Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

Summary

Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Abstract

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.

Introduction

The concept of maternal immune activation (MIA) originates from the epidemiology studies on the association of maternal infection with autism and schizophrenia¹. Due to the absence of detectable replicating viral pathogens in the placenta or the fetal brain after maternal viral infection^2,3, the effect of the infection on the offspring is hypothesized to be caused by the activation of the maternal immune system rather than the pathogens themselves.

To elucidate the cause-and-effect relationship between MIA and psychiatric disorders, injection of chemically synthesized, viral mimic double stranded RNA polyinosinic:polycytidylic acid (poly(I:C)) into pregnant rodents has been widely used as the animal model for MIA^4,5. Poly(I:C) is recognized by toll-like receptor 3 (TLR3), and systemic administration of poly(I:C) induces viral-like acute inflammatory response. One of the mechanisms by which poly(I:C) produces behavioral abnormalities and neuropathologies in the offspring is by causing an imbalance of pro- and anti- inflammatory cytokines in the maternal-placental-fetal axis⁶. Several groups have adopted the MIA model to understand the etiology of psychiatric disorders⁷, and due to the diverse interests among research groups, various time points of immune activation have been used to achieve different perturbations on brain development and behaviors⁷.

The Paul H. Patterson laboratory at the California Institute of Technology adopts the strategy of injecting poly(I:C) into pregnant mice at embryonic 12.5 days (E12.5), which has successfully demonstrated that MIA is capable of inducing behavioral, neurological, and immunological changes in the offspring that are associated with autism and schizophrenia^8-11. Our prior works show that MIA offspring display behavioral abnormalities (e.g., social impairment, communication deficit, repetitive behavior, anxiety-like behavior, and latent inhibition deficit^8,10,12), immune dysregulation and cytokines imbalance^8,13,14, alteration of fetal brain gene expression¹⁵, loss of Purkinje cell in lobule VII of cerebellum¹¹, alteration of synaptic properties in hippocampus⁹, gene x environment interaction¹³, alteration of gut permeability, and gut microbiota composition¹⁶. Furthermore, therapeutic and prophylactic strategies are also developed from this model system^13,16,17. By inducing MIA at E12.5, others have shown that MIA produces fetal microglial activation and cholinergic developmental alteration in basal forebrain¹⁸, strain specific interaction¹⁹, brain cerebral synaptosomal ultrastructural abnormalities, cerebral mitochondrial respiratory chain hyperfunction abnormalties, downregulation of cerebral synaptosomal molecules¹⁷, depressive-like behaviors, impairment in cognition and hippocampal long-term potentiation (LTP), and deficit of adult hippocampal neurogenesis²⁰.

Here, we provide a detailed method of how to induce MIA at E12.5 by poly(I:C), as well as paradigms of how to apply this model to study the etiology of autism and schizophrenia. It is important to note that MIA is a risk factor for a variety of disorders⁴, and its outcomes are extremely sensitive to the time and method of induction as well as the husbandry of the pregnant dams. As such, even minor inconsistencies between laboratories often result in low reproducibility and/or different phenotypes in the offspring. Our method is specifically designed for those interested in studying MIA as an environmental risk factor for autism and schizophrenia, and the detailed description provided will help researchers improve the reproducibility of their data.

Protocol

All protocols were performed under the approval of the California Institute of Technology Institutional Animal Care and Use Committee (IACUC).

1. Preparation for Timed-mating Pairs

1. Use at least 6 dams for behavioral experiments and 3 for gene expression analysis.
   NOTE: Use double the number of estimated female mice, as only about 50% of the mice will be plugged from the timed-mating.
2. Use female mice with no prior pregnancy and at 8-16 weeks of age.
   NOTE: Female mice that have prior sexual exposure to male mice but have not been pregnant are acceptable.
3. House the female mice together and place the cages next to each other in order to synchronize their estrous cycle. Use a standard mice cage with a height of over 5.5 inches and a 75 square inch interior floor to allow housing of 5 adult mice. Label each female mouse using an ear punch.

