Constructing Mutants in Serotype 1 Streptococcus pneumoniae strain 519/43

Summary

Here, we describe a S. pneumoniae serotype 1 strain 519/43 that can be genetically modified by using its ability to naturally acquire DNA and a suicide-plasmid. As proof of principle, an isogenic mutant in the pneumolysin (ply) gene was made.

Abstract

Streptococcus pneumoniae serotype 1 remains a huge problem in low-and-middle income countries, particularly in sub-Saharan Africa. Despite its importance, studies in this serotype have been hindered by the lack of genetic tools to modify it. In this study, we describe a method to genetically modify a serotype 1 clinical isolate (strain 519/43). Interestingly, this was achieved by exploiting the Pneumococcus’ ability to naturally acquire DNA. However, unlike most pneumococci, the use of linear DNA was not successful; to mutate this important strain, a suicide plasmid had to be used. This methodology has provided the means for a deeper understanding of this elusive serotype, both in terms of its biology and pathogenicity. To validate the method, the major known pneumococcal toxin, pneumolysin, was mutated because it has a well-known and easy to follow phenotype. We showed that the mutant, as expected, lost its ability to lyse red blood cells. By being able to mutate an important gene in the serotype of interest, we were able to observe different phenotypes for loss of function mutants upon intraperitoneal and intranasal infections from the ones observed for other serotypes. In summary, this study proves that strain 519/43 (serotype 1) can be genetically modified.

Introduction

Streptococcus pneumoniae (S. pneumoniae, the pneumococcus) is one of the principal causes of morbidity and mortality globally. Up until recently, close to 100 serotypes of S. pneumoniae have been discovered^{1,2,3,4,5,6,7}. Yearly, invasive pneumococcal disease (IPD) claims around 700,000 deaths, of children younger than 5 years old⁸. S. pneumoniae is the major cause of bacterial pn....

Protocol

1. Generation of the mutating amplicon by SOE-PCR²³ and amplification of the spectinomycin cassette

1. Start by performing PCR for the amplification of the homology arms (ply 5’ (488 bp) and ply3’ (715 bp) respectively) of the flanking regions of the ply gene from strain 519/43. Use primers plyFw1_NOTI (TTT GCGGCCGCCAGTAAATGACTTTATACTAGCTATG), ply5’R1_BamHI (CGAAATATAGACCAAAGGACGCGGATCC AGAACCAAACTTGACCTTGA), ply3’F1_BamHI (TCAAGGTCAAGTTTGGTTCT

Discussion

Streptococcus pneumoniae, in particular serotype 1, continues to be a global threat causing invasive pneumococcal disease and meningitis. Despite the introduction of various vaccines that should be protective against serotype 1, in Africa, this serotype is still capable of causing outbreaks that lead to high morbidity and mortality¹³. The ability to genetically manipulate this serotype is of critical importance because of its clinical relevance. The method described in this study allows t.......

Materials

Name	Company	Catalog Number	Comments
AccuPrime Pfx DNA polymerase	Invitrogen	12344024	Used for amplification of the fragments
Ampicillin sodium salt	Sigma Aldrich	A9518	Used for bacterial selection on stage 1(pSD1)
Blood Agar Base	Oxoid	CM0055	Used to plate S. pneumoniae transformants
Bovine Serum Albumine	sigma	55470	used for S. pneumoniae Transformation
Brain Heart Infusion	Oxoid	CM1135	used to grow S. pneumoniae cells
Calcium Chloride Cacl2	Sigma	449709	used for S. pneumoniae Transformation
Competence stimulating peptide 1	AnaSpec	AS-63779	used for S. pneumoniae Transformation
Luria Broth Agar	Gibco	22700025	used for plating and selection of pSD1 and pSD2
Luria Broth Base (Miller's formulation)	Gibco	12795027	used for plating and selection of pSD1 and pSD2
Monarch Gel Extraction Kit	NEB	T1020S	Used to extract the bands from the DNA gel
Monarch Plasmid Miniprep Kit	NEB	T1010S	Used to extract plasmid from the cells
pGEM T-easy	Promega	A1360	used as suicide plasmid
S.O.C.	Invitrogen	15544034	used for recovery of cells after transformation
Sodium Hydroxide (NaOH)	Sigma	S0899	used for S.pneumoniae Transformation
Spectinomycin Hydrochloride	SigmaAldrich	PHR1426	Used for bacterial selection
Subcloning Efficiency DH5α Competent Cells	Invitrogen	18265017	used for the creation of pSD1 and pSD2