The authors have no acknowledgements.

1. 분석 혼합물 준비 <ol><li> TE의 pH 8 버퍼에있는 모든 분자 수준의 물에 프라이머 및 프로브 [Entero F1A, Entero R1, GPL813TQ 12 100 μmol / L의 재고 농도를 확인; HF183-1, BthetR1, BthetP1 3]. 참고 :이 타겟 프로브는 형광 재료 / 장비 목록에 표시된 다른 형광 (7)으로 표시됩니다. </li><li> 계획 반응에 따라 혼합하여 12 μl의 디지털 PCR 믹스 마스터 믹스를 준비 0.216 ㎕를 앞으로 각 (배 재고, 자재 / 장비의 목록 참조) 프라이머, 0.06 ㎕를 각 형광 프로브를 반대하고, 클레아없는 물 μl를 5.016 (최종 농도 : 900 nM의 각각의 프라이머, 250 nM의 각 프로브). 용액에 공기 방울을 소개 않도록주의하면서 혼합 아래로 적어도 10 시간을 피펫합니다. </li><li> 6 μL의 DNA 템플릿에 혼합 일반 PCR 튜브 또는 판에, (단계 1.2에서) 피펫 18 μL 마스터 믹스 (기술은 기존과 같이 추출교활한 13) 액적 생성에 대한 분석 혼합물을 확인합니다. 중복 샘플을 실행하면, 피펫 마스터 믹스 36 μl를 잘 각각에 12 μl의 DNA 템플릿입니다. 접시에 해당하는 복제 우물이 비어 둡니다. 양성 대조군 (자재 / 장비의 목록 참조)없이 템플릿 컨트롤 (NTC를) 포함 (즉, 템플릿으로 사용되는 분자 수준의 물). 주 : 양성 대조군 분석이 올바르게 실행되고 있는지 확인하기 위해 필요하며, NTC 플레이트 내에 오염이없는 보장하고 데이터 분석 뒷부분 형광 기준선을 설정하는 것이 필요하다. 처음 사용자는 모두 원액 희석 DNA 샘플을 사용하는 것이 좋습니다. </li></ol> 2. 물방울 생성 및 PCR 플레이트 설치 <ol><li> 멀티 채널 피펫을 사용하여 아래로 약 15 시간을 피펫 팅하여 분석 혼합물을 섞는다. 피펫 팁이 혼합물 내에서 초과 거품을 방지하기 위해 액체 내에서 유지 있는지 확인합니다. </li><li> 기능ERT의 흰색 카트리지 홀더에 카트리지 1 (포함 8 우물) 카트리지 홀더 종료를 클릭합니다. 카트리지 1은 제자리에 있으며 방울을 생성하는 동안 홀더에서 빠질 수 없습니다. 멀티 채널 피펫을 사용하여 조심스럽게 기포를 도입하지 않고 카트리지 표시된 &quot;예제&quot;의 중간 위치로 분석 혼합물 20 μl를 옮긴다. </li><li> 피펫은 카트리지의 좌측 액적 생성 오일을 70 μL의 ( &#39;유&#39;로 표시). </li><li> 개스킷 개스킷과 플랫 (4)에 의해 균일하게 유지된다 확인한와 커버 카트리지는 카트리지의 가장자리를 향해 틱. 열고 카트리지를 배치 방울 생성기의 녹색 조명 버튼을 누릅니다. 를 눌러 발전기를 닫 버튼을 다시 녹색 조명. 참고 : 문이 닫히고 나면, 버튼을 흐리게 문을 다시 열 수 없으며 액적 발생 즉시 약 1 분 동안 계속 시작합니다. </li><li> 두 번째 이상 8 반응, 장소 카트리지 2 일 경우액적 생성 총 설정 시간을 저장하는 진행 중에 흰색 카트리지 홀더 및 카트리지 (1)과 동일한 방법으로 준비한다. </li><li> 희미한 조명 버튼을 액적 생성의 완료를 나타내는 녹색으로 바뀌면 방울 생성기 문을 엽니 다. 방울 생성기에 흰색 카트리지 1 포함 카트리지 홀더, 따로 설정 및 장소 카트리지 (2)를 제거합니다. </li><li> 카트리지 1 가스켓을 제거하고 폐기합니다. 부드럽게 열 사이클링 (실온에서 유지), 최종 PCR 플레이트에 카트리지 ( &#39;물방울&#39;로 표시)의 세 번째 열에서 생성 된 방울의 전체 부피 (약 40 μL)를 옮긴다. 참고 : 새로 생성 된 물방울을 깰 수있는 작업으로 흰색 카트리지 홀더를 해제합니다하지 마십시오 방울 최종 판에 전사 된 후에 만​​ 카트리지 홀더를 연다. </li><li> 반복하여 추가 샘플에 대한 2.1-2.7 단계를 반복합니다. </li><li> 모든 방울 최종 PCR 플레이트되면 뚫을 배치접시 위에 호일 커버와 접시 시일에 놓습니다. 실러에 180 ° C 키를 눌러 &#39;재생&#39;에 대한 봉인을 설정하고 10 초 동안 실을 수 있습니다. </li></ol> 3. 열 사이클링과 물방울 읽기 <ol><li> 열 사이 클러에 밀봉 판을 놓고, 단계 2.7에서 사용 된 최종 PCR 플레이트, 2.0 ° C / sec의 온도 램핑 속도에 대응 한. </li><li> 다음 열 프로그램을 실행하여 10 분간 유지 한 다음 94 ℃에서 30 초, 95 ° C에서 10 분, 60 ° C에서 60 초 선택적 98 ° C (AT : 최종 보류 4 또는 15 ° C). </li><li> 사이클 종료 후, 각 웰에 각각의 액적에서 형광의 자동 측정을위한 액적 리더 플레이트를 옮긴다. 또한, 액적 읽기 전에 최대 3 일 동안 4 ° C에서 접시를 저장합니다. 물방울 읽기를 진행하기 전에 실온에 있는지 확인. <ol><li> 설정에 방울 독서를 동반하는 소프트웨어를 엽니 다. 에서&#39;샘플&#39;, &#39;분석 1&#39;과 &#39;분석 2.&#39;빈 96 웰 플레이트의 개략적 인을 포함하는 기본 &#39;설정&#39;메뉴는 두 번 세 부분을 포함하는 메뉴를 엽니 다 잘 A1을 클릭 </li><li> &#39;샘플&#39;섹션에서 &#39;이름&#39;키를 누릅니다 입력하거나 표시 오른쪽에있는 상자를 확인 표시된 상자에 샘플 ID를 입력합니다 &#39;적용을.&#39; 다음, 메뉴 표시 &#39;실험&#39;드롭 다운을 클릭하고 &#39;RED&#39;(희귀 이벤트 감지)를 선택하고 입력을 클릭합니다. </li><li> &#39;분석 1.&#39;표시 부분으로 이동 &#39;이름&#39;섹션에서 분석 (예를 들어, 엔테로)를 작성하여 입력을 클릭합니다. 라벨 &#39;형식&#39;아래 상자에서 드롭 다운 메뉴를 클릭하고 &#39;채널 알 수없는 1&#39;을 선택하고 입력을 클릭합니다. </li><li> &#39;분석 2.&#39;표시 부분으로 이동 &#39;이름&#39;섹션에서 분석 (예 : HF183)를 작성하여 입력을 클릭합니다. 라벨 &#39;형식&#39;아래 상자에 메뉴 드롭 다운을 클릭&#39;채널 알 수없는 2&#39;를 선택하고 입력을 클릭 거라고. 3.3.4에 3.3.2 지금 단계에서 모든 정보는 잘 A1에서 제시한다. </li><li> 방울을 포함하는 모든 후속 우물의 이름을 지정합니다. 총 설치 시간을 절약하기 위해 동시에 여러 우물을 선택하는 &#39;시프트&#39;또는 &#39;Ctrl 키를,&#39;을 클릭합니다. </li><li> 판의 디지털 묘사 메뉴의 오른쪽 하단에 물리적 판을 눌러 &#39;OK&#39;를 반영합니다. &#39;템플릿&#39;섹션 아래에있는 판 회로도의 상단에 표시되는 새 메뉴에서 &#39;다른 이름으로 저장&#39;와 이름을 선택하고 판을 저장합니다. </li><li> 화면의 왼쪽에있는 &#39;실행&#39;을 클릭하고 팝업 아웃 &quot;실행 옵션&quot;창에 적절한 염료 설정을 선택합니다. 데이터 수집 시작하고 소프트웨어에서 실시간으로 표시됩니다. </li></ol></li></ol> 4. 데이터 분석 및보고 <ol><li> 독자가 완료되고 상자 &#39;완벽한 실행&#39;라는 나타나면 &#39;확인&#39;을 클릭합니다. 참고 : 소프트도자기는 소프트웨어의 &#39;분석&#39;섹션에서 최종 데이터 파일을 표시합니다. 이 관점에서, 소프트웨어는 &#39;2D 진폭의 데이터 플롯에 선택한 모든 접시에 우물과 기본값을 가지고있다. </li><li> 양극과 음극 방울 사이의 거리를 확인합니다. NTC 우물에있는 모든 방울의 형광베이스 라인 근처에 있는지 확인합니다. </li><li> 표시된 버튼을 클릭 &#39;이벤트.&#39; 제시된 막대 그래프의 오른쪽에 &#39;총&#39;라는 이름의 상자 당 잘 받아 방울의 총 수를 표시하기 위해 하단에있는 &quot;하나&quot;라는 이름의 상자를 클릭합니다. Ctrl 키를 누른 제외 할 잘 (들)을 클릭하여 &lt;10,000 방울 (7)를 포함하는 모든 우물을 제외합니다. </li><li> 모두 타겟 NTC 우물에 부정적인 방울 위의 약 하나의 표준 편차 (500-700 형광 단위)에서 형광 임계 값을 설정하는 &#39;1D 진폭&#39;로 표시 버튼을 클릭합니다. 화면 유엔의 바로 왼쪽에두 개의 임계 버튼을 보여주는 &#39;자동 분석&#39;그것을 통해 실행하는 솔리드 핑크 수평 라인이 오른쪽에있는 아이콘을 선택 데르. </li><li> 진폭 그래프의 각에서 &#39;설정 임계 값&#39;의 왼쪽에있는 상자를 클릭하고 적절한 형광 임계 값을 입력합니다. μL 반응 당 복사본 목표 농도를 자동적으로 계산된다. 주 : 임계 값 다른 표적에 대해 동일 할 필요는 없다. </li><li> 1D 진폭 화면의 왼쪽 상단 모서리에있는 &#39;내보내기&#39;버튼을 클릭하여 .csv 파일에 결과를 보냅니다. .csv 파일에서 DNA 템플릿 μL 당 대상의 복사 ㎕의 반응에 따라 대상의 사본 (엔테로 종의 23S 유전자. 또는 HF183 마커)에서 변환 (4)에 의해 수출 목표 농도를 곱합니다. </li></ol>

<ol>
	<li>Boehm, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+forty-one+microbial+source+tracking+methods:+A+twenty-seven+lab+evaluation+study.">Performance of forty-one microbial source tracking methods: A twenty-seven lab evaluation study.</a> Water Res. 47 (18), 6812-6828 (2013).</li><li>Layton, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+human+fecal+anaerobe-associated+PCR-based+assays+in+a+multi-laboratory+method+evaluation+study.">Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study.</a> Water Res. 47 (18), 6897-6908 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+platform,+reference+material,+and+quantification+model+on+enumeration+of+Enterococcus+by+quantitative+PCR+methods.">Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods.</a> Water Res. 47 (1), 233-241 (2013).</li><li>Sivaganesan, M., Siefring, S., Varma, M., Haugland, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MPN+estimation+of+qPCR+target+sequence+recoveries+from+whole+cell+calibrator+samples.">MPN estimation of qPCR target sequence recoveries from whole cell calibrator samples.</a> J. Microbiol. Methods. 87 (3), 343-349 (2011).</li><li>Huggett, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Digital+MIQE+Guidelines:+Minimum+Information+for+Publication+of+Quantitative+Digital+PCR+Experiments.">The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments.</a> Clin. Chem. 59 (6), 892-902 (2013).</li><li>Cao, Y., Raith, M. R., Griffith, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+digital+PCR+for+simultaneous+quantification+of+general+and+human-associated+fecal+indicators+for+water+quality+assessment.">Droplet digital PCR for simultaneous quantification of general and human-associated fecal indicators for water quality assessment.</a> Water Res. 70, 337-349 (2015).</li><li>Sanders, R., Huggett, J. F., Bushell, C. A., Cowen, S., Scott, D. J., Foy, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+Digital+PCR+for+Absolute+DNA+Quantification.">Evaluation of Digital PCR for Absolute DNA Quantification.</a> Anal. Chem. 83 (17), 6474-6484 (2011).</li><li>Whale, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+microfluidic+digital+PCR+and+conventional+quantitative+PCR+for+measuring+copy+number+variation.">Comparison of microfluidic digital PCR and conventional quantitative PCR for measuring copy number variation.</a> Nucleic Acid Res. 40 (11), 82-89 (2012).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nature Methods. 10 (10), 1003-1005 (2013).</li><li>Morisset, D., &#352;tebih, D., Milavec, M., Gruden, K., &#381;el, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+food+and+feed+aamples+with+droplet+digital+PCR.">Quantitative analysis of food and feed aamples with droplet digital PCR.</a> PLoS One. 8 (5), e62583 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+molecular+community+analysis+methods+for+discerning+fecal+sources+and+human+waste.">Evaluation of molecular community analysis methods for discerning fecal sources and human waste.</a> Water Res. 47 (18), 6862-6872 (2013).</li></ol>

The authors declare that they have no competing financial interests.

프로토콜에서 몇 가지 중요한 단계가 있습니다. 마스터 믹스 종래 qPCR의 마스터 믹스보다 점성이기 때문에 먼저, 분석 혼합물의 혼합은 어렵다. 간단한 텍싱 차례로 분석 혼합물에이어서 방울에 DNA 템플릿의 비 균일 한 분포로 연결 불충분 한 혼합, 발생할 수 있습니다. 프로토콜에 설명 된 혼합 별 피펫 팅 기술은 정확한 dPCR 정량을 보장하기 위해 따라야합니다. 둘째, 물방울이 균일 한 형태와 크...

들이보다 빠르고 유연하고 전통 문화 기반 방법에 비해 특정한 때문에 정량적 PCR (qPCR에) 방법이 널리 오락 수질 모니터링 및 미생물 소스 추적 애플리케이션에 사용되어왔다. 따라서, qPCR에이 같은 엔테로 종으로 일반 배설물 지표에 대한 신속한 물 모니터링 결과를 달성하는 것이 좋습니다. 개정 USEPA 레크리에이션 수질 기준 1. 대부분의 qPCR 분석은 개발 환경이 물에 분변 오염의 소스를 식별하기위한 검증되었다. 이들 중에서도 HF183 마커 분석은 가장 자주 인간 분변 오염 연관된 3 식별하는데 사용들이다. 그들이 정량 표준 곡선에 의존하기 때문에, qPCR의 결과는 종종 편향 될 수있다. qPCR에는 스탠에서 자신의 정량주기 (Cq와)를 보간하여 샘플 대상의 알 수없는 농도를 정량화Cq와와 직렬로 희석 된 표준 세트의 로그 양 사이에 선형 관계를 설명 바 닥 곡선. 안정적이고 일관된 표준 참조 물질의 부족 때문에 크게 qPCR에 결과를 바이어스 할 수 있습니다. 연구 qPCR의 결과가 서로 다른 공급 업체의 4에서 약 절반 로그 사용 기준에 차이와 같은 공급 업체 5 표준의 다른 배치를 사용하여 2 배에 의해 것으로 나타났다. 디지털 PCR (dPCR) 기술은 균일 한 나노 리터 또는 피코 리터 반응 6 수천 또는 수백만 벌크 qPCR의 분할에 의해 생성 된 소형 PCR들의 다수의 긍정의 빈도를 카운트하여 미지 시료를 정량화한다. 파티션이 물 유 방울 (즉,이 문서) 또는 칩에 작은 챔버 경우 그것은 각각 (즉,이 문서) 방울 디지털 PCR 또는 챔버 디지털 PCR로 언급된다. 높은 샘플 농도는 대상 DNA의 존재를 야기 할파티션의 높은 비율 (따라서 긍정적 인 PCR), 포아송 분포로 근사 관계. 이와 같이, 이진 결과 (양 또는 음 PCR)이 기록되어 포지티브 액적 주파수 qPCR에 같이 표준 곡선에 대한 필요성을 제거 직접 포아송 근사 통해 미지의 샘플 농도를 계산하는데 사용된다. 디지털 PCR 정량이 진 본성은 qPCR에 7 위에 추가 이점을 제공한다. 지연 증폭 여전히 양성 PCR을 수득 할 수 있기 때문에, dPCR 정량화는 증폭 효율을 감소 억제에 대해 더 강력하다. qPCR에 8 ~ 10에 비해 dPCR 높은 정밀도로 이어지는, qPCR에있다 마찬가지로, dPCR 정량이 된 CQ 값의 변동에 의해 영향을받지 않습니다. 또한, 분할 프로세스는 효과적으로 amplificatio 동안 (기판의 경쟁을 최소화하는 각 방울에 타겟 DNA에 존재하는 매우 소량 보장qPCR에에 (즉, 분석이 동시에 두 개의 DNA 목표를 측정) 양면 인쇄를 달성하기위한 일반적인 장애물 서로 다른 DNA 대상)의 n은. 따라서, 양면 또는 단면에 실행 (즉 하나의 대상이 하나의 분석에서 측정) 여부를 dPCR 모두 대상 7,11의 거의 구별 정량을 생산하고 있습니다. 이 문서에서 설명하는 디지털 PCR 분석 (EntHF183 dPCR)의 목표는 일반 배설물 표시 엔테로 종의 동시 직접 정량화를 얻을 수 있습니다. 향상된 정밀도, 재현성 및 억제에 대한 견고성과 인간 배설물 관련 HF183 마커는 qPCR에 비교 대응. 이 분석은 성공적 환경 담수, 해수 및 각종 분뇨 7 분변 오염의 정량을 위해 사용되었지만, 또한 물 및 폐수의 다른 유형에도 적용될 수있다. 이 분석은 때문에 그것을 퇴적물 또는 토양 분석을위한 큰 약속을 보유하고억제에 높은 내성을이야,하지만 억제제는 샘플의 이러한 종류의 혼합의 추가 시험 때문에 복잡성 요구된다.

<table><tbody><tr><td>Low Bind Microtubes</td><td>Costar</td><td>3207</td><td>For storage of reagents, samples/production of master mixes</td></tr><tr><td>Nuclease Free Water</td><td>FisherSci</td><td>BP2484-50</td><td></td></tr><tr><td>TE pH 8 buffer</td><td>FisherSci</td><td>BP2473-100</td><td></td></tr><tr><td>Hardshell 96 Well Plate</td><td>BioRad</td><td>HSP-9601</td><td>For initial master mix and sample inoculation</td></tr><tr><td>Aluminum Sealing Film</td><td>BioRad</td><td>359-0133</td><td>To seal sample plate</td></tr><tr><td>Droplet Generator</td><td>BioRad</td><td>186-3002</td><td></td></tr><tr><td>Droplet Generation Oil</td><td>BioRad</td><td>186-3005</td><td></td></tr><tr><td>Cartridge</td><td>BioRad</td><td>186-4008</td><td></td></tr><tr><td>DG8 Cartridge Holder</td><td>BioRad</td><td>186-3051</td><td></td></tr><tr><td>Gasket</td><td>BioRad</td><td>186-3009</td><td></td></tr><tr><td>20 &amp;#956;l pipet tips</td><td>Rainin</td><td>GP-L10F</td><td>For tansferring sample/master mix to cartidge</td></tr><tr><td>200 &amp;#956;l pipet tips</td><td>Rainin</td><td>GP-L200F</td><td>For transferring droplets to final Twin.Tec Plate</td></tr><tr><td>Twin.Tec 96 Well Plate</td><td>Eppendorf</td><td>951020320</td><td>For final droplets thermal cycling and reading</td></tr><tr><td>Pierceable Heat Seal Foil</td><td>BioRad</td><td>181-4040</td><td>To seal Twin.Tec plate before thermalcycling</td></tr><tr><td>PX1 PCR Plate Sealer</td><td>BioRad</td><td>181-4000</td><td></td></tr><tr><td>CFX96 Thermalcycler</td><td>BioRad</td><td>CFX96 and C1000</td><td>Only the thermal cycler is needed, no optics</td></tr><tr><td>QX100 Droplet Reader</td><td>BioRad</td><td>186-3001</td><td></td></tr><tr><td>Droplet Reader Oil</td><td>BioRad</td><td>186-3004</td><td></td></tr><tr><td>Droplet PCR Supermix&amp;nbsp;</td><td>BioRad</td><td>186-3024</td><td>&lt;em&gt;i.e.&lt;/em&gt; the digital PCR mix in manuscript</td></tr><tr><td>QuantaSoft software (v1.3.2)</td><td>Quantasoft&amp;nbsp;</td><td>QX100&amp;nbsp;</td><td>For viewing, analyzing, and exporting ddPCR data</td></tr><tr><td>Entero Forward Primer (Ent F1A)</td><td>Operon</td><td>GAGAAATTCCAAACGAACTTG</td><td>Alternative vendor can be used</td></tr><tr><td>Entero Reverse Primer (Ent R1)</td><td>Operon</td><td>CAGTGCTCTACCTCCATCATT</td><td>Alternative vendor can be used</td></tr><tr><td>Entero Probe (GPL813TQ)</td><td>Operon</td><td>[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]</td><td>Alternative vendor can be used, but the florophore has to be FAM</td></tr><tr><td>HF183 Forward Primer (HF183-1)</td><td>Operon</td><td>ATCATGAGTTCACATGTCCG</td><td>Alternative vendor can be used</td></tr><tr><td>HF183 Reverse Primer (BthetR1)</td><td>Operon</td><td>CGTAGGAGTTTGGACCGTGT</td><td>Alternative vendor can be used</td></tr><tr><td>HF183 Probe (BthetP1)</td><td>Operon</td><td>[6-HEX]-CTGAGAGGAAGGTCCCCC&lt;br/&gt; ACATTGGA-[BHQ1]</td><td>Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.&amp;nbsp;</td></tr><tr><td>Positive control</td><td></td><td></td><td>Mixture of &lt;em&gt;E. faecalis&lt;/em&gt; genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing &lt;em&gt;E. faecalis&lt;/em&gt; and sequences of the ordered HF183 plasmid, please see Cao &lt;em&gt;et al.&lt;/em&gt; 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available &lt;em&gt;Enterococcus&lt;/em&gt; DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared &lt;em&gt;E. faecalis&lt;/em&gt; genomic DNA.</td></tr></tbody></table>

a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters

이 원고는 엔테로 종의 동시 정량. 인간 배설물 관련 HF183 마커에 대한 이중 디지털 PCR 분석 (EntHF183 dPCR)에 대해 설명합니다. EntHF183 이중 dPCR (EntHF183 dPCR로 함 이에 관해서) 분석은 공개 된 개별 정량 PCR (qPCR에) 대응과 같은 프라이머 및 프로브 시퀀스를 사용합니다. 마찬가지로, 이전 qPCR에 대해 수행과 같은 물 여과 및 DNA 추출 절차는 dPCR를 실행하기 전에 다음에 있습니다. 그러나, 이중 dPCR 분석은 qPCR에 분석을 통해 몇 가지 장점이 있습니다. 가장 중요한 dPCR 분석은 대상의 직접 정량화하여, 따라서 표준 곡선을 실행에 대한 필요성, 관련 바이어스 및 가변성을 제거합니다. qPCR에있는 (즉, 동시 정량) 엔테로 및 HF183를 양면 인쇄하는 동안뿐만 아니라, 종종 샘플 덜 풍부한 대상의 심각한 과소 평가로 연결, dPCR 두 목표의 일관성 정량을 제공하며, 자극그녀는 동일한 반응을 개별적으로 또는 동시에 정량. dPCR 분석도 qPCR에 의해 용인보다 높은 크기 1 ~ 2 오더이다 PCR 억제제의 농도를 허용 할 수있다. 그것은 동시에 두 개의 별도 qPCR에 분석을 실행할 필요없이 환경 바다에서 모두 일반과 인간의 관련 분변 오염에 대한 정확하고 반복 가능한 정보를 제공하기 때문에 이러한 장점은 EntHF183 dPCR 분석이 특히 매력적. qPCR에 이상 장점에도 불구하고, 현재 사용 가능한 장비와 dPCR 분석의 상부 정량 한계는 약 qPCR에 의한 달성보다 낮은 크기의 네 주문이다. 따라서, 희석 등의 일반적으로 하수 유출이 관찰 된 것과 대상 생물의 높은 농도의 측정을 위해 요구된다.

좋은 EntHF183 이중 dPCR 실행 허용 방울 (약 10,000-17,000) 및 음과 양의 물방울 7 형광 값 사이의 비교적 큰 차이 (약 5,000)의 상대적으로 높은 숫자가 발생한다. 방울의 수가 비정상적으로 낮은 가능성 액적 생성 공정에서 문제를 나타내고, 만 방울의 차단이 문서에서 사용되는 액적 dPCR 시스템으로부터 경험적 데이터에 기초하여 제시된다. 양극과 음극 방?...

Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

이 원고를 동시에 엔테로 종을 정량화하는 데 사용할 수있는 이중 디지털 PCR 분석. 레크리에이션 바다에서 일반과 인간의 관련 분변 오염의 지표로 HF183 유전자 마커를 설명합니다.

동시 정량을위한 이중 디지털 PCR 분석<em&gt; 엔테로 종.</em&gt;과 바다에서 인간 방패 관련 HF183 마커

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated ...

a-duplex-digital-pcr-assay-for-simultaneous-quantification

Research

JoVE Journal

Environment

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

9.7K 조회수.  Southern California Costal Water Research Project Authority.  이 원고를 동시에 엔테로 종을 정량화하는 데 사용할 수있는 이중 디지털 PCR 분석. 레크리에이션 바다에서 일반과 인간의 관련 분변 오염의 지표로 HF183 유전자 마커를 설명합니다. 

비디오: A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

EPA Method 1615. Measurement of Enterovirus and Norovirus Occurrence in Water by Culture and RT-qPCR. Part III. Virus Detection by RT-qPCR

EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. This method was developed with the goal of having a standardized method for use in multiple analytical laboratories during monitoring period 3 of the Unregulated Contaminant Monitoring Rule. Herein we present the protocol for extraction of viral ribonucleic acid (RNA) from water sample concentrates and for quantitatively measuring enterovirus and norovirus concentrations using reverse transcription-quantitative PCR (RT-qPCR). Virus concentrations for the molecular assay are calculated in terms of genomic copies of viral RNA per liter based upon a standard curve. The method uses a number of quality controls to increase data quality and to reduce interlaboratory and intralaboratory variation. The method has been evaluated by examining virus recovery from ground and reagent grade waters seeded with poliovirus type 3 and murine norovirus as a surrogate for human noroviruses. Mean poliovirus recoveries were 20% in groundwaters and 44% in reagent grade water. Mean murine norovirus recoveries with the RT-qPCR assay were 30% in groundwaters and 4% in reagent grade water.

Here we present a procedure to quantify enterovirus and norovirus in environmental and drinking waters using reverse transcription-quantitative PCR. Mean virus recovery from groundwater with this standardized procedure from EPA Method 1615 was 20% for poliovirus and 30% for murine norovirus.

엔테로 바이러스 및 문화와 RT-qPCR에 의해 물에서 노로 바이러스의 발생의 EPA 방법 1615 측정. 파트 III. RT-qPCR에 의한 바이러스 검출

EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. This method was developed with the goal of having a ...

연구

환경과학

Cost-effective Method for Microbial Source Tracking Using Specific Human and Animal Viruses

Microbial contamination of the environment represents a significant health risk. Classical bacterial fecal indicators have shown to have significant limitations, viruses are more resistant to many inactivation processes and standard fecal indicators do not inform on the source of contamination. The development of cost-effective methods for the concentration of viruses from water and molecular assays facilitates the applicability of viruses as indicators of fecal contamination and as microbial source tracking (MST) tools. Adenoviruses and polyomaviruses are DNA viruses infecting specific vertebrate species including humans and are persistently excreted in feces and/or urine in all geographical areas studied. In previous studies, we suggested the quantification of human adenoviruses (HAdV) and JC polyomaviruses (JCPyV) by quantitative PCR (qPCR) as an index of human fecal contamination. Recently, we have developed qPCR assays for the specific quantification of porcine adenoviruses (PAdV) and bovine polyomaviruses (BPyV) as animal fecal markers of contamination with sensitivities of 1-10 genome copies per test tube. In this study, we present the procedure to be followed to identify the source of contamination in water samples using these tools. As example of representative results, analysis of viruses in ground water presenting high levels of nitrates is shown.
Detection of viruses in low or moderately polluted waters requires the concentration of the viruses from at least several liters of water into a much smaller volume, a procedure that usually includes two concentration steps in series. This somewhat cumbersome procedure and the variability observed in viral recoveries significantly hamper the simultaneous processing of a large number of water samples.
In order to eliminate the bottleneck caused by the two-step procedures we have applied a one-step protocol developed in previous studies and applicable to a diversity of water matrices. The procedure includes: acidification of ten-liter water samples, flocculation by skimmed milk, gravity sedimentation of the flocculated materials, collection of the precipitate and centrifugation, resuspension of the precipitate in 10 ml phosphate buffer. The viral concentrate is used for the extraction of viral nucleic acids and the specific adenoviruses and polyomaviruses of interest are quantified by qPCR. High number of samples may be simultaneously analyzed using this low-cost concentration method.
The procedure has been applied to the analysis of bathing waters, seawater and river water and in this study, we present results analyzing groundwater samples. This high-throughput quantitative method is reliable, straightforward, and cost-effective.

The study describes a cost-effective method for the identification of the source of fecal/urine contamination or contamination by nitrates in water using qPCR for the specific quantification of human/porcine/bovine DNA viruses, adenoviruses and polyomaviruses, proposed as MST tools.

특정 인간과 동물 바이러스를 사용하여 미생물 소스 추적을위한 비용 효율적인 방법

Microbial contamination of the environment represents a significant health risk. Classical bacterial fecal indicators have shown to have significant ...

면역학 및 감염병학

Multiplex Detection of Bacteria in Complex Clinical and Environmental Samples using Oligonucleotide-coupled Fluorescent Microspheres

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated to a microbiota dominated by a number of bacterial species, including Gardnerella vaginalis, Atopobium vaginae, and others1-3. This condition is associated with a range of negative health outcomes, including HIV acquisition4, and it can be difficult to manage clinically5. Furthermore, diagnosis of BV has relied on the use of Gram stains of vaginal swab smears that are scored on various numerical criteria6,7. While this diagnostic is simple, inexpensive, and well suited to resource-limited settings, it can suffer from problems related to subjective interpretations and it does not give a detailed profile of the composition of the vaginal microbiota8. Recent deep sequencing efforts have revealed a rich, diverse vaginal microbiota with clear differences between samples taken from individuals that are diagnosed with BV compared to those individuals that are considered normal9,10, which has resulted in the identification of a number of potential targets for molecular diagnosis of BV11,12. These studies have provided a wealth of useful information, but deep sequencing is not yet practical as a diagnostic method in a clinical setting. We have recently described a method for rapidly profiling the vaginal microbiota in a multiplex format using oligonucleotide-coupled fluorescent beads with detection on a Luminex platform13. This method, like current Gram stain-based methods, is rapid and simple but adds the additional advantage of exploiting molecular knowledge arising from sequencing studies in probe design. This method therefore provides a way to profile the major microorganisms that are present in a vaginal swab that can be used to diagnose BV with high specificity and sensitivity compared to Gram stain while providing additional information on species presence and abundance in a semi-quantitative and rapid manner. This multiplex method is expandable well beyond the range of current quantitative PCR assays for particular organisms, which is currently limited to 5 or 6 different assays in a single sample14. Importantly, the method is not limited to the detection of bacteria in vaginal swabs and can be easily adapted to rapidly profile nearly any microbial community of interest. For example, we have recently begun to apply this methodology to the development of diagnostic tools for use in wastewater treatment plants.

We describe a multiplex method for the detection of microorganisms within a sample using oligonucleotide-coupled fluorescent beads. Amplicon from all organisms within a sample is hybridized to a panel of probe-coupled beads. A Luminex or Bio-Plex instrument is used to query each bead for bead type and hybridization signal.

Oligonucleotide - 결합 형광등 Microspheres를 사용하여 복잡한 임상 및 환경 샘플에서 박테리아의 멀티 플렉스 감지

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated ...

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation into thousands of nano-sized water-in-oil individual reactions. Recently, ddPCR has become one of the most accurate and sensitive tools for circulating tumor DNA (ctDNA) detection. One of the major limitations of the standard ddPCR technique is the restricted number of mutations that can be screened per reaction, as specific hydrolysis probes recognizing each possible allelic version are required. An alternative methodology, the drop-off ddPCR, increases throughput, since it requires only a single pair of probes to detect and quantify potentially all genetic alterations in the targeted region. Drop-off ddPCR displays comparable sensitivity to conventional ddPCR assays with the advantage of detecting a greater number of mutations in a single reaction. It is cost-effective, conserves precious sample material, and can also be used as a discovery tool when mutations are not known a priori.

Here, we present a protocol to accurately quantify multiple genetic alterations of a target region in a single reaction using drop-off ddPCR and a unique pair of hydrolysis probes.

하나의 물방울 디지털 연쇄 반응 핫스팟 지역에서 돌연변이의 포괄적이 고 동시 검색

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation ...

유전학

A Modified EPA Method 1623 that Uses Tangential Flow Hollow-fiber Ultrafiltration and Heat Dissociation Steps to Detect Waterborne Cryptosporidium and Giardia spp.

Cryptosporidium and Giardia species are two of the most prevalent protozoa that cause waterborne diarrheal disease outbreaks worldwide. To better characterize the prevalence of these pathogens, EPA Method 1623 was developed and used to monitor levels of these organisms in US drinking water supplies 12. The method has three main parts; the first is the sample concentration in which at least 10 L of raw surface water is filtered. The organisms and trapped debris are then eluted from the filter and centrifuged to further concentrate the sample. The second part of the method uses an immunomagnetic separation procedure where the concentrated water sample is applied to immunomagnetic beads that specifically bind to the Cryptosporidium oocysts and Giardia cysts allowing for specific removal of the parasites from the concentrated debris. These (oo)cysts are then detached from the magnetic beads by an acid dissociation procedure. The final part of the method is the immunofluorescence staining and enumeration where (oo)cysts are applied to a slide, stained, and enumerated by microscopy.
Method 1623 has four listed sample concentration systems to capture Cryptosporidium oocysts and Giardia cysts in water: Envirochek filters (Pall Corporation, Ann Arbor, MI), Envirochek HV filters (Pall Corporation), Filta-Max filters (IDEXX, Westbrook, MA), or Continuous Flow Centrifugation (Haemonetics, Braintree, MA). However, Cryptosporidium and Giardia (oo)cyst recoveries have varied greatly depending on the source water matrix and filters used1,14. A new tangential flow hollow-fiber ultrafiltration (HFUF) system has recently been shown to be more efficient and more robust at recovering Cryptosporidium oocysts and Giardia cysts from various water matrices; moreover, it is less expensive than other capsule filter options and can concentrate multiple pathogens simultaneously1-3,5-8,10,11. In addition, previous studies by Hill and colleagues demonstrated that the HFUF significantly improved Cryptosporidium oocysts recoveries when directly compared with the Envirochek HV filters4. Additional modifications to the current methods have also been reported to improve method performance. Replacing the acid dissociation procedure with heat dissociation was shown to be more effective at separating Cryptosporidium from the magnetic beads in some matrices9,13 .
This protocol describes a modified Method 1623 that uses the new HFUF filtration system with the heat dissociation step. The use of HFUF with this modified Method is a less expensive alternative to current EPA Method 1623 filtration options and provides more flexibility by allowing the concentration of multiple organisms.

A Modified EPA Method 1623 that Uses Tangential Flow Hollow-fiber Ultrafiltration and Heat Dissociation Steps to Detect Waterborne Cryptosporidium and Giardia spp.

This protocol describes the use of a tangential flow hollow-fiber ultrafiltration sample concentration system and a heat dissociation as alternative steps for the detection of waterborne Cryptosporidium and Giardia species using EPA Method 1623.

Waterborne를 검색하는 접선 흐름 빈 섬유 Ultrafiltration 및 열 분해 단계를 사용 수정일 EPA 방법 1,623<em&gt; Cryptosporidium</em&gt;과<em&gt; Giardia SPP.</em

Cryptosporidium and Giardia species are two of the most prevalent protozoa that cause waterborne diarrheal disease outbreaks worldwide. To better ...

Capture of Environmental DNA (eDNA) from Water Samples by Flocculation

The analysis of environmental DNA (eDNA) has become a widely used approach to problem solving in species management. The detection of cryptic species including invasive and (or) species at risk is the goal, typically accomplished by testing water and sediment for the presence of characteristic DNA signatures. Reliable and efficient procedures for the capture of eDNA are required, especially those that can be performed easily in the field by personnel with limited training and citizen scientists. The capture of eDNA using membrane filtration is widely used currently. This approach has inherent issues that include the choice of filter material and porosity, filter fouling, and time required on site for the process to be performed. Flocculation offers an alternative that can be easily implemented and applied to sampling regimes that strive to cover broad territories in limited time.

Capture of Environmental DNA eDNA from Water Samples by Flocculation

Environmental DNA (eDNA) is typically captured from water samples using alcohol precipitation, filtration, or flocculation. Presented here is an alternative protocol that uses lanthanum chloride to enable collection of dissolved and particulate-bound nucleic acids from water samples containing eukaryotic cells, prokaryotic cells, and virus.

The analysis of environmental DNA (eDNA) has become a widely used approach to problem solving in species management. The detection of cryptic species ...

Development and Testing of Species-specific Quantitative PCR Assays for Environmental DNA Applications

New, non-invasive methods for detecting and monitoring species presence are being developed to aid in fisheries and wildlife conservation management. The use of environmental DNA (eDNA) samples for detecting macrobiota is one such group of methods that is rapidly becoming popular and being implemented in national management programs. Here we focus on the development of species-specific targeted assays for probe-based quantitative PCR (qPCR) applications. Using probe-based qPCR offers greater specificity than is possible with primers alone. Furthermore, the ability to quantify the amount of DNA in a sample can be useful in our understanding of the ecology of eDNA and the interpretation of eDNA detection patterns in the field. Careful consideration is needed in the development and testing of these assays to ensure the sensitivity and specificity of detecting the target species from an environmental sample. In this protocol we will delineate the steps needed to design and test probe-based assays for the detection of a target species; including creation of sequence databases, assay design, assay selection and optimization, testing assay performance, and field validation. Following these steps will help achieve an efficient, sensitive, and specific assay that can be used with confidence. We demonstrate this process with our assay designed for populations of the mucket (Actinonaias ligamentina), a freshwater mussel species found in the Clinch River, USA.

