JoVE Logo

Sign In

A subscription to JoVE is required to view this content. Sign in or start your free trial.

In This Article

  • Summary
  • Abstract
  • Introduction
  • Protocol
  • Results
  • Discussion
  • Disclosures
  • Acknowledgements
  • Materials
  • References
  • Reprints and Permissions

Summary

This manuscript describes a method for labeling individual messenger RNA (mRNA) transcripts with fluorescently-labeled DNA probes, for use in single-molecule fluorescence in situ hybridization (smFISH) experiments in E. coli. smFISH is a visualization method that allows the simultaneous detection, localization, and quantification of single mRNA molecules in fixed individual cells.

Abstract

A method is described for labeling individual messenger RNA (mRNA) transcripts in fixed bacteria for use in single-molecule fluorescence in situ hybridization (smFISH) experiments in E. coli. smFISH allows the measurement of cell-to-cell variability in mRNA copy number of genes of interest, as well as the subcellular location of the transcripts. The main steps involved are fixation of the bacterial cell culture, permeabilization of cell membranes, and hybridization of the target transcripts with sets of commercially available short fluorescently-labeled oligonucleotide probes. smFISH can allow the imaging of the transcripts of multiple genes in the same cell, with limitations imposed by the spectral overlap between different fluorescent markers. Following completion of the protocol illustrated below, cells can be readily imaged using a microscope coupled with a camera suitable for low-intensity fluorescence. These images, together with cell contours obtained from segmentation of phase contrast frames, or from cell membrane staining, allow the calculation of the mRNA copy number distribution of a sample of cells using open-source or custom-written software. The labeling method described here can also be applied to image transcripts with stochastic optical reconstruction microscopy (STORM).

Introduction

Stochasticity is a fundamental and unavoidable aspect of gene expression and gives rise to cell-cell heterogeneity1, both at the level of transcripts and proteins2,3. Quantifying the variability between cells under well-defined conditions offers a unique window into the basic processes that underlie gene expression and its regulation. One important source of cell-cell heterogeneity in bacteria takes place at the transcriptional level. Transcript numbers vary not only due to the stochasticity of transcription, but also to post-transcriptional processes such as regulation by small RNAs and RNAases2. One way of directly accessing this heterogeneity in a quantitative fashion is by fluorescently tagging individual transcripts of a given gene in smFISH. This methodology allows the detection and subcellular localization of particular RNA molecules in fixed, individual bacterial cells4. mRNAs are hybridized with a set of fluorescently-labeled ~20 base-long oligonucleotides that are designed to bind selectively to transcripts of interest5,6. Multiple labeling ensures detection above background fluorescence, and individual mRNA molecules appear as diffraction-limited spots under a fluorescence microscope7 (see Figure 1). There are other approaches for labeling mRNA molecules, in which the complementary oligomer probes carry conjugated haptens (e.g., biotin or digoxigenin) that are detected using secondary fluorescently-labeled reporter techniques8.

There are other methods that provide quantitative information about transcripts, in addition to smFISH. Some, such as the Northern blot or quantitative PCR, probe the bulk and thus can measure neither the number of mRNA copies nor their position in individual cells. Therefore these methods are not suitable to quantify cell-to-cell variability. A recent image-based technique that allows for the quantification of both the copy number of RNAs within cells as well as their intracellular location, called multiplexed error-robust fluorescence in situ hybridization (MERFISH) has been developed. MERFISH is based on the assignment of a unique barcode consisting of a defined combination from a fixed number of fluorescently-labeled oligonucleotide probes. These barcodes are read out in sequential rounds of smFISH measurements, with photobleaching following each round of hybridization, thereby increasing throughput by two orders of magnitude9,10. This technique necessitates an automated fluid handling system and the proper design of the probe set.

The combination of multiple fluorescence labeling of individual transcripts, together with novel super-resolution techniques such as stochastic optical reconstruction microscopy (STORM)11, enables a ten-fold increase in resolution in the subcellular localization of transcripts. In STORM, a suitable combination of fluorescent probes and imaging buffer allows for multiple cycles of fluorescence emission per probe molecule (blinking). STORM may also be used to image the E. coli transcriptome and observe genome-wide spatial organization of RNA, by labeling simultaneously all the transcripts of interest12.

