Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

Summary

Here, we introduce a detailed soaking method of RNA interference in Bursaphelenchus xylophilus to facilitate the study of gene functions.

Abstract

The pinewood nematode, Bursaphelenchus xylophilus, is one of the most destructive invasive species worldwide, causing the wilting and eventual death of pine trees. Despite the recognition of their economic and environmental significance, it has thus far been impossible to study the detailed gene functions of plant-parasitic nematodes (PPNs) using conventional forward genetics and transgenic methods. However, as a reverse genetics technology, RNA interference (RNAi) facilitates the study of the functional genes of nematodes, including B. xylophilus.

This paper outlines a new protocol for RNAi of the ppm-1 gene in B. xylophilus, which has been reported to play crucial roles in the development and reproduction of other pathogenic nematodes. For RNAi, the T7 promoter was linked to the 5′-terminal of the target fragment by polymerase chain reaction (PCR), and double-stranded RNA (dsRNA) was synthesized by in vitro transcription. Subsequently, dsRNA delivery was accomplished by soaking the nematodes in a dsRNA solution mixed with synthetic neurostimulants. Synchronized juveniles of B. xylophilus (approximately 20,000 individuals) were washed and soaked in dsRNA (0.8 µg/mL) in the soaking buffer for 24 h in the dark at 25 °C.

The same quantity of nematodes was placed in a soaking buffer without dsRNA as a control. Meanwhile, another identical quantity of nematodes was placed in a soaking buffer with green fluorescent protein (gfp) gene dsRNA as a control. After soaking, the expression level of the target transcripts was determined using real-time quantitative PCR. The effects of RNAi were then confirmed using microscopic observation of the phenotypes and a comparison of the body size of the adults among the groups. The current protocol can help advance research to better understand the functions of the genes of B. xylophilus and other parasitic nematodes toward developing control strategies through genetic engineering.

Introduction

Plant-parasitic nematodes (PPNs) are a continuing threat to food security and forest ecosystems. They cause an estimated 100 billion USD in economic losses each year¹, the most problematic of which are primarily root-knot nematodes, cyst nematodes, and pinewood nematodes. The pinewood nematode, Bursaphelenchus xylophilus, is a migratory, endoparasitic nematode, which is the causal pathogen of pine wilt disease². It has caused great harm to pine forests worldwide³. Using the terminology of Van Megen et al.⁴, B. xylophilus is a member of the Parasitaphelench....

Protocol

The study was approved by the council for animal experimentation of Zhejiang Agricultural & Forestry University. The B. xylophilus isolate NXY61 was originally extracted from a diseased Pinus massoniana in the Ningbo area of Zhejiang province, China¹¹.

1. Gene cloning

NOTE: See the Table of Materials for details about the primers used in this protocol.

1. Collect nematodes.

Discussion

Although the life history and parasitic environment of B. xylophilus are different from those of other nematodes, there has been limited research on the molecular pathogenesis of this plant pathogen. Despite great progress made in the application of CRISPR/Cas9 genome editing technology in C. elegans and other nematodes, only RNAi technology applied to B. xylophilus has been published to date¹⁷. RNAi is one of the most powerful tools available to study the gene function .......

Materials

Name	Company	Catalog Number	Comments
Baermann funnel	n/a	n/a	to isolate nematodes
Beacon Designer 7.9	Shanghai kangyusheng information technology co.	n/a	to design qPCR primers
Botrytis cinerea	n/a	n/a	as food for nematodes
Bursaphelenchus xylophilus	n/a	n/a	its number was NXY61 and was it was originally extracted from diseased Pinus massoniana in Ningbo, Zhejiang province, China.
constant temperature incubator	Shanghai Jing Hong Laboratory Instrument Co.	H1703544	to cultur nematodes
Electrophoresis apparatus	Bio-Rad Laboratories	1704466	to achieve electrophoretic analysis
Ethanol, 75%	Sinopharm Chemical Reagent Co.	80176961	to extract RNA
Ex Taq Polymerase Premix	Takara Bio Inc.	RR030A	for PCR
Ex Taq Polymerase Premix	Takara Bio Inc.	RR390A	for PCR
Gel imager	LongGene Scientific Instruments Co.	LG2020	to make nucleic acid bands visible
GraphPad Prism 8	GraphPad Prism	n/a	to analyze the data and make figurs
High Speed Centrifuge	Hangzhou Allsheng Instruments Co.	AS0813000	centrifug
High-flux tissue grinder	Bertin		to extract RNA
ImageJ software	National Institutes of Health	n/a	to measure the body lengths
isopropyl alcohol	Shanghai Aladdin Biochemical Technology Co.	L1909022	to extract RNA
Leica DM4B microscope	Leica Microsystems Inc.		to observe nematodes
magnetic beads	Aoran science technology co.	150010C	to extract RNA
MEGAscript T7 High Yield Transcription Kit	Thermo Fisher Scientific Inc.	AM1333	to synthesize dsRNA in vitro
NanoDrop ND-2000 spectrophotometer	Thermo Fisher Scientific Inc.	NanoDrop 2000/2000C	to analyze the quality of the dsRNA
PCR Amplifier	Bio-Rad Life Medical Products Co.	1851148	to amplify nucleic acid sequence
Petri dishes	n/a	n/a	to cultur nematodes
pGEM-T Easy vector	Promega Corporation	A1360	for cloning
Potato Dextrose Agar (Medium)	n/a	n/a	to cultur Botrytis cinerea
Prime Script RT reagent Kit with gDNA Eraser	Takara Bio Inc.	RR047B	to synthetic cDNA
Primer Premier 5.0	PREMIER Biosoft	n/a	to design PCR primers
primers:ppm-1-F/R	Tsingke Biotechnology Co.	n/a	F: 5'-GATGCGAAGTTGCCAATCATTCT -3'; R: 5'- CCAGATCCAGTCCACCATACACC -3
q-ppm-1-F/R	Tsingke Biotechnology Co.	n/a	F: 5'-CATCCGAATGGCAATACAG-3'; R: 5'-ACTATCCTCAGCGTTAGC-3'
Real-time thermal cycler qTOWER 2.2	Analytique Jena Instruments (Beijing) Co.		for qPCR
shaking table	Shanghai Zhicheng analytical instrument manufacturing co.		to soak nematodes
stereoscopic microscope	Chongqing Optec Instrument Co.	1814120	to observe nematodes
T7-GFP-F/R	Tsingke Biotechnology Co.	n/a	F: 5'-TAATACGACTCACTATAGGGAAA GGAGAAGAACTTTTCAC-3'; R: 5'-TAATACGACTCACTATAGGGCTG TTACAAACTCAAGAAGG-3'
T7 promoter	Tsingke Biotechnology Co.	n/a	TAATACGACTCACTATAGGG
Takara MiniBEST Agarose Gel DNA Extraction Kit	Takara Bio Inc.	9762	to recover DNA
TaKaRa TB Green Premix Ex Taq (Tli RNaseH Plus)	Takara Bio Inc.	RR820A	for qPCR
trichloroethane	Shanghai LingFeng Chemical Reagent Co.		to extract RNA
TRIzol Reagent	Thermo Fisher Scientific Inc.	15596026	total RNA extraction reagent,to extract RNA