This work was supported by AMED under Grant Number JP22gm6110025 (to Y.N.) and by the JSPS KAKENHI Grant Number 22H02762 (to Y.N.).

NOTE: See the Table of Materials for details related to all materials, reagents, and equipment used in this protocol.
1. Probe synthesis
<ol>
	<li>RNA extraction
	<ol>
		<li>Place three live Cladonema medusae that are cultured in artificial seawater (ASW) in a 1.5 mL tube using a 3.1 mL transfer pipette with the tip cut off, and remove as much ASW as possible. 
		NOTE: ASW is prepared by dissolving a mixture of mineral salts in tap water with chlorine neutralizer; the final specific gravity (S.G.) is 1.018 or the parts per thousand (ppt) is ~27.</li>
		<li>Freeze the 1.5 mL tubes in liquid nitrogen to inhibit RNase activity. Add 30 &#181;L of lysis buffer from the total RNA isolation kit in which 2-mercaptoethanol (1 &#181;L/100 &#181;L of lysis buffer) has been added and homogenize the samples in the lysis buffer using a homogenizer. 
		NOTE: To avoid overflow of the buffer and sample from the tubes, homogenization with a small amount of lysis buffer is recommended.</li>
		<li>Add 570 &#181;L of lysis buffer and extract the total RNA following the protocol of the total RNA isolation kit (Figure 1).</li>
		<li>Measure the concentration of the extracted RNA using a spectrophotometer and store at &#8722;80 &#176;C until use.</li>
	</ol>
	</li>
	<li>cDNA synthesis
	<ol>
		<li>Using a kit, synthesize cDNA using the total RNA extracted from the medusae as a template (Figure 1 and Table 1).</li>
		<li>Incubate at 65 &#176;C for 5 min.</li>
		<li>Cool rapidly on ice.</li>
		<li>Perform cDNA synthesis with the mixture from step 1.2.1 (Table 1). Mix thoroughly by pipetting and incubate at 42 &#176;C for 60 min.</li>
		<li>Incubate at 95 &#176;C for 5 min.</li>
		<li>Cool rapidly on ice.</li>
		<li>Measure the concentration of the synthesized cDNA using a spectrophotometer and store at or below &#8722;20 &#176;C until use.</li>
	</ol>
	</li>
	<li>PCR product synthesis
	<ol>
		<li>To create a PCR template, design the specific primer using Primer-BLAST. Source the reference sequence from NCBI data or RNA-seq data. 
		NOTE: See the Table of Materials for the primers used in this protocol.</li>
		<li>To amplify the target sequence, perform TA cloning, which does not require the use of restriction enzymes. To obtain a PCR product in which an adenine is added at the 3&#39; end, use the following settings: 98 &#176;C for 2 min; 35 cycles of 98 &#176;C for 10 s, 55-60 &#176;C for 30 s, 72 &#176;C for 1 min. Use Taq DNA polymerase for the reactions (Table 1). 
		NOTE: To determine the PCR conditions, follow the protocol that accompanies the DNA polymerase to be used, which generally provides a recommended annealing temperature and extension time.</li>
		<li>Run the PCR product through a 1% agarose gel and cut out the band of interest. Extract the PCR products from the cut gels using a gel extraction kit.</li>
	</ol>
	</li>
	<li>Ligation
	<ol>
		<li>Ligate the PCR product to the vector with 3&#39; thymine overhangs by mixing the reagents (Table 1) and incubating at 37 &#176;C for 30 min (Figure 1). 