All the single-cell methods reviewed above are based on imaging transcripts in fixed cells. Hence, they do not provide any information regarding the kinetic properties of transcripts within cells. To follow transcripts in live cells13, mRNAs can be labeled by the fusion of the gene of interest to an array of binding sites. These latter are then recognized by an RNA-binding protein, such as the bacteriophage MS2 coat protein, which is fused to a fluorescent protein such as the green fluorescent protein (GFP)10,14,15.

Here we describe a method for labeling individual mRNAs with a set of fluorescently-labeled DNA probes, for use in smFISH experiments, in particular in E. coli. Furthermore, we show that the same labeling scheme may be used for STORM measurements with minor modifications.

Protocol

1. Probe Design

NOTE: This protocol uses commercially available oligonucleotide probes already tagged with fluorophores. The probes consist of a set of specific sequences complementary to a target mRNA, each probe being conjugated to a single fluorescent molecule. Alternatively, it is possible to attach fluorescent markers to probes, as described elsewhere5,16.

  1. Design smFISH probes using the Probe Designer16 algorithm developed by Arjun Raj (van Oudenaarden Lab, Massachusetts Institute of Technology); sequences of smFISH probes used in this manuscript are listed in the table of materials.
    NOTE: The minimum number of probes in a set for a detectable signal is ~30. The precise number may vary according to the gene of interest, particularly if very short transcripts are measured.
  2. Choose a dye that fits the optical setup (see table of materials).
    NOTE: The Cy3 dye or an optically equivalent dye with a low susceptibility to photo-bleaching is highly recommended. A candidate for dual labeling is Cy5 or an optically equivalent dye (see table of materials). Suitable dyes for STORM imaging of labeled mRNA are characterized by their capacity for multiple cycles of fluorescence emission. Some smFISH dyes can be used for STORM imaging (see table of materials). To image two (or more) transcripts corresponding to different genes in the same cell, one should choose oligonucleotide probes conjugated to dyes whose spectra have little or no overlap.

2. Reagent Preparation

NOTE: It is important to keep the samples RNAse-free by using RNase-free consumables such as filtered pipette tips and tubes, and to keep any working environment clean. In order to avoid degradation of the target transcripts, all reagents used following cell fixation must be nuclease-free (see table of materials) or diethylpyrocarbonate (DEPC)-treated and sterilized.

