Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

Summary

Here, we describe a protocol for visualizing stem-like proliferating cells in the jellyfish Cladonema. Whole-mount fluorescent in situ hybridization with a stem cell marker allows for the detection of stem-like cells, and 5-ethynyl-2'-deoxyuridine labeling enables the identification of proliferating cells. Together, actively proliferating stem-like cells can be detected. 

Abstract

Cnidarians, including sea anemones, corals, and jellyfish, exhibit diverse morphology and lifestyles that are manifested in sessile polyps and free-swimming medusae. As exemplified in established models such as Hydra and Nematostella, stem cells and/or proliferative cells contribute to the development and regeneration of cnidarian polyps. However, the underlying cellular mechanisms in most jellyfish, particularly at the medusa stage, are largely unclear, and, thus, developing a robust method for identifying specific cell types is critical. This paper describes a protocol for visualizing stem-like proliferating cells in the hydrozoan jellyfish Cladonema pacificum. Cladonema medusae possess branched tentacles that continuously grow and maintain regenerative capacity throughout their adult stage, providing a unique platform with which to study the cellular mechanisms orchestrated by proliferating and/or stem-like cells. Whole-mount fluorescent in situ hybridization (FISH) using a stem cell marker allows for the detection of stem-like cells, while pulse labeling with 5-ethynyl-2'-deoxyuridine (EdU), an S phase marker, enables the identification of proliferating cells. Combining both FISH and EdU labeling, we can detect actively proliferating stem-like cells on fixed animals, and this technique can be broadly applied to other animals, including non-model jellyfish species.

Introduction

Cnidaria is considered a basally branching metazoan phylum containing animals with nerves and muscles, placing them in a unique position for understanding the evolution of animal development and physiology^1,2. Cnidarians are categorized into two main groups: Anthozoa (e.g., sea anemones and corals) possess only planula larvae and sessile polyp stages, while Medusozoa (members of Hydrozoa, Staurozoa, Scyphozoa, and Cubozoa) typically take the form of free-swimming medusae, or jellyfish, as well as planula larvae and polyps. Cnidarians commonly exhibit high regenerative capacity, and their underlying cellular me....

Protocol

NOTE: See the Table of Materials for details related to all materials, reagents, and equipment used in this protocol.

1. Probe synthesis

1. RNA extraction
   1. Place three live Cladonema medusae that are cultured in artificial seawater (ASW) in a 1.5 mL tube using a 3.1 mL transfer pipette with the tip cut off, and remove as much ASW as possible.
      NOTE: ASW is prepared by dissolving a mixture of mineral salts in tap water with c.......

Discussion

Proliferating cells and stem cells are important cellular sources in various processes such as morphogenesis, growth, and regeneration^21,22. This paper describes a method for co-staining the stem cell marker Nanos1 by FISH and EdU labeling in Cladonema medusae. Previous work using EdU or BrdU labeling has suggested that proliferative cells localize to the tentacle bulbs^16,17, but their m.......

Materials

Name	Company	Catalog Number	Comments
2-Mercaptoethanol	Wako	137-06862
3.1 mL transfer pipette	Thermo Scientific	233-20S
5-Bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal)	Wako	029-15043
anti-DIG-POD	Roche	11207733910
Cladonema pacificum Nanos1 forward primer			5’-AAGAGACACAGTCATTATCAAGC GA-3’
Cladonema pacificum Nanos1 reverse primer			5’-CGACGTGTCCAATTTTACGTGCT -3’
Cladonema pacificum Piwi forward primer			5’- AAAAGAGCAGCGGCCAGAAAGA AGGC -3’
Cladonema pacificum Piwi reverse primer			5’- GCGGGTCGCATACTTGTTGGTA CTGGC -3’
Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 488 dye	Invitrogen	C10337	EdU kit
Coroline off	GEX Co. ltd	N/A	chlorine neutralizer
DIG Nucleic Acid Detection Kit Blocking Reagent	Roche	11175041910	blocking buffer
DIG RNA labeling mix	Roche	11277073910
DTT	Promega	P117B
ECOS competent cell DH5α	NIPPON GENE	316-06233	competent cell
Fast gene Gel/PCR Extraction kit	Fast gene	FG-91302	gel extraction kit
Fast gene plasmid mini kit	Fast gene	FG-90502	plasmid miniprep
Formamide	Wako	068-00426
Heparin sodium salt from porcine	SIGMA-ALDRICH	H3393-10KU
Isopropyl-β-D(-)-thiogalactopyranoside (IPTG)	Wako	096-05143
LB Agar	Invitrogen	22700-025	agar plate
LB Broth Base	Invitrogen	12780-052	LB medium
Maleic acid	Wako	134-00495
mini Quick spin RNA columns	Roche	11814427001	clean-up column
NaCl	Wako	191-01665
NanoDrop OneC Microvolume UV-Vis Spectrophotometer with Wi-Fi	Thermo Scientific	ND-ONEC-W	spectrophotometer
Polyoxyethlene (20) Sorbitan Monolaurate (Tween-20)	Wako	166-21115
PowerMasher 2	nippi	891300	homogenizer
Proteinase K	Nacarai Tesque	29442-14
RNase Inhibitor	TaKaRa	2313A
RNeasy Mini kit	Qiagen	74004	total RNA isolation kit
RQ1 RNase-Free Dnase	Promega	M6101
Saline Sodium Citrate Buffer 20x powder (20x SSC)	TaKaRa	T9172
SEA LIFE	Marin Tech	N/A	mixture of mineral salts
T3 RNA polymerase	Roche	11031163001
T7 RNA polymerase	Roche	10881767001
TAITEC HB-100	TAITEC	0040534-000	Hybridization incuvator
TaKaRa Ex Taq	TaKaRa	RR001A	Taq DNA polymerase
TaKaRa PrimeScript 2 1st strand cDNA Synthesis Kit	TaKaRa	6210A	cDNA synthesis kit
Target Clone	TOYOBO	TAK101	pTA2 Vector
tRNA	Roche	10109541001
TSA Plus Cyanine 5	AKOYA Biosciences	NEL745001KT	tyramide signal amplification (TSA) technique
Zeiss LSM 880	ZEISS	N/A	laser scanning confocal microscope