		NOTE: The molecular ratio of vector:PCR should be 1:&#62;3. The pTA2 vector size is approximately 3 kb. If the PCR product (insert) is A (kb) and B (ng/&#181;L), the volume of the insert (X in Table 1) to be taken can be calculated by ([50 ng of vector &#215; A kb of insert])/(3 kb vector &#215; [1/3]) = 50&#183;A ng of insert. If the concentration of insert is B ng/&#181;L, then volume taken is 50&#183;A/B &#181;L of insert.</li>
	</ol>
	</li>
	<li>Transformation and plating
	<ol>
		<li>For transformation, thaw the competent cells on ice and dispense them into 20 &#181;L aliquots each. Add 1 &#181;L of the plasmids containing the PCR product (less than 5% of competent cell volume) and vortex for 1 s. Incubate on ice for 5 min, and then incubate at 42 &#176;C for 45 s, and vortex for 1 s.</li>
		<li>Add 180 &#181;L of Super Optimal broth with Catabolite repression (SOC) medium (a nutritionally rich bacterial culture medium) to the competent cells and incubate at 37 &#176;C for 30 min. After 30 min, spread the competent cells onto an agar plate containing ampicillin, 5-bromo-4-chloro-3-indolyl-beta-D-galacto-pyranoside (X-gal), and isopropyl-&#946;-d-1-thiogalactopyranoside (IPTG), and incubate at 37 &#176;C for 12-16 h (Figure 1). 
		NOTE: X-gal and IPTG are used for selecting blue and white colonies.</li>
	</ol>
	</li>
	<li>Liquid culture
	<ol>
		<li>Pick a white colony out of the white and blue colonies on the plate. Add it to 3-5 mL of LB medium with ampicillin and incubate on a shaker for 12-16 h at 37 &#176;C (Figure 1).</li>
	</ol>
	</li>
	<li>Miniprep
	<ol>
		<li>Extract the plasmid from the LB medium using a plasmid miniprep (Figure 1).</li>
		<li>Quantify the plasmid concentration using a spectrophotometer.</li>
	</ol>
	</li>
	<li>Read the sequence.
	<ol>
		<li>To read the DNA sequence of the plasmid, send the plasmid for Sanger sequencing and then use software to align it with the genome/transcriptome sequence to confirm whether the target sequence is properly synthesized and assess in which direction the target sequence is inserted into the plasmid (5&#39; to 3&#39; or 3&#39; to 5&#39;). 
		NOTE: If the target sequence is inserted into the plasmid in the 5&#39; to 3&#39; direction from the RNA polymerase binding site near the 3&#39; end, an antisense probe can be generated by in vitro transcription. If the target sequence is inserted in the reverse 3&#39; to 5&#39; direction, a sense probe (negative control) can be generated. If using vectors such as pTA2, two transcription binding sites can be used depending on the purpose.</li>
	</ol>
	</li>
	<li>In vitro transcription
	<ol>
		<li>Prepare the DNA template from the created plasmid by performing PCR using primers outside the RNA polymerase binding site (e.g., T7/T3 binding sites) in the plasmid (Figure 1). 
		NOTE: Universal primers such as the M13-20 forward primer and the M13 reverse primer can be used to prepare a DNA template that includes RNA polymerase binding sites.</li>
		<li>Purify the template after PCR amplification using a gel/PCR extraction kit.</li>
		<li>Mix the reagents shown below, and perform the transcription reaction at 37 &#176;C for 3 h (Figure 1 and Table 1).</li>
		<li>Add 1.5 &#181;L of DNase and incubate at 37 &#176;C for 30 min.</li>
		<li>Add 10 &#181;L of RNase-free water and purify the probe from the transcription reaction solution using a clean-up column.</li>
		<li>Check the size of the synthesized RNA by loading 1 &#181;L onto a 1% agarose gel and determine the concentration using a spectrophotometer. 
		NOTE: Synthesized RNA probes should have a concentration of at least 100 ng/&#181;L.</li>
		<li>Add 30 &#181;L of formamide for storage at or below &#8722;20 &#176;C.</li>
	</ol>
	</li>
</ol>
2. EdU incorporation and fixation
<ol>
	<li>Place Cladonema medusae (5-10 animals per tube) into 1.5 mL tubes using a 3.5 mL transfer pipette and add ASW up to a total volume of 500 &#181;L. Add 7.5 &#181;L of 10 mM EdU stock solution and incubate the samples for 1 h at 22 &#176;C (Figure 2). The EdU final concentration is 150 &#181;M. 
	NOTE: Use 5-7-day-old medusae to monitor third branch formation (Figure 3A). The day that the medusae detach from the polyp is counted as day 1, and on day 5, medusae typically start to exhibit a third branch on their main tentacles.</li>
	<li>After 1 h, remove as much ASW containing EdU as possible.</li>
	<li>To anesthetize the medusae, add 7% MgCl2 in H2O and incubate for 5 min.</li>
	<li>Remove the 7% MgCl2 in H2O and fix the medusae overnight (O.N.) at 4 &#176;C with 4% paraformaldehyde (PFA) in ASW (Figure 2). 
