fluorescent Nanosensor: Rapid Detection of E. Coli O157:H7

Enterohemorrhagic Escherichia coli O157:H7 has been linked to both waterborne and foodborne illnesses, and remains a threat despite the food- and water-screening methods used currently. While conventional bacterial detection methods, such as polymerase chain reaction (PCR) and enzyme-linked immunosorbent assays (ELISA) can specifically detect pathogenic contaminants, they require extensive sample preparation and lengthy waiting periods. In addition, these practices demand sophisticated laboratory instruments and settings, and must be executed by trained professionals. Herein, a protocol is proposed for a simpler diagnostic technique that features the unique combination of magnetic and fluorescent parameters in a nanoparticle-based platform. The proposed multiparametric magneto-fluorescent nanosensors (MFnS) can detect E. coli O157:H7 contamination with as little as 1 colony-forming unit present in solution within less than 1 h. Furthermore, the ability of MFnS to remain highly functional in complex media such as milk and lake water has been verified. Additional specificity assays were also used to demonstrate the ability of MFnS to only detect the specific target bacteria, even in the presence of similar bacterial species. The pairing of magnetic and fluorescent modalities allows for the detection and quantification of pathogen contamination in a wide range of concentrations, exhibiting its high performance in both early- and late-stage contamination detection. The effectiveness, affordability, and portability of the MFnS make them an ideal candidate for point-of-care screening for bacterial contaminants in a wide range of settings, from aquatic reservoirs to commercially packaged foods.

Foodborne Pathogen Screening Using Magneto-fluorescent Nanosensor: Rapid Detection of E. Coli O157:H7

The overall goal of this protocol is to synthesize functional nanosensors for the portable, cost-effective, and rapid detection of specifically targeted pathogenic bacteria through a combination of magnetic relaxation and fluorescence emission modalities.

Enterohemorrhagic Escherichia coli O157:H7 has been linked to both waterborne and foodborne illnesses, and remains a threat despite the food- and ...

Amplification of Escherichia coli in a Continuous-Flow-PCR Microfluidic Chip and Its Detection with a Capillary Electrophoresis System

Polymerase chain reaction (PCR) is a traditional method employed for the amplification of a target gene that has played an important role in biomolecular diagnostics. However, traditional PCR is very time-consuming because of the low-temperature variation efficiency. This work proposes a continuous-flow-PCR (CF-PCR) system based on a microfluidic chip. The amplification time can be greatly reduced by running the PCR solution into a microchannel placed on heaters set at different temperatures. Moreover, as capillary electrophoresis (CE) is an ideal way to differentiate positive and false-positive PCR products, a CE system was built to achieve efficient separation of the DNA fragments. This paper describes the process of amplification of Escherichia coli (E. coli) by the CF-PCR system built in-house and the detection of the PCR products by CE. The results demonstrate that the target gene of E. coli was successfully amplified within 10 min, indicating that these two systems can be used for the rapid amplification and detection of nucleic acids.

Amplification of Escherichia coli in a Continuous-Flow-PCR Microfluidic Chip and Its Detection with a Capillary Electrophoresis System

This protocol describes how to build a continuous-flow-polymerase chain system based on a microfluidic chip and how to build a capillary electrophoresis system in the lab. It presents a simple method for the analysis of nucleic acids in the lab.

Polymerase chain reaction (PCR) is a traditional method employed for the amplification of a target gene that has played an important role in biomolecular ...

Bioengineering

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. coli O157:H7 by targeting ORF Z3276. With this assay, we can detect as low as a few copies of the genome of DNA of E. coli O157:H7. The sensitivity and specificity of the assay were confirmed by intensive validation tests with a large number of E. coli O157:H7 strains (n = 369) and non-O157 strains (n = 112). Furthermore, we have combined propidium monoazide (PMA) procedure with the newly developed qPCR protocol for selective detection of live cells from dead cells. Amplification of DNA from PMA-treated dead cells was almost completely inhibited in contrast to virtually unaffected amplification of DNA from PMA-treated live cells. Additionally, the protocol has been modified and adapted to a 96-well plate format for an easy and consistent handling of a large number of samples. This method is expected to have an impact on accurate microbiological and epidemiological monitoring of food safety and environmental source.

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A qPCR assay was developed for detection of Escherichia coli O157:H7 targeting a unique genetic marker, Z3276. The qPCR was combined with propidium monoazide (PMA) treatment for live cell detection. This protocol has been modified and adapted to a 96-well plate format for easy and consistent handling of numerous samples

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Summary

Explore More Videos

Chapters in this video

EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. Part III. Virus Detection by RT-qPCR

Cost-effective Method for Microbial Source Tracking Using Specific Human and Animal Viruses

Multiplex Detection of Bacteria in Complex Clinical and Environmental Samples using Oligonucleotide-coupled Fluorescent Microspheres

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

A Modified EPA Method 1623 that Uses Tangential Flow Hollow-fiber Ultrafiltration and Heat Dissociation Steps to Detect Waterborne Cryptosporidium and Giardia spp.

Capture of Environmental DNA (eDNA) from Water Samples by Flocculation

Development and Testing of Species-specific Quantitative PCR Assays for Environmental DNA Applications

Foodborne Pathogen Screening Using Magneto-fluorescent Nanosensor: Rapid Detection of E. Coli O157:H7

Amplification of Escherichia coli in a Continuous-Flow-PCR Microfluidic Chip and Its Detection with a Capillary Electrophoresis System

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR