Preparation and Gene Modification of Nonhuman Primate Hematopoietic Stem and Progenitor Cells

Summary

The goal of this protocol is to isolate nonhuman primate CD34⁺ cells from primed bone marrow, to gene-modify these cells with lentiviral vectors, and to prepare a product for infusion into the autologous host. The total protocol length is approximately 48 h.

Abstract

Hematopoietic stem and progenitor cell (HSPC) transplantation has been a cornerstone therapy for leukemia and other cancers for nearly half a century, underlies the only known cure of human immunodeficiency virus (HIV-1) infection, and shows immense promise in the treatment of genetic diseases such as beta thalassemia. Our group has developed a protocol to model HSPC gene therapy in nonhuman primates (NHPs), allowing scientists to optimize many of the same reagents and techniques that are applied in the clinic. Here, we describe methods for purifying CD34⁺ HSPCs and long-term persisting hematopoietic stem cell (HSC) subsets from primed bone marrow (BM). Identical techniques can be employed for the purification of other HSPC sources (e.g., mobilized peripheral blood stem cells [PBSCs]). Outlined is a 2 day protocol in which cells are purified, cultured, modified with lentivirus (LV), and prepared for infusion back into the autologous host. Key readouts of success include the purity of the CD34⁺ HSPC population, the ability of purified HSPCs to form morphologically distinct colonies in semisolid media, and, most importantly, gene modification efficiency. The key advantage to HSPC gene therapy is the ability to provide a source of long-lived cells that give rise to all hematopoietic cell types. As such, these methods have been used to model therapies for cancer, genetic diseases, and infectious diseases. In each case, therapeutic efficacy is established by enhancing the function of distinct HSPC progeny, including red blood cells, T cells, B cells, and/or myeloid subsets. The methods to isolate, modify, and prepare HSPC products are directly applicable and translatable to multiple diseases in human patients.

Introduction

Stem cell gene therapy is a powerful means to address a wide range of human pathologies. HSPC gene therapy is a particularly attractive approach, due to i) the relative ease of collecting these cells from patients, ii) the wealth of knowledge that is available regarding cell surface phenotypes and ex vivo culture parameters, and, as the field expands, because iii) it presents scientists with an ever-increasing toolbox of gene modification strategies tailored to various diseases of interest. We are actively investigating HSPC gene therapy approaches from multiple angles, including the basic science of HSPC biology, the engraftment of gene-modified HSPCs in preclinical ....

Protocol

Autologous NHP transplants, priming (mobilization), the collection of cells, and gene modification are conducted consistent with previously published protocols²⁶. All experimental procedures are reviewed and approved by the Institutional Animal Care and Use Committee of the Fred Hutchinson Cancer Research Center and the University of Washington (Protocol #3235-01). All studies are carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of t.......

Discussion

LV vector engineering is the best-characterized method to gene-modify cell types such as CD34⁺ HSPCs, for subsequent transplantation in vivo. The protocol described here is designed to maximize the number of gene-modified HSPCs that persist long-term in vivo, and provide clinical benefits to patients with various malignant, infectious, and genetic diseases. Although gene-editing strategies have emerged over the last decade, LV-modified cells are the best studied in vitro, in animal models, and in patients