2. Setting up Timed-mating Pair

1. Set up the timed-mating 0-2 hr before the dark cycle begins. Place two female mice in each cage. Take out the mice and weigh them individually. Record the body weight of each female mouse.
2. Place one male mouse into each cage with the two female mice. Use trio mating to minimize the paternal confounding effect.

3. Vaginal Plug Check (E0.5)

1. Check the female mice 0-4 hr after the dark cycle ends. Gently lift the female mouse from the base of the tail and allow the mouse to grab the wire grid, cage top, or cage edge.
2. Search for signs of vaginal plug: vaginal plug is a visible whitish mass in the vaginal opening. If the plug is not obvious, gently insert a 200 µl pipette tip into the vaginal opening. Resistance from coagulation confirms vaginal plug formation. Check the vaginal plug once per day.
   NOTE: Vaginal plug is only an indication that copulation has occurred, and therefore does not guarantee pregnancy. Vaginal plug may be difficult to identify in certain strains of mice. Seek help from an experienced mice caregiver to increase the accuracy of plug identification.
3. Move the plugged mice to a new cage and group house them. Define the day of vaginal plug appearance as embryonic 0.5 day (E0.5).

4. On E10.5-11.5, Check for Pregnancy

1. Gently lift the base of the tail and allow the mouse to grab the wire grid, cage top, or cage edge. Observe the abdomen area to check for signs of pregnancy, e.g., a bulge in the abdomen (Figure 1).
   NOTE: The sign of pregnancy is always more obvious at E11.5 than at E10.5.
2. Weigh the mice to verify pregnancy. The pregnant mouse generally weighs about 20% heavier at E10.5 and 30% heavier at E12.5 compared to a non-pregnant mouse (Figure 2). Single house the pregnant mice in clean cages.

5. 20 mg/kg Poly(I:C) Preparation

1. Use at least 6 dams per group for behavioral experiments and 3 per group for gene expression analysis. Prepare the corresponding amount of poly(I:C) solution.
2. Weigh the poly(I:C) powder in a 50 ml conical tube to make a final concentration of 40 mg/ml. In order to minimize and standardize the stress caused by injection volume, inject 5 µl of poly(I:C) solution for each gram of mouse body weight (5 µl/g, or 5 ml/kg). To induce MIA, we inject 20 mg of poly(I:C) per kg.
   NOTE: The concentration of poly(I:C) solution needed is (20 mg/kg)/(5 ml/kg) = 4 mg/ml. Since the poly(I:C) powder contains 10% poly(I:C), we need to make a final concentration of (4 mg/ml)/0.1= 40 mg/ml of poly(I:C) solution.
   CAUTION: The poly(I:C) powder is very light. Be careful not to lose any powder while transferring from the spatula to the conical tube.
3. Add the corresponding volume of 0.9% sodium chloride (saline) into the conical tube and close the cap. Dissolve the powder by gently rolling the saline droplet over the poly(I:C) powder until the solution is clear. Centrifuge the conical tube at 800 x g for 1 min (Figure 3C). Filter the poly(I:C) solution by 0.22 µm filter. Transfer the poly(I:C) solution to an 1.5 or 2 ml microcentrifuge tube. Optional: Use a spectrophotometer to measure the 260/280 ratio of the poly(I:C) solution. Ensure the ratio is between 1.54-1.82 (Figure 3) as described by the manufacturer. NOTE: The saline used to dissolve poly(I:C) powder and serve as control injection should be sterile and pharmaceutical grade.

6. Saline or Poly(I:C) Injection on E12.5

1. Weigh the mouse on the scale and put it back into the cage. Use the following formula to calculate the volume of injection for both saline and poly(I:C) mice: body weight (g) multiplied by 5 = desired injection volume (µl). Use a 0.3 ml insulin syringe to draw up the calculated volume of saline or 20 mg/kg poly(I:C) solution, e.g., 150 µl for a 30 g mouse.
2. Gently pick up the mouse by the base of the tail and place it on top of the cage. Handle the mouse gently to avoid confounding effects induced by stress. Insert the needle, bevel up, at approximately 20° relative to the mouse into the center of its two upper nipples (Figure 4), and inject the saline or poly(I:C) solution. NOTE: The needle should be replaced for each mouse after injection. 
3. Place the mouse back to its home cage. Place the cages in a quiet, low traffic room to avoid the other confounding effects.

7. The Day After Poly(I:C) Injection (E13.5)

1. Check the injected mice on the following morning. Use a scale to measure body weight.
   NOTE: Poly(I:C) injected pregnant mice usually gain less weight than saline injected mice on the day after injection.
2. Do not disturb the mice until the offspring are born.

8. Gauge of MIA Offspring

1. In order to minimize the confounding effects of MIA induction, follow the guidelines listed below to gauge the usage of MIA offspring.
   1. Exclude the litters from preterm or delayed birth, or if the litter size is smaller than 5.
   2. Euthanize the excessive pups by CO₂ if the litter size is larger than 10.

9. Optional: Examine the Acute Inflammatory Response After MIA

1. Sacrifice the pregnant mice 3 hr after saline or poly(I:C) injection using the method described in the institution's animal care committee-approved protocol.
   NOTE: Cervical dislocation is often preferred as it minimizes the effect of CO₂/euthanasia drugs on the dam and embryo.
2. Collect the spleen from the adult pregnant mice and isolate the placenta and fetal brain under the stereomicroscope.
   1. For spleen collection, lay the mouse on the dissection plate and spray 70% ethanol on the abdominal area of the pregnant mice. Use a pair of sterile scissors to make a vertical cut in the center of abdominal area below the ribcage through the skin.
   2. The spleen sits in the left superior abdominal quadrant. Use forceps to isolate the spleen. Roll the spleen on delicate task wipers to remove the fatty tissue around the organ. Collect roughly 50 mg of splenic tissue and place them individually in Eppendorf tubes with 500 µl RNA stabilize buffer or TRIzol to prevent nucleic acid degradation. Store the samples at -80 °C freezer until use.
   3. For placenta collection, gently pull out the uterine horns from the body. Place the uterine horns in a Petri dish filled with autoclaved phosphate buffered saline (PBS) and leave the dish on ice. Use two forceps to tear open the uterine wall and expose the amniotic sac.
      1. Carefully use the forceps to open the amniotic sac without damaging the placenta and the fetus. Separate the placenta from the fetus and cut the umbilical cord as close to the placenta as possible. Remove the amniotic sac debris from the placenta. Place the placenta individually in Eppendorf tubes with 500 µl RNA stabilize buffer or TRIzol. Store the sample at -80 °C freezer until use.
   4. For fetal brain collection, store the fetus in RNA stabilize buffer from step 9.2.2 until dissection. Tease off the pial membrane from the ventricle of the brain using delicate #5 forceps under the stereomicroscope. Carefully remove all the membrane from the fetal brain. Place the fetal brains individually in Eppendorf tubes with 500 µl RNA stabilize buffer or TRIzol. Store the sample at -80 °C freezer until use.
3. Extract the RNA from the tissue and convert the RNA to cDNA. Analyze the Il6 gene expression in the cDNA by real-time PCR .
4. Extract the RNA from the tissues by following the manufacture protocol of TRIzol. If the tissues are stored in RNA stabilization buffer. Thaw the sample and spin down the buffer. Transfer the tissue by tip to another eppendorf with 500 µl TRIzol and continue RNA extraction.
5. Use a spectrophotometer to measure the concentration, 260/280 and 260/230 ratio of the RNA. Ensure the ratios are above 2.0.
6. Eliminate the DNA contamination by treated the RNA with DNase I. Mix 1 µg RNA, 1 µl 10X reaction buffer, 1 µl RNase-Free DNase, and nuclease-free water to a final volume of 10 µl. Incubate the master mix at 37 °C for 30 min. Add 1 µl DNase stop solution to terminate the reaction. Incubate the mixture at 65 °C for 10 min.
7. Reverse transcribe the RNA to cDNA. Use 20 µl reactions, and up to 1 µg of total RNA per reaction. Mix 4 µl 5x reverse transcription (RT) reaction mix buffer, 1 µl reverse transcriptase, 11 µl RNA template after the treatment with DNase I and 4 µl nuclease-free H₂O to make a final 20 µl solution. Program the thermal cycler conditions for RT. A generic condition include: Step 1: 25 °C for 5 min; Step 2: 42 °C for 30 min; Step 3: 85 °C for 5 min; Step 4: hold at 4 °C. Dilute the cDNA 5 times. For short-term storage, store the cDNA at 4°C. For long-term storage, freeze the cDNA at -20 °C.
8. Analyze the Il6 gene expression in the cDNA by real-time PCR and normalize the Il6 gene expression to β-actin gene expression.
   1. Make a master mix for Il6 and β-actin detection. Use 25 µl reaction, the master mix for each gene includes 12.5 µl SYBR Green Mix, 0.5 µl of 10 µM forward primer, 0.5 µl of 10 µM reverse primer and 6.5 µl nuclease-free H₂O.
   2. Place 5 µl 5x diluted cDNA at the bottom of the well of optical 96-well reaction plate. Pipette 20 µl of master mix to each well to make a final 25 µl PCR mix. Triplicate each gene for each sample. Seal the plate by using optical adhesive film. Spin down the plate at 800 x g for 3 min at 4 °C Use the standard program of real-time PCR: Step 1: 50 °C for 2 min; Step 2: 95 °C for 10 min; Step 3: 40 cycles of 95 °C for 15 sec and temperature 60 °C for 1 min. Add an additional step for dissociation curve.