Environmental DNA assays require rigorous design, testing, optimization and validation before the collection of field data can begin. Here, we present a protocol to take users through each step of designing a species-specific, probe-based qPCR assay for the detection and quantification of a target species DNA from environmental samples.

환경 DNA 응용을 위한 종별 정량PCR 분석의 개발 및 시험

New, non-invasive methods for detecting and monitoring species presence are being developed to aid in fisheries and wildlife conservation management. The ...

Foodborne Pathogen Screening Using Magneto-fluorescent Nanosensor: Rapid Detection of E. Coli O157:H7

Enterohemorrhagic Escherichia coli O157:H7 has been linked to both waterborne and foodborne illnesses, and remains a threat despite the food- and water-screening methods used currently. While conventional bacterial detection methods, such as polymerase chain reaction (PCR) and enzyme-linked immunosorbent assays (ELISA) can specifically detect pathogenic contaminants, they require extensive sample preparation and lengthy waiting periods. In addition, these practices demand sophisticated laboratory instruments and settings, and must be executed by trained professionals. Herein, a protocol is proposed for a simpler diagnostic technique that features the unique combination of magnetic and fluorescent parameters in a nanoparticle-based platform. The proposed multiparametric magneto-fluorescent nanosensors (MFnS) can detect E. coli O157:H7 contamination with as little as 1 colony-forming unit present in solution within less than 1 h. Furthermore, the ability of MFnS to remain highly functional in complex media such as milk and lake water has been verified. Additional specificity assays were also used to demonstrate the ability of MFnS to only detect the specific target bacteria, even in the presence of similar bacterial species. The pairing of magnetic and fluorescent modalities allows for the detection and quantification of pathogen contamination in a wide range of concentrations, exhibiting its high performance in both early- and late-stage contamination detection. The effectiveness, affordability, and portability of the MFnS make them an ideal candidate for point-of-care screening for bacterial contaminants in a wide range of settings, from aquatic reservoirs to commercially packaged foods.

Foodborne Pathogen Screening Using Magneto-fluorescent Nanosensor: Rapid Detection of E. Coli O157:H7

The overall goal of this protocol is to synthesize functional nanosensors for the portable, cost-effective, and rapid detection of specifically targeted pathogenic bacteria through a combination of magnetic relaxation and fluorescence emission modalities.

E. 콜라이 O157:H7의 Foodborne 병원 체 검사를 사용 하 여 자기 형광 Nanosensor: 신속한 감지

Enterohemorrhagic Escherichia coli O157:H7 has been linked to both waterborne and foodborne illnesses, and remains a threat despite the food- and ...

Amplification of Escherichia coli in a Continuous-Flow-PCR Microfluidic Chip and Its Detection with a Capillary Electrophoresis System

Polymerase chain reaction (PCR) is a traditional method employed for the amplification of a target gene that has played an important role in biomolecular diagnostics. However, traditional PCR is very time-consuming because of the low-temperature variation efficiency. This work proposes a continuous-flow-PCR (CF-PCR) system based on a microfluidic chip. The amplification time can be greatly reduced by running the PCR solution into a microchannel placed on heaters set at different temperatures. Moreover, as capillary electrophoresis (CE) is an ideal way to differentiate positive and false-positive PCR products, a CE system was built to achieve efficient separation of the DNA fragments. This paper describes the process of amplification of Escherichia coli (E. coli) by the CF-PCR system built in-house and the detection of the PCR products by CE. The results demonstrate that the target gene of E. coli was successfully amplified within 10 min, indicating that these two systems can be used for the rapid amplification and detection of nucleic acids.

Amplification of Escherichia coli in a Continuous-Flow-PCR Microfluidic Chip and Its Detection with a Capillary Electrophoresis System

This protocol describes how to build a continuous-flow-polymerase chain system based on a microfluidic chip and how to build a capillary electrophoresis system in the lab. It presents a simple method for the analysis of nucleic acids in the lab.

연속 유동 PCR 미세유체 칩에서 대장균 의 증폭 및 모세관 전기영동 시스템을 사용한 검출

Polymerase chain reaction (PCR) is a traditional method employed for the amplification of a target gene that has played an important role in biomolecular ...

생체공학

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. coli O157:H7 by targeting ORF Z3276. With this assay, we can detect as low as a few copies of the genome of DNA of E. coli O157:H7. The sensitivity and specificity of the assay were confirmed by intensive validation tests with a large number of E. coli O157:H7 strains (n = 369) and non-O157 strains (n = 112). Furthermore, we have combined propidium monoazide (PMA) procedure with the newly developed qPCR protocol for selective detection of live cells from dead cells. Amplification of DNA from PMA-treated dead cells was almost completely inhibited in contrast to virtually unaffected amplification of DNA from PMA-treated live cells. Additionally, the protocol has been modified and adapted to a 96-well plate format for an easy and consistent handling of a large number of samples. This method is expected to have an impact on accurate microbiological and epidemiological monitoring of food safety and environmental source.

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A qPCR assay was developed for detection of Escherichia coli O157:H7 targeting a unique genetic marker, Z3276. The qPCR was combined with propidium monoazide (PMA) treatment for live cell detection. This protocol has been modified and adapted to a 96-well plate format for easy and consistent handling of numerous samples

라이브의 검출<em&gt; 대장균</em&gt; O157 : PMA-qPCR에 의한 H7 셀

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

동시 정량을위한 이중 디지털 PCR 분석

요약

더 많은 비디오 탐색

이 비디오의 챕터