	NOTE: When performing FISH without EdU incorporation, samples can be fixed similarly to those treated with EdU following anesthetization (steps 2.3-2.4).</li>
</ol>
3. Fluorescent&#160;&#160;in situ hybridization
<ol>
	<li>Proteinase treatment and post fixation
	<ol>
		<li>Remove the PFA and wash the samples with PBS containing 0.1% Tween-20 (PBST) for 3 x 10 min. Use 300-500 &#181;L of PBST per wash. 
		NOTE: From this step to the end of hybridization, the experiment should be performed in an RNase-free environment, wearing gloves and a mask. The 1x PBS in this step must be made with DEPC-treated water. After hybridization, 1x PBS made with water without DEPC treatment can be used. Some ISH and FISH protocols dehydrate samples using methanol steps, which makes it possible to save the fixed samples at &#8722;20 &#176;C until use. To avoid superfluous work, the dehydration process is omitted from this protocol, particularly since the samples can be kept in PBST for up to a few days.</li>
		<li>After fixation, place the sample in 1.5 mL tubes on a shaker, except for the anti-DIG-POD antibody O.N. incubation step (step 3.4.2). After washing, add 10 mg/mL Proteinase K stock solution in PBST and incubate the medusae with Proteinase K (final concentration: 10 &#181;g/mL) at 37 &#176;C for 10 min.</li>
		<li>Remove the Proteinase K solution and wash the samples for 2 x 1 min with PBST.</li>
		<li>To postfix the medusae, add 4% PFA in 1x PBS and incubate at 37 &#176;C for 15 min.</li>
		<li>Remove the PFA solution and wash the samples for 2 x 10 min with PBST. 
		NOTE: If the target gene is highly expressed with low background signal, steps 3.1.2-3.1.5 can be skipped.</li>
	</ol>
	</li>
	<li>Hybridization
	<ol>
		<li>Remove the PBST and add Hybridization Buffer (HB Buffer, Table 1). Incubate the samples in HB Buffer for 15 min at room temperature (RT). Use 300-400 &#181;L of HB Buffer, which provides enough volume for successful hybridization. 
		NOTE: HB Buffer, Wash Buffer 1, and Wash Buffer 2 are prepared with 20x SSC stock. HB Buffer is stored at or below &#8722;20 &#176;C and must be brought to RT before use.</li>
		<li>Remove the HB Buffer and add new HB Buffer. Prehybridize at 55 &#176;C for at least 2 h in a hybridization incubator.</li>
		<li>Remove the HB Buffer and incubate with HB Buffer containing the probes that were stored in step 1.9.7 (final probe concentration: 0.5-1 ng/&#181;L in HB Buffer). Hybridize at 55 &#176;C for 18-24 h (Figure 2) in a hybridization incubator. 
		NOTE: FISH signal intensity and specificity can vary due to target gene expression, as well as probe length and specificity. To increase the intensity, parameters such as hybridization duration (18-72 h) and temperature (50-65 &#176;C) can be adjusted, and different probes can be tested. To avoid non-specific signals, Proteinase K treatment (concentration and duration) can be modified19.</li>
	</ol>
	</li>
	<li>Probe removal
	<ol>
		<li>Remove the HB Buffer containing probes, and then add Wash Buffer 1 (Table 1). Wash the samples with Wash Buffer 1 for 2 x 15 min at 55 &#176;C. Use 300-400 &#181;L of wash buffer. 
		&#8203;NOTE: HB Buffer containing probes can be used repeatedly, up to about ten times. Instead of discarding, store the used HB Buffer containing probes at or below &#8722;20 &#176;C. Preheat Wash Buffer 1, Wash Buffer 2, 2x SSC, and PBST at 55 &#176;C before use.</li>
		<li>Remove Wash Buffer 1, and then add Wash Buffer 2 (Table 1). Wash the samples with Wash Buffer 2 for 2 x 15 min at 55 &#176;C.</li>
		<li>Remove Wash Buffer 2, and then add 2x SSC. Wash the samples with 2x SSC for 2 x 15 min at 55 &#176;C.</li>
		<li>Remove 2x SSC, and then add preheated PBST. Wash the samples for 1 x 15 min with PBST at RT.</li>
	</ol>
	</li>
	<li>Anti-DIG antibody incubation
	<ol>
		<li>Remove PBST, and then add 1% blocking buffer. Incubate the samples for at least 1 h at RT while shaking slowly on a rocker. 