  1. Buffers for smFISH
    1. Prepare RNase-free 1x PBS (phosphate buffered saline, solution with a phosphate buffer concentration of 0.01 M and a sodium chloride concentration of 0.154 M, (pH 7.4)). Dilute RNase-free 10x PBS (see table of materials) in nuclease-free water (see table of materials) at a 1:10 v/v ratio.
      1. Alternatively prepare DEPC-treated 1x PBS.
    2. Prepare RNase-free 2x SSC (saline-sodium citrate buffer, 0.3 M NaCl in 0.03 M sodium citrate, (pH 7.0)). Dilute RNase-free 20x SSC (see table of materials) in nuclease-free water at a 1:10 v/v ratio.
      1. Alternatively, prepare DEPC-treated 2x SSC.
  2. Oligonucleotide probe stock solution.
    1. Re-dissolve the dried oligonucleotide probe blend in 200 µL of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) to create a probe stock of 25 µM. Mix well by pipetting up and down, and then vortex and centrifuge briefly.
    2. To avoid freeze and thaw of the stock solution tube, make several aliquots of the stock solution, corresponding to the amount expected to be used in a single experimental run. Store the stock solution at -20 °C or below and protect from light.
      NOTE: A probe set of 5 nmol can provide up to 250 hybridization reactions.
  3. Hybridization buffer (following Skinner et al.7 ):
    1. Add 5 mL nuclease-free water to a 50 mL polypropylene conical-bottom tube. Add 1 g of dextran sulfate to the water and dissolve it by vigorous vortexing. Mix the contents in an orbital shaker until bubbles disappear (~30 min).
    2. Add to the solution 3,530 µL of deionized formamide, 10 mg of E. coli tRNA, 1mL of 20x SSC, 100 µL of 200 mM vanadyl-ribonucleoside complex and 40 µL of 50 mg/mL BSA. Bring the final volume to 10 mL by addition of DEPC-treated water or nuclease-free water, and vortex the solution until it is homogenous.
      NOTE: To avoid freeze and thaw of the solution, make several aliquots of the stock solution, corresponding to the amount expected to be used in a single experimental run. Store the stock solution at -20 °C. Be sure to let the formamide warm to room temperature before opening the bottle. To reduce the background, it is suggested to calibrate the optimal formamide concentration (10 - 40% v/v ratio).
      Caution: WARNING! Formamide is highly toxic and a known teratogen. Avoid contact with the eyes or skin, inhalation or ingestion. Handle it under a fume hood while wearing a lab coat and protective gloves.
    3. Sterilize the solution by passing it through a 0.22-µm filter. Keep in aliquots and store at -20 °C up to one year.
  4. Prepare Fixation buffer (4.6% formaldehyde in 1x PBS) by adding 37% formaldehyde (v/v) to 1x PBS (see 2.1.1) at a 1:8 v/v ratio and vortex.
    CAUTION: WARNING! Formaldehyde is highly toxic and a known carcinogen. Handle it under a fume hood while wearing a lab coat and protective gloves.
  5. Prepare wash buffer for smFISH (20% formamide in 2x SSC) by adding deionized formamide to 2x SSC (see 2.1.2) to a 1:4 v/v ratio and vortex.
  6. Prepare imaging buffer for smFISH by adding 5 mM cysteamine and oxygen scavengers (7 µM glucose oxidase, 56 nM catalase, and 10% glucose (w/v)) to wash buffer (20% formamide in 2x SSC)
  7. Buffers for STORM
    1. Prepare Buffer A by adding 50 mM Tris-HCl and 10 mM NaCl to nuclease-free water.
      NOTE: Store at RT for years.
    2. Prepare Buffer B by adding 50 mM Tris-HCl, 10 mM NaCl, and 10% w/v glucose to nuclease-free water.
      NOTE: Store at 4 °C for up to a year.
    3. Prepare MEA buffer by dissolving 77 mg cysteamine in 1 mL of buffer A (makes a 1 M solution).
      NOTE: It can be stored at 4 °C for 1 month.
    4. Prepare Gloxy buffer by adding 8,440 AU (arbitrary units) glucose oxidase and 70,200 AU catalase to 1 mL buffer A.
      NOTE: Makes 50x stock solution, it can be stored at 4 °C for 1 month.
    5. Prepare imaging buffer for STORM by adding 50 mM of MEA buffer and 1x Gloxy buffer to buffer B.
      NOTE: The imaging buffer for STORM is composed of 5 mM cysteamine, oxygen scavengers (7 µM glucose oxidase and 56 nM catalase) in 50 mM Tris with 10 mM NaCl, and 10% glucose at pH 8.0. Prepare just before imaging, it can be stored and used at RT for approximately 2 h.

3. Sample Fixation

  1. Grow bacterial cells (e.g., E. coli MG1655) in growth media of choice (e.g., LB medium) overnight inan orbital shaker at 260 rpm and 37 °C.
    NOTE: To determine the background due to non-specific binding of the probes, measurements in a strain in which the gene of interest has been deleted should be conducted, following the same procedures (see Δgalk in Figure 1 and ΔsodB in Figure 2).
  2. Dilute the overnight culture 1:100 in fresh medium and measure its optical density (OD600) in a spectrophotometer every ~1 h, up to a value of 0.2 - 0.4; a 4 mL culture should be sufficient.
    NOTE: If the chosen microscope does not have phase contrast or differential interference contrast capabilities, E. coli outer membranes can be labeled with 2 μM lipophilic fluorescent marker (see table of materials), which should be added to the bacterial suspension 20 min prior to fixation17. Fixation and further treatment are accomplished as described below. Care must be taken to choose a fluorescent marker having a different emission spectrum, to minimize the spectral overlap with the labeled-probe set.
  3. Pellet cells by centrifugation for 5 min at 4,500 g at 4 °C. Remove the supernatant from all tubes.
  4. Add 1 mL of 1x PBS to each tube and resuspend the pellet to minimize cell-to-cell aggregation. Then add 4 mL of fixation buffer and vortex gently.
  5. Incubate samples in an orbital shaker at 260 rpm for 30 min at 24 °C.
  6. Pellet cells by centrifugation for 10 min, 1,000 g, 4 °C. Remove supernatant. Add 1 mL 1x PBS.
  7. Transfer suspensions to 1.8 µL conical-bottom micro-centrifuge tubes (see table of materials) and repeat step 3.6 twice.

4. Sample Permeabilization

  1. Remove supernatant very carefully. Use small volume pipettes, if necessary, to remove all the liquid outside the pellet.
  2. Resuspend in 300 µL DEPC-treated water or nuclease-free water. Add 350 µL high grade absolute ethanol (99%) and mix gently by inverting the tube. Add another 350 µL of ethanol and mix again, to reach a final ethanol concentration of 70% (v/v ratio).
    CAUTION: WARNING! Ethanol is flammable.
  3. Rotate the sample with a tube rotator at 20 rpm for 1 h at room temperature (RT), or at 4 °C overnight. Samples may be stored at 4 °C  up to one week.

5. Hybridization

  1. Pellet cells by centrifugation for 7 min, 750 x g, 4 °C. Remove supernatant.
  2. Add 1 mL 20% wash buffer to the samples and leave standing for several minutes, or pipette to dissolve the pellet completely.
  3. Pellet cells by centrifugation for 7 min, at 750 x g, 4 °C.
  4. Remove the supernatant very gently by pipetting. Use small-volume pipettes if necessary to remove all the liquid outside the pellet.
  5. Add the oligonucleotide probe set stock solution to the hybridization buffer aliquot so that the final oligonucleotide concentration is 250 nM; vortex vigorously.
    NOTE: One can label two or more different target mRNAs at once in the same cell. Add probe sets of both targets to the hybridization buffer. Care must be taken to choose dyes having different emission spectra to minimize the spectral overlap (e.g., Cy3 and Cy5). Make sure that samples intended for STORM imaging are hybridized with an oligonucleotide probe set conjugated with a suitable dye for STORM (e.g., in table of materials).
  6. Suspend samples (see step 5.4) in 50 µL hybridization buffer that contains the oligonucleotide probes, while avoiding the generation of bubbles (the solution is quite viscous).
  7. Leave samples overnight on a hot block at 30 °C in dark.
    NOTE: Following this, samples may be stored for up to 6 months at 4 °C.

6. Washing

  1. Use one new microcentrifuge tube for each sample to image. Add 1 mL wash buffer.
  2. Add 10-15 µL from the hybridized samples to the new tube that contains the wash buffer and mix/vortex.
  3. Pellet cells by centrifugation for 7 min, 750 x g at 4 °C. Remove supernatant.
    NOTE: To reduce background, incubate for 1 h at 30 °C.
  4. Wash twice more (resuspend in 1 mL wash buffer, centrifuge and remove pellet).
  5. Resuspend in 25 µL wash buffer.
    NOTE: In order to reduce photo-bleaching one can add to the wash buffer an oxygen scavenging system (2.6) to improve dye stability in single-molecule fluorescence experiments6.

7. Preparation of Samples for Imaging

NOTE: Cells need to be immobilized in order to allow proper imaging under a fluorescence and phase-contrast microscope. The following methods can be used to prepare samples in which different fields of view can be imaged at different focal planes.

  1. Agarose gel preparation
    1. Add 150 mg agarose to 10 mL 2x SSC buffer. Do not add 2x SSC to agarose, or else it will not dissolve properly.
    2. Microwave for 10-15 s each time until large bubbles begin to form. Set aside to cool for a few minutes.
    3. Place a separating silicone frame on the slide so that the slide's center remains exposed.
    4. Place a 10 mm wide (1-2 mm thick) rigid ring in the center of the slide and deposit a small amount of gel in it, for sealing. Wait a few minutes for it to harden.
    5. Add more gel until a high dome shape is formed. Wait 10 min for it to harden, and remove the ring (using fine tweezers or any other method).
    6. Deposit ~10 μL of washed bacterial cells (see 6.5) on the gel and seal with a #0 coverslip slide.
  2. Chamber sample preparation for smFISH
    1. Alternatively (to step 7.1) prepare samples for imaging by immobilizing the washed bacterial cells (see 6.5) on poly-D-lysine-coated glass bottom disposable plastic petri dishes.
    2. Incubate the samples in the dark, at room temperature, overnight before visualization to allow adhesion of the cells to the surface. Before visualization wash once with wash buffer (.5); keep the sample wet with wash buffer(2.5) or imaging buffer for smFISH (2.6).
  3. Chamber Sample Preparation for STORM
    1. Prepare samples for STORM for imaging on poly-D-lysine-coated glass bottom disposable plastic petri dishes.
    2. Incubate the samples in the dark, at RT, overnight. Before visualization wash once with wash buffer for smFISH (2.5); and add imaging buffer for STORM (2.7.5).

8. Transcript Visualization

  1. Image cells with a wide-field fluorescence microscope equipped with a motorized stage (see table of materials).
    NOTE: For STORM modification, use cells labeled with a dye capable of multiple cycles of fluorescence emission. Image the sample using 3D super-resolution imaging system (e.g., see table of materials).
  2. Use (recommended) a 60-100x N.A >1.3 oil immersion phase contrast objective lens with a strong light source, such as a mercury or metal-halide lamp; LED-based light sources are also recommended.
  3. Use a standard cooled CCD camera, ideally optimized for low-light level imaging rather than speed (we use a camera with 16 µm pixel size) (see table of materials).
    NOTE: The use of a cooled EMCCD (electron multiplying charge coupled device) camera CCD camera is necessary to reduce thermal noise that prevents detection, particularly of single molecules.
  4. Use filter sets appropriate for the fluorophores chosen.
  5. To determine properly cell boundaries, acquire images of different fields of view in each sample either with phase contrast optics, or by labeling fluorescently the outer cell membrane. Acquire images at different focal planes (z-stack) for all channels (usually 13 slices separated by 250 nm are taken).
    NOTE: The motorized stage of the microscope and the filter sets should be controlled by commercial (see table of materials) or in-house software that can capture a stack of images in sequence.

9. Data Analysis

  1. Convert the image stacks to a suitable format for data analysis.
  2. Estimate the copy number of the target mRNA from the total intensity of fluorescent foci in the cell, rather than from counting discrete 'spots' as in other currently available protocols.
  3. Carry out image analysis with open-source software18 or with a custom-built program. For details of data imaging and analysis see Skinner et al.7

Results

We carried out smFISH measurements of galK and sodB transcripts in E. coli cells. The transcripts were hybridized with a set of specific sequences complementary to the target sequence, each probe being conjugated to a single fluorescent molecule (see table of materials). Fluorescence and phase contrast images of MG1655 wild-type E. coli strain (WT) or a JW0740 (Keio collection)19 galK-deleted strain (ΔgalK) were exposed to 2 mM D-fuc...

Discussion

We have measured in our laboratory the transcript number of different genes in E. coli cells using the smFISH method2. In brief, this procedure consists of the following steps: cell fixation, permeabilization of membranes to allow for probe penetration, probe hybridization, and sample imaging using a standard fluorescence microscope. This procedure is based on previously published ones with some modifications6,7,

Disclosures

The authors have nothing to disclose.

Acknowledgements

This work was supported by an Israel Science Foundation grant 514415 (to J.S.) and a BSF-NSF (MCB) grant 2016707 (to J.S.). Support from a Siegfried and Irma Ullman Professorial Chair (to J.S.) is also acknowledged.

Materials

NameCompanyCatalog NumberComments
Dextran sulfate sodium saltSigma-AldrichD8906
Pure Ethanol, 99.5%, ACS reagent, absoluteMallinckrodt Baker - Avantor8025.25
Diethylpyrocarbonate (DEPC)Sigma-AldrichD5758
RNase-free 20X SSCLife Technologies/AmbionAM9763
RNase-free 10X PBSLife Technologies/AmbionAM9625
TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) BioUltra, for molecular biologySigma-Aldrich93283
nuclease-free waterThermo Fisher Scientific10977035
Formaldehyde solution for molecular biology, 36.5-38% in waterSigma-AldrichF8775
Deionized formamide, nuclease freeThermo Fisher Scientific/AmbionAM9342
E. coli tRNA (ribonucleic acid, transfer type xx from escherichia)Sigma-AldrichR1753-500UN
UltraPure BSA (50mg/ml)Thermo Fisher Scientific/AmbionAM2616
Vanadyl-ribonucleoside complex,VRC, 200 mMNew England BiolabS1402S
Poly-L-LysineSigmaP4707
Cysteamine and oxygenSigma-Aldrich30070
Glucose Oxidase from Aspergillus niger, Type VII, 50KUSigma-AldrichG2133
CatalaseSigma-AldrichC40
D-glucoseSigma-AldrichG8270
D-fucoseSigma-AldrichF8150
Vybrant DiO Cell-Labeling SolutionLife TechnologiesV2286
Agarose,low melting reagentSigma-AldrichA9414
Adhesive silicone isolator 24-2mm Dia. X 1.8 mm depth JTR24R-A2-2.0Grace Bio-LabsJTR24R-A2-2.0 666208
poly-D-lysine-coated glass bottom Glass Bottom Culture DishesMatTek CorporationP35GC-1.5-14-C
Super life nitrile powder free examination glovesSupermaxTC-N-9889
Brand sterilization incubator tapeSigma-AldrichBR61750
Microcentrifuge tubes (1.8 ml)Axygen - Corning Life SciencesMCT-175C
Falcon round-bottom polypropylene tubes (14 ml)BD Biosciences352059
Conical-bottom centrifuge polypropylene tubes (50 ml)Corning430828
Serological pipettes (Corning 5 ml)Corning Life Sciences4051
Serological pipettes (Corning 10 ml)Corning Life Sciences4488
Serological pipettes (Corning 25 ml)Corning Life Sciences4251
Spectrophotometer cuvettesSarstedt67.742
RNase-free pipette tips 0.2 - 20 μlFroggaBioFT20
RNase-free pipette tips 10 - 200 μlAxigene/corningTF-200
RNase-free pipette tips 100 - 1000 μlFroggaBioFT1000
RNase-free pipette tips 100 - 1000 μlSorenson14200
Syringe disposile 10 mL needle G-21Becton Dickinson, BiosciencesBD-309643
Minisart 0.2 um Syringe FilterSartorius16534 K
Nikon instruments microscope type A immersion oil A, 8ccNikonMXA20233
Microscope slides 76 x26, 3"x1"x1mmThermo Fisher Scientific421-004ET
#0 coverslip slide 24x60Thermo Fisher Scientific/MenzelBNBB024060A0
Orbital shakerM.R.CTOU-50
Hot blockM.R.C
VortexFried Electric CompanyG-560-E
MicrocentrifugeEppendorf5427R
CentrifugeEppendorf5810R
Portable Pipet-Aid XP2, Pipette ControllerDrummond Scientific Company4-000-501-I
OD600 Spectrophotometer for Bacterial Growth Rates DiluPhotometerMidsciOD600-10
iXon X3 EMCCD cameraAndorDU-897E-CS0-#BV
Eclipse Ti microscopeNikonMEA53100
CFI plan apochromat DM 100X oil objective lambda PH-3 N.A 1.45 WD 0.13NikonMRD31905
Filter set (TRITC/CY3): EX - ET545/30X; EM - ET620/60M; BS - T570LPNikon49005
Filter set (CY5): EX - ET640/30X; EM - ET690/50M; BS - T660PNikon49009
Nis-elements AR auto reaserch softwareNikonMQS31000
STORM microscopeVutaraSR-200
NA 1.2 water immersion objective Olympus
SRX image acquisition and analysis softwareVutara
Evolve 512 EMCCD cameraPhotometrics
Stellaris® FISH Probes, Custom Assay with CAL Fluor® Red 590 DyeBiosearch Technologies IncSMF-1083-5
Probe Sequence for galK mRNA:
gtgttttttctttcagactc
tagccaaatgcgttggcaaa
ctgaatggtgtgagtggcag
caccaatcaaattcacgcgg
acgaaaccgtcgttgtagtc
tgataatcaatcgcgcaggg
gtggtgcacaactgatcacg
acgcgaactttacggtcatc
gctgattttcataatcggct
gcatcgagggaaaactcgtc
gttttcatgtgcgacaatgg
cacgccacgaacgtagttag
ttacgcagttgcagatgttt
tccagtgaagcggaagaact
tgctgcaatacggttccgac
gtccagcggcagatgataaa
tgaccgttaagcgcgatttg
agcctacaaactggttttct
gcggaaattagctgatccat
aaggcatgatctttcttgcc
cagtgagcggcaatcgatca
tgggcatggaaactgctttg
gatgatgacgacagccacac
gggtacgtttgaagttactg
gtgttgtattcgctgccaac
ggtttcgcactgttcacgac
tggctgctggaagaaacgcg
ttcaatggtgacatcacgca
catgcgcaacagcgttgaac
ggcgttttcagtcagtatat
atacgtttcaggtcgccttg
tgagactccgccatcaactc
gaaatcatcgcgcatagagg
caatttgcggcacggtgatt
ttgacgatttctaccagagt
acctttgtcgccaatcacag
ggatcagcgcgacgatacag
atattgttcagcgacagctt
gtctctttaatacctgtttt
ctccttgtgatggtttacaa
Stellaris® FISH Probes, Custom Assay with Quaser Fluor® Red 670 DyeBiosearch Technologies IncSMF-1083-5
Probe Sequence for sodB mRNA:
gtgttttttctttcagactc
tagccaaatgcgttggcaaa
ctgaatggtgtgagtggcag
caccaatcaaattcacgcgg
acgaaaccgtcgttgtagtc
tgataatcaatcgcgcaggg
gtggtgcacaactgatcacg
acgcgaactttacggtcatc
gctgattttcataatcggct
gcatcgagggaaaactcgtc
gttttcatgtgcgacaatgg
cacgccacgaacgtagttag
ttacgcagttgcagatgttt
tccagtgaagcggaagaact
tgctgcaatacggttccgac
gtccagcggcagatgataaa
tgaccgttaagcgcgatttg
agcctacaaactggttttct
gcggaaattagctgatccat
aaggcatgatctttcttgcc
cagtgagcggcaatcgatca
tgggcatggaaactgctttg
gatgatgacgacagccacac
gggtacgtttgaagttactg
gtgttgtattcgctgccaac
ggtttcgcactgttcacgac
tggctgctggaagaaacgcg
ttcaatggtgacatcacgca
catgcgcaacagcgttgaac
ggcgttttcagtcagtatat
atacgtttcaggtcgccttg
tgagactccgccatcaactc
gaaatcatcgcgcatagagg
caatttgcggcacggtgatt
ttgacgatttctaccagagt
acctttgtcgccaatcacag
ggatcagcgcgacgatacag
atattgttcagcgacagctt
gtctctttaatacctgtttt
ctccttgtgatggtttacaa