Materials

Name	Company	Catalog Number	Comments
Stemspam SFEM II ("HSPC") Media	StemCell	09655
Hank's Balanced Salt Solution	Gibco	14175095
Phosphate-Buffered Saline	Gibco	14190-144
Penicillin/Streptomycin	Gibco	15140-122
Dimethyl Sulfoxide	Sigma Aldrich	D2650-100
100% Ethanol	Decon labs	M18027161M
Cyclosporine	Sigma	30024-25MG
500 mM EDTA	Invitrogen	15575-038
Heat-Inactivated Fetal Bovine Serum	Sigma Aldrich	PS-0500-A
CH-296/ RetroNectin (2.5 mL, 1 µg/µL)	TaKaRA	T100B
Bovine Serum Albumin	Sigma	A7906-100g
HEPES	Sigma	H9897
Rat anti-mouse IgM magnetic beads	Miltenyi Biotec	130-047-301
Recombinant HumanStem Cell Factor (SCF)	Peprotech	300-07
Recombinant Human Thrombopoietin (TPO)	Peprotech	300-18
Recombinant Human FMS-like tyrosine kinase 3 (FLT-3)	Peprotech	300-19
Protamine sulfate	Sigma	P-4505
14 mL Polypropylene Round-Bottom Tube	Corning	352059
Colony Gel 1402	ReachBio	1402
QuadroMACS Separators	Miltenyi Biotec	130-090-976
MACS L25 Columns	Miltenyi biotec	130-042-401
10 mM PGE2	Cayman Chemical	14753-5mg
TC-treated T-75 flasks	Bioexpress	T-3001-2
Non-TC-treated T-75 flasks	Thermo-Fisher	13680-57
20 ml syringes	BD Biosciences	302830
16.5 G needles	BD Precision	305198
Syringe Tip Cap	BD Biosciences	305819
QuickExtract DNA Solution	Epicentre	QE09050
8-tube strip cap PCR Tubes	USA scientific	1402-2708
96-well Thermocycler	Thermo-Fisher	4375786
Pre-Separation filters	Miltenyi Biotec	130-041-407
Strainer, Cell; BD Falcon; Sterile; Nylon mesh; Mesh size: 70um; Color: white; 50/CS	fisher scientific	352350
Ultracomp ebeads	eBioscience	01-2222-42
MACSmix Tube Rotator	Miltenyi	130-090-753
3 mL Luer-Lock Syringes	Thermo-Fisher	14823435
35 mm x 10 mm cell culture dish	Corning	430165
60 mm x 15 mm cell culture dish	Corning	430196
150 mm x 25 mm cell culture dish	Corning	430599
Non TC treated flasks	Falcon	353133
Qiagen DNA extraction	Qiagen	51104
PE Anti-Human CD90 (Thy1) Clone:5E10	Biolegend	328110
PE-CF594 Mouse Anti-Human CD34 Clone:563	BD horizon	562449
APC-H7 Mouse Anti-Human CD45RA Clone: 5H9	BD Pharmingen	561212
V450 Mouse Anti-NHP CD45 Clone:d058-1283	BD Biosciences	561291
Autologous Serum	Collected from autologous host and cryopreserved prior to mobilization and collection of CD34+ HSPCs	N/A	Beard, B. C. et al. Efficient and stable MGMT-mediated selection of long-term repopulating stem cells in nonhuman primates. Journal of Clinical Investigation. 120 (7), 2345-2354, (2010).
Virus-Conditioned Media (VCM)	Kiem Lab, FHCRC Co-operative Center for Excellence in Hematology (CCEH)	N/A	Beard, B. C. et al. Efficient and stable MGMT-mediated selection of long-term repopulating stem cells in nonhuman primates. Journal of Clinical Investigation. 120 (7), 2345-2354, (2010).
Anti-CD34 antibody, Clone 12.8	Kiem Lab	N/A	Beard, B. C. et al. Efficient and stable MGMT-mediated selection of long-term repopulating stem cells in nonhuman primates. Journal of Clinical Investigation. 120 (7), 2345-2354, (2010).
Lenti F primer: AGAGATGGGTGCGAGAGCGTCA	Integrated DNA Technologies	N/A	Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016).
Lenti R primer: TGCCTTGGTGGGTGCTACTCCTAA	Integrated DNA Technologies	N/A	Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016).
Actin F primer: TCCTGTGGCACTCACGAAACT	Integrated DNA Technologies	N/A	Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016).
Actin R primer: GAAGCATTTGCGGTGGACGAT	Integrated DNA Technologies	N/A	Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016).