		NOTE: Prepare 1% blocking buffer freshly by diluting 5% blocking buffer stock (Table 1). Check the samples before the next antibody reaction because the sample tends to stick to the back of the lid or the wall as a result of shaking.</li>
		<li>After blocking, remove the 1% blocking buffer, add anti-DIG-POD solution (1:500, in 1% blocking buffer), and incubate the samples O.N. at 4 &#176;C (Figure 2). 
		NOTE: Be careful to keep the incubation time within 12-16 h to prevent the detection of non-specific signals.</li>
	</ol>
	</li>
	<li>Detection of DIG-labeled probe
	<ol>
		<li>Remove the anti-DIG-POD solution, and then add Tris-NaCl-Tween Buffer (TNT, Table 1). Wash the samples with TNT for 3 x 10 min at RT. 
		NOTE: The use of the tyramide signal amplification (TSA) technique provides a better resolution image against horseradish peroxidase-labeled reagents (e.g., anti-DIG-POD).</li>
		<li>Dilute fluorescent dye-conjugated tyramide (Cy5-tyramide) stock solution (1:50) in the amplification diluent buffer to make the active Cy5-tyramide solution (Figure 2).</li>
		<li>Remove as much TNT as possible, and then add the active Cy5-tyramide solution. Incubate the samples for 10 min in the dark.</li>
		<li>Wash the samples with PBST for 3 x 10 min in the dark.</li>
	</ol>
	</li>
	<li>Detection of EdU 
	NOTE: The EdU kit detects incorporated EdU as fluorescent signals (Figure 2).
	<ol>
		<li>To prepare the EdU detection cocktail, mix the components as shown in Table 1. Use 100 &#181;L of EdU detection cocktail for each sample. 
		NOTE: Prepare 1x Reaction Buffer additive by diluting 10x Reaction Buffer additive with ultrapure water.</li>
		<li>Remove PBST, and then add the EdU detection cocktail. Incubate in the dark for 30 min.</li>
		<li>Wash with PBST for 3 x 10 min in the dark.</li>
	</ol>
	</li>
	<li>DNA staining
	<ol>
		<li>Dilute Hoechst 33342 (1:500) in PBST to prepare the Hoechst solution. Remove the PBST, and then add the Hoechst solution. Incubate the samples for 30 min in the dark (Figure 2).</li>
		<li>Wash the samples with PBST for 3-4 x 10 min in the dark.</li>
	</ol>
	</li>
	<li>Mounting
	<ol>
		<li>Make a bank on the glass slide to prevent the sample from being crushed. Apply vinyl tape to the glass slide and hollow out the center.</li>
		<li>Transfer the medusae to the bank on the slide glass using a 3.1 mL transfer pipette with the tip cut off. 
		NOTE: Be careful not to let the tentacles overlap.</li>
		<li>Remove any PBST with a P200 pipette, and then slowly add 70% glycerol as the mounting medium (Figure 2). 