References

  1. Tsimring, L. S. Noise in biology. Reports Prog. Phys. 77 (2), 26601 (2014).
  2. Arbel-Goren, R., et al. Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli. Nucleic Acids Res. 44 (14), 6707-6720 (2016).
  3. Arbel-Goren, R., et al. Effects of post-transcriptional regulation on phenotypic noise in Escherichia coli. Nucleic Acids Res. 41 (9), 4825-4834 (2013).
  4. van Gijtenbeek, L. A., Robinson, A., van Oijen, A. M., Poolman, B., Kok, J. On the Spatial Organization of mRNA, Plasmids, and Ribosomes in a Bacterial Host Overexpressing Membrane Proteins. PLOS Genet. 12 (12), e1006523 (2016).
  5. Raj, A., vanden Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. Imaging individual mRNA molecules using multiple singly labeled probes. Nat. Methods. 5 (10), 877-879 (2008).
  6. Raj, A., Tyagi, S. Detection of individual endogenous RNA transcripts in situ using multiple singly labeled probes. Methods Enzymol. 472 (10), (2010).
  7. Skinner, S. O., La Sepúlveda, ., Xu, H., Golding, I. Measuring mRNA copy number in individual Escherichia coli cells using single-molecule fluorescent in situ hybridization. Nat. Protoc. 8 (6), 1100-1113 (2013).
  8. Barakat, T. S., Gribnau, J. Combined DNA-RNA fluorescent in situ hybridization (FISH) to study X chromosome inactivation in differentiated female mouse embryonic stem cells. J. Vis. Exp. (88), e51628 (2014).
  9. Chen, K. H., Boettiger, A. N., Moffitt, J. R., Wang, S., Zhuang, X. RNA imaging. Spatially resolved, highly multiplexed RNA profiling in single cells. Science. 348 (6233), aaa6090 (2015).
  10. van Gijtenbeek, L. A., Kok, J. Illuminating messengers: An update and outlook on RNA visualization in bacteria. Front. Microbiol. 8, 1-19 (2017).
  11. Fei, J., et al. Determination of in vivo target search kinetics of regulatory noncoding RNA. Science. 347 (6228), 1371-1374 (2015).
  12. Moffitt, J. R., Pandey, S., Boettiger, A. N., Wang, S., Zhuang, X. Spatial organization shapes the turnover of a bacterial transcriptome. Elife. 5, 1-22 (2016).
  13. Ong, W. Q., Citron, Y. R., Sekine, S., Huang, B. Live Cell Imaging of Endogenous mRNA Using RNA-Based Fluorescence "Turn-On" Probe. ACS Chem. Biol. , (2016).
  14. Golding, I., Paulsson, J., Zawilski, S. M., Cox, E. C. Real-time kinetics of gene activity in individual bacteria. Cell. 123 (6), 1025-1036 (2005).
  15. Golding, I., Cox, E. C. Chapter 8 Spatiotemporal Dynamics in Bacterial Cells: Real-Time Studies with Single-Event Resolution. Methods Cell Biol. 89 (8), (2008).
  16. So, L. H., Ghosh, A., Zong, C., Sepulveda, L. A., Segev, R., Golding, I. General properties of transcriptional time series in Escherichia coli. Nat. Genet. 43 (6), 554-560 (2011).
  17. Spahn, C., Endesfelder, U., Heilemann, M. Super-resolution imaging of Escherichia coli nucleoids reveals highly structured and asymmetric segregation during fast growth. J. Struct. Biol. 185 (3), 243-249 (2014).
  18. Sliusarenko, O. Microbetracker software. Mol Microbiol. 80 (3), 612-627 (2012).
  19. Baba, T., et al. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2, 8 (2006).
  20. Arbel-Goren, R., et al. Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli. Nucleic Acids Res. 44 (14), 6707-6720 (2016).
  21. Brandt, U. A two-state stabilization-change mechanism for proton-pumping complex I. Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1807 (10), 1364-1369 (2011).

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Explore More Articles

Escherichia ColiSingle molecule Fluorescence In Situ Hybridization smFISHTranscriptsCell to cell VariabilityCell Wall LocalizationLB MediumOptical DensityPBSFixation BufferPermeabilizationEthanolWash BufferOligonucleotide Probe SetHybridization Buffer

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2025 MyJoVE Corporation. All rights reserved