10. Examine the Behavioral Abnormalities in MIA Adult Offspring (Optional):

1. Perform the behavior tests at the ages of 8-12 weeks. Change the cage bedding at least 3 days before the test. Acclimate the mice to the behavioral testing room at least 30 min before the test.
2. For prepulse inhibition (PPI), restrain the mice in plexiglass cylinder with a piezo-electric sensor underneath it. Acclimate the mice to the PPI chamber for 5 min. Expose the mice with 6 trials of 120 dB white noise (startle).
3. Then expose the mice with randomized mixtures of 14 trials of background noise, 14 trials of Startle, 14 trials of prepulse 5 dB (5 dB higher than background noise) + Startle (PPI5), and 14 trials of prepulse 15 dB (15 dB higher than background noise + Startle (PPI15).
4. Average the startle response for the first 6 trials of 120 dB trials. Average the startle response for the other individual stimulations. Covert the value to prepulse inhibition by (Startle - PPI5 or PPI15)/Startle.
5. For open-field test, place the mouse in the corner of an open square arena (50 x 50 x 50 cm³). Record the trajectory of the mouse for 10 min through a ceiling mounted camera. Define the center of the arena as the center zone (17 x 17 cm²). Quantify the distance traveled, center zone entries, and time spent in center zone manually or by image-based automatic analysis software.
6. For marble burying test, acclimate the mouse to a test cage with compressed 5cm deep, clean, Aspen pine bedding for 10 min. Return the mouse to its homecage. Gently place 20 navy blue 1.5 cm diameter glass marbles in the fashion of 4 x 5 arrangement. Place the mouse back to the test cage with marbles for 10 min. Count the marbles that has been buried in the 10 min testing duration.

11. Examine the Cerebellar Neuropathology in MIA Adult Offspring (Optional):

1. Euthanize the saline and MIA adult offspring by anesthetic. Perfuse the mouse with 50 ml PBS and subsequently 50 ml 4% paraformaldehyde through the cardiovascular system.
2. Remove the brain carefully and postfix the brain in 4% paraformaldehyde overnight at 4 °C. Rinse the brain with PBS three times and store the brain in PBS with 0.02% sodium azide in a 4 °C fridge until use.
   NOTE: The postfixed brain can be stored in PBS with 0.02% sodium azide in the fridge for up to a month.
3. Section the brain into 50 µm thin slices sagittally using vibratome. Collect the brain sections using a soft brush pen. Terminate the endogenous peroxidase activity by incubating the sections in 0.6% hydrogen peroxide for 30 min at room temperature.
4. Incubate the sections in anti-calbindin antibody diluted in the blocking buffer (10% goat serum with 0.1% Triton X-100 and 0.02% sodium azide in PBS) overnight at room temperature. Then incubate the sections in corresponding biotinylated secondary antibody diluted in blocking buffer for 2 hr at room temperature.
5. Incubate the sections in avidin DH - Biotinylated peroxidase H complex buffer to detect the biotin for 1 hr at room temperature. Develop the sections by using peroxidase substrate to visualize the antigen. Wash the sections with PBS three times in between the steps. Mount the sections onto microscope slides. Image the sections under the microscope.

