JoVE Logo
Faculty Resource Center

Sign In

Summary

Abstract

Introduction

Protocol

Representative Results

Discussion

Acknowledgements

Materials

References

Genetics

Using Next Generation Sequencing to Identify Mutations Associated with Repair of a CAS9-induced Double Strand Break Near the CD4 Promoter

Published: March 31st, 2022

DOI:

10.3791/62583

1Division of Biology, Kansas State University, 2Kansas State Veterinary Diagnostic Laboratory, Kansas State University, 3Department of Diagnostic Medicine/Pathobiology, Kansas State University
* These authors contributed equally

Presented here is sgRNA/CAS9 endonuclease and next-generation sequencing protocol that can be used to identify the mutations associated with double strand break repair near the CD4 promoter.

Double strand breaks (DSBs) in DNA are the most cytotoxic type of DNA damage. Because a myriad of insults can result in these lesions (e.g., replication stress, ionizing radiation, unrepaired UV damage), DSBs occur in most cells each day. In addition to cell death, unrepaired DSBs reduce genome integrity and the resulting mutations can drive tumorigenesis. These risks and the prevalence of DSBs motivate investigations into the mechanisms by which cells repair these lesions. Next generation sequencing can be paired with the induction of DSBs by ionizing radiation to provide a powerful tool to precisely define the mutations associated with DSB repair defects. However, this approach requires computationally challenging and cost prohibitive whole genome sequencing to detect the repair of the randomly occurring DSBs associated with ionizing radiation. Rare cutting endonucleases, such as I-Sce1, provide the ability to generate a single DSB, but their recognition sites must be inserted into the genome of interest. As a result, the site of repair is inherently artificial. Recent advances allow guide RNA (sgRNA) to direct a Cas9 endonuclease to any genome locus of interest. This could be applied to the study of DSB repair making next generation sequencing more cost effective by allowing it to be focused on the DNA flanking the Cas9-induced DSB. The goal of the manuscript is to demonstrate the feasibility of this approach by presenting a protocol that can define mutations that stem from the repair of a DSB upstream of the CD4 gene. The protocol can be adapted to determine changes in the mutagenic potential of DSB associated with exogenous factors, such as repair inhibitors, viral protein expression, mutations, and environmental exposures with relatively limited computation requirements. Once an organism's genome has been sequenced, this method can be theoretically employed at any genomic locus and in any cell culture model of that organism that can be transfected. Similar adaptations of the approach could allow comparisons of repair fidelity between different loci in the same genetic background.

Maintaining genomic stability is critical for all living organisms. Accurate DNA replication and a robust DNA damage response (DDR) are necessary to faithfully propagate the genetic material1,2. DNA damages occur regularly in most cells2,3. When these damages are sensed, cell cycle progression is halted, and DNA repair mechanisms are activated. Double strand breaks in DNA or DSBs are the most toxic and mutagenic type of DNA damage3,4.

While several DDR signaling path....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

1. Cell plating

  1. Grow HFK LXSN and HFK 8E6 cells in 10 cm plates in keratinocyte culture media (10 mL/plate) with human keratinocyte growth supplement (HKGS) and 1% penicillin/streptomycin. Grow cells to about 80% confluence at 37 °C in a jacket incubator with 5% CO2.
  2. Replace culture media with 3 mL of trypsin-EDTA (0.05%, ethylenediamine tetraacetic acid). Incubate at 37 °C for 3 min. Neutralize trypsin with equal volume of fetal bovine serum (FBS) supplemented .......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Three representative results are presented for this protocol. Figure 1 is an immunoblot confirming expression of CAS9 in HFK control (LXSN) and HFK expressing beta-HPV 8E6 (8E6). 48 h after transfection, whole cell lysates were harvested and subsequently probed with an anti-CAS9 antibody (or GAPDH as a loading control). The result shows that HFK LXSN and HFK 8E6 are expressing similar amount of CAS9 indicating that transfection efficiency is similar between t.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

In addition to the depth of information provided, there are several advantages to this method. First, DSB repair, in theory, can be assessed at any genomic loci without modifying the genome of the cell of interest. Second, access to NGS analysis of repair is increased by the reduced cost and computational effort afforded by making and analyzing a single DSB targeted to a defined area. Finally, with the genomes of additional organisms routinely becoming available and multiple publications demonstrating successful transfec.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Research reported in this manuscript was supported by the National Institute of General Medical Sciences of the National Institutes of Health (P20GM130448) (NAW and RP); National Cancer Institute of the National Institutes of Health (NCI R15 CA242057 01A1); Johnson Cancer Research Center in Kansas State University; and the U.S. Department of Defense (CMDRP PRCRP CA160224 (NAW)). We appreciate KSU-CVM Confocal Core and Joel Sanneman for our immunofluorescence microscopy. The content is solely the responsibility of the authors and does not necessarily represent the official views of these funding agencies.

....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Name Company Catalog Number Comments
6 Well Tissue Culture Plate Celltreat 229106 Cell culture plate
BCA Kit VWR 89167-794 BCA assay kit
Centrifuge 5910 R Eppendorf 2231000772 Tabletop Centrifuge
CLC Genomic Workbench Qiagen 832001 deep sequence data analysis software/indel caller/variant caller
Digital Microplate Genie pulse Scientific industries SI-400A Plate shaker
DYKDDDDK Tag Monoclonal Antibody (FG4R) ThermoFisher Scientific MA191878 Anti-FLAG antibody
Epilife CF Kit ThermoFisher Scientific MEPICF500 Cell cultrue media and supplements
Fetal Bovine Serum (FBS) VWR 89510-194 Cell culture supplement
Goat anti-Rabbit IgG ThermoFisher Scientific A-11012 Secondary antibody
HighPrep PCR Clean-up system MagBio AC-60005 Bead-based PCR cleanup kit
KAPA HiFi HotStart ReadyMix PCR Kit KAPA Biosystems KK2600 PCR mastermix/PCR assay
MagAttract HMW DNA kit Qiagen 67563 High Molecular Weight DNA extraction kit
Magnetic Stand-96 Thermo Fisher Scientific AM10027 96-Well Magnetic Rack
MiniAmp Thermal Cycler Applied Biosystems A37834 Thermal Cycler
Miseq Illumina SY-410-1003 Sequencer
Miseq v2 300 cycle reagent kit Illumina MS-102-2002 300-cycle cartridge/sequencing reagents
Nextera XT DNA Library Prep kit Illumina FC-131-1024 Library preparation kit
Nextera XT Kit v2 Set A Illumina 20027215 Indexes
Nunc 96-well polypropylene DeepWell Stroage plates Thermo Fisher Scientific 260251 deep well 96-well plates
Penicillin-Streptomycin Solution (100X) Calsson Labs PSL02-6X100ML Antibiotics for cell culture
Phosphate Buffered Saline (PBS) Bio Basic PD8117 PBS
px330-CD4 Addgen 136938 SgRNA/CAS9 plasmids targeting 5’- GGCGTATCTGTGTGAGGACT
QIAxcel Advanced System Qiagen 9001941 capillary electrophersis machine
QIAxcel DNA screening kit Qiagen 929004 DNA buffer/ capillary electrophersis tubes
Qubit 1x ds HS Assay Kit ThermoFisher Scientific Q23851 Fluorometer reagents/1x dsDNA solution
Qubit 4 Fluorometer ThermoFisher Scientific Q33238 Fluorometer
Qubit Assay Tubes Thermo Fisher Scientific Q32856 Fluorometer assay tubes
RIPA Lysis Buffer VWR VWRVN653-100ML Lysis buffer for protein extraction
Trypsin-EDTA (0.05%), phenol red ThermoFisher Scientific 25300054 Trypsin
Vortex-Genie 2 Scientific industries SI-0236 Vortex
Xfect Transfection Reagent Takara Bio 631318 Transfection reagent
genomic data analysis software QIAGEN CLC Workbench v21.0. Data analysis software

  1. Vítor, A. C., Huertas, P., Legube, G., de Almeida, S. F. Studying DNA double-strand break repair: an ever-growing toolbox. Frontiers in Molecular Biosciences. 7, (2020).
  2. Giglia-Mari, G., Zotter, A., Vermeulen, W. DNA damage response. Cold Spring Harbor Perspectives in Biology. 3 (1), 000745 (2011).
  3. Khanna, K. K., Jackson, S. P. DNA double-strand breaks: Signaling, repair and the cancer connection. Nature Genetics. 27 (3), 247-254 (2001).
  4. vanden Berg, J. G., et al. A limited number of double-strand DNA breaks is sufficient to delay cell cycle progression. Nucleic Acids Research. 46 (19), 10132-10144 (2018).
  5. Chang, H. H. Y., Pannunzio, N. R., Adachi, N., Lieber, M. R. Non-homologous DNA end joining and alternative pathways to double-strand break repair. Nature Reviews Molecular Cell Biology. 18 (8), 495-506 (2017).
  6. Daley, J. M., Sung, P. 5. 3. B. P. 1. BRCA1, and the choice between recombination and end joining at DNA double-strand breaks. Molecular and Cellular Biology. 34 (8), 1380-1388 (2014).
  7. Godin, S. K., Sullivan, M. R., Bernstein, K. A. Novel insights into RAD51 activity and regulation during homologous recombination and DNA replication. Biochemistry and Cell Biology = Biochimie et Biologie Cellulaire. 94 (5), 407-418 (2016).
  8. Jette, N., Lees-Miller, S. P. The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis. Progress in Biophysics and Molecular Biology. 117, 194-205 (2015).
  9. Weterings, E., van Gent, D. C. The mechanism of non-homologous end-joining: A synopsis of synapsis. DNA Repair. 3 (11), 1425-1435 (2004).
  10. Bhargava, R., Lopezcolorado, F. W., Tsai, L. J., Stark, J. M. The canonical non-homologous end joining factor XLF promotes chromosomal deletion rearrangements in human cells. Journal of Biological Chemistry. 295 (1), 125-137 (2020).
  11. Gunn, A., Bennardo, N., Cheng, A., Stark, J. M. Correct end use during end joining of multiple chromosomal double strand breaks is influenced by repair protein RAD50, DNA-dependent protein kinase DNA-PKcs, and transcription context. Journal of Biological Chemistry. 286 (49), 42470-42482 (2011).
  12. Simsek, D., Jasin, M. Alternative end-joining is suppressed by the canonical NHEJ component Xrcc4-ligase IV during chromosomal translocation formation. Nature Structural & Molecular Biology. 17 (4), 410-416 (2010).
  13. Certo, M. T., et al. Tracking genome engineering outcome at individual DNA breakpoints. Nature Methods. 8 (8), 671-676 (2011).
  14. Murthy, V., et al. Characterizing DNA repair processes at transient and long-lasting double-strand DNA breaks by immunofluorescence microscopy. JoVE Journal of Visualized Experiments. (136), e57653 (2018).
  15. Wang, J. L., et al. Dissection of DNA double-strand-break repair using novel single-molecule forceps. Nature Structural & Molecular Biology. , (2018).
  16. Azzam, E. I., Jay-Gerin, J. -. P., Pain, D. Ionizing radiation-induced metabolic oxidative stress and prolonged cell injury. Cancer Letters. 327, 48-60 (2012).
  17. Kuo, L. J., Yang, L. -. X. γ-H2AX - A novel biomarker for DNA double-strand breaks. In Vivo. 5, (2008).
  18. Sanders, J. T., et al. Radiation-induced DNA damage and repair effects on 3D genome organization. Nature Communications. 11 (1), 6178 (2020).
  19. Bellaiche, Y., Mogila, V., Perrimon, N. I-SceI endonuclease, a new tool for studying DNA double-strand break repair mechanisms in Drosophila. Genetics. 152 (3), 1037-1044 (1999).
  20. Wallace, N. A., Robinson, K., Howie, H. L., Galloway, D. A. β-HPV 5 and 8 E6 disrupt homology dependent double strand break repair by attenuating BRCA1 and BRCA2 expression and foci formation. PLOS Pathogens. 11 (3), 1004687 (2015).
  21. Hu, C., Bugbee, T., Gamez, M., Wallace, N. A. Beta human papillomavirus 8E6 attenuates non-homologous end joining by hindering DNA-PKcs activity. Cancers. 12 (9), 2356 (2020).
  22. Hu, C., Bugbee, T., Dacus, D., Palinski, R., Wallace, N. A. Beta human papillomavirus 8 E6 allows colocalization of non-homologous end joining and homologous recombination repair factors. PLOS Pathogens. 18 (3), 1010275 (2022).
  23. Butler, T. A. J., Paul, J. W., Chan, E. -. C., Smith, R., Tolosa, J. M. Misleading westerns: Common quantification mistakes in western blot densitometry and proposed corrective measures. BioMed Research International. 2019, 5214821 (2019).
  24. Rogakou, E. P., Pilch, D. R., Orr, A. H., Ivanova, V. S., Bonner, W. M. DNA double-stranded breaks induce histone H2AX Phosphorylation on serine 139. Journal of Biological Chemistry. 273 (10), 5858-5868 (1998).
  25. Taning, C. N. T., Van Eynde, B., Yu, N., Ma, S., Smagghe, G. CRISPR/Cas9 in insects: Applications, best practices and biosafety concerns. Journal of Insect Physiology. 98, 245-257 (2017).
  26. Ghezraoui, H., et al. Chromosomal translocations in human cells are generated by canonical nonhomologous end-joining. Molecular Cell. 55 (6), 829-842 (2014).

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2024 MyJoVE Corporation. All rights reserved