Results

Injection of 20 mg/kg poly(I:C) at E12.5 could evoke an acute inflammatory response in the maternal-placental-fetal axis and precipitate a chronic effect to brain development and behavioral phenotypes^12,13. Elevated levels of a proinflammatory cytokine, Interleukin (IL)-6, is a reliable indicator of acute inflammatory response after MIA. The peak time for Il6 gene expression in the placenta and fetal brain is at 3 hr post-poly(I:C) injection^12,13. We have sh...

Discussion

MIA induction at different time windows perturbs different brain development events in rodents, and consequently leads to different behavioral abnormalities and neuropathologies in the offspring. Here, we described a protocol to induce MIA in mice with poly(I:C) injection at E12.5. This method of MIA induction leads to behavioral, neurological, immunological, and gastrointestinal abnormalities associated with autism and schizophrenia in the offspring^8,10,11,16. It is important to note that, because MIA is an e...

Materials

Name	Company	Catalog Number	Comments
Polyinosinic–polycytidylic acid potassium salt	SIGMA	P9582
0.9% sodium chloride INJ. USP	HOSPIRA	NDC 0409-4888-10
MONOJECT insuline syrinage 3/10 mL 29G x 1/2"	COVIDIEN	8881600145
50 ml conical screw cap tubes	USA SCIENTIFIC	1500-1211
Nanodrop 1000 spectrophotometer	THERMO SCIENTIFIC	1000	Optional
Stereomicroscope	Wild Heerbrugg	M5A	Optional
Dumont #5 Forceps Inox Tip Size .10 X .06mm	Roboz	RS-5045	Optional
RNAlater RNA stabilization reagent	Qiagen	76104	Optional
TRIzol reagent	Life Technologies	15596-026	Optional
RQ1 Rnase-free DNase	Promega	M610A	Optional
iScript cDNA synthesis kit	Bio-Rad	170-8891	Optional
FastStart universal SYBR green master mix with ROX	Roche	4913922001	Optional
Real-time PCR	ABI	7300	Optional
Primer: Il6 forward	Life Technologies	TAGTCCTTCCTACCCCAATTTCC	Optional
Primer: Il6 Reverse	Life Technologies	TTGGTCCTTAGCCACTCCTTC	Optional
Primer: beta-actin forward	Life Technologies	AGAGGGAAATCGTGCGTGAC	Optional
Primer: beta-actin Reverse	Life Technologies	CAATAGTGATGACCTGGCCGT	Optional
MicroAmp optical 96-well reaction plate	Life Technologies	4306737	Optionl
MicroAmp optical adhesive film	Life Technologies	4311971	Optionl
EthoVision	Noldus	EthoVision	Optionl
SR-LAB apparatus (PPI)	San Diego Instruments	SR-LAB	Optionl
Marbles	PENN-PLAX	Blue gem stones marbles	Optionl
Dulbecco's Phosphate-Buffered Saline (DPBS)	Life Technologies	21600-069	Optionl
Paraformaldehyde	MACRON	2621-59	Optionl
Vibratome	Leica	VT1000 S	Optionl
Sodium azide	Sigma	S2002	Optionl
Triton x-100	Sigma	X100	Optionl
Hydrogen peroxide solution	Sigma	18312	Optionl
Goat serum	Vector Laboratories	S-1000	Optionl
Rabbit anti-calbindin antibody	Abcam	ab11426	Optionl
Biotinlyated goat anti-rabbit IgGantibody	Vector Laboratories	BA-1000	Optionl
VECTASTAIN ABC Kit	Vector Laboratories	PK-4000	Optionl