		NOTE: Instead of 70% glycerol, anti-fading mounting medium can be used to prevent the fluorescence from fading.</li>
		<li>Gently place a coverslip on the medusae with forceps, and seal the side of the coverslip with clear nail polish.</li>
		<li>Keep the slides at 4 &#176;C in the dark if not immediately performing microscopy observation.</li>
	</ol>
	</li>
	<li>Imaging
	<ol>
		<li>Use a laser scanning confocal microscope to acquire images. For single-cell resolution, use a 40x oil lens or a lens for higher magnification.</li>
		<li>After image acquisition, open the images using ImageJ/FIJI software and count cells that are positive for EdU+ and/or Nanos1+&#160;by the multipoint tool20.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Lecl&#232;re, L., R&#246;ttinger, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diversity+of+cnidarian+muscles:+Function,+anatomy,+development+and+regeneration.">Diversity of cnidarian muscles: Function, anatomy, development and regeneration.</a> Frontiers in Cell and Developmental Biology. 4, 157 (2017).</li><li>Bosch, T. C. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Back+to+the+basics:+Cnidarians+start+to+fire.">Back to the basics: Cnidarians start to fire.</a> Trends in Neurosciences. 40 (2), 92-105 (2017).</li><li>Gold, D. A., Jacobs, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stem+cell+dynamics+in+Cnidaria:+Are+there+unifying+principles.">Stem cell dynamics in Cnidaria: Are there unifying principles.</a> Development Genes and Evolution. 223 (1-2), 53-66 (2013).</li><li>Technau, U., Steele, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+crossroads+in+developmental+biology:+Cnidaria.">Evolutionary crossroads in developmental biology: Cnidaria.</a> Development. 138 (8), 1447-1458 (2011).</li><li>Lecl&#232;re, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternally+localized+germ+plasm+mRNAs+and+germ+cell/stem+cell+formation+in+the+cnidarian+Clytia.">Maternally localized germ plasm mRNAs and germ cell/stem cell formation in the cnidarian Clytia.</a> Developmental Biology. 364 (2), 236-248 (2012).</li><li>Bradshaw, B., Thompson, K., Frank, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+mechanisms+underlie+oral+vs+aboral+regeneration+in+the+cnidarian+Hydractinia+echinata.">Distinct mechanisms underlie oral vs aboral regeneration in the cnidarian Hydractinia echinata.</a> eLife. 4, 05506 (2015).</li><li>Sinigaglia, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pattern+regulation+in+a+regenerating+jellyfish.">Pattern regulation in a regenerating jellyfish.</a> eLife. 9, 54868 (2020).</li><li>David, C. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interstitial+stem+cells+in+Hydra:+Multipotency+and+decision-making.">Interstitial stem cells in Hydra: Multipotency and decision-making.</a> The International Journal of Developmental Biology. 56 (6-7-8), 489-497 (2012).</li><li>R&#246;ttinger, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nematostella+vectensis,+an+emerging+model+for+deciphering+the+molecular+and+cellular+mechanisms+underlying+whole-body+regeneration.">Nematostella vectensis, an emerging model for deciphering the molecular and cellular mechanisms underlying whole-body regeneration.</a> Cells. 10 (10), 2692 (2021).</li><li>Houliston, E., Momose, T., Manuel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clytia+hemisphaerica:+A+jellyfish+cousin+joins+the+laboratory.">Clytia hemisphaerica: A jellyfish cousin joins the laboratory.</a> Trends in Genetics. 26 (4), 159-167 (2010).</li><li>Peron, S., Houliston, E., Lecl&#232;re, L., Boutet, A., Shierwater, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Marine+Jellyfish+Model,+Clytia+hemisphaerica.">The Marine Jellyfish Model, Clytia hemisphaerica.</a> Handbook of Marine Model Organisms in Experimental Biology. , 129-147 (2021).</li><li>Denker, E., Manuel, M., Lecl&#232;re, L., Le Guyader, H., Rabet, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ordered+progression+of+nematogenesis+from+stem+cells+through+differentiation+stages+in+the+tentacle+bulb+of+Clytia+hemisphaerica+(Hydrozoa,+Cnidaria).">Ordered progression of nematogenesis from stem cells through differentiation stages in the tentacle bulb of Clytia hemisphaerica (Hydrozoa, Cnidaria).</a> Developmental Biology. 315 (1), 99-113 (2008).</li><li>Fujita, S., Kuranaga, E., Nakajima, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regeneration+potential+of+jellyfish:+Cellular+mechanisms+and+molecular+insights.">Regeneration potential of jellyfish: Cellular mechanisms and molecular insights.</a> Genes. 12 (5), 758 (2021).</li><li>Suga, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flexibly+deployed+Pax+genes+in+eye+development+at+the+early+evolution+of+animals+demonstrated+by+studies+on+a+hydrozoan+jellyfish.">Flexibly deployed Pax genes in eye development at the early evolution of animals demonstrated by studies on a hydrozoan jellyfish.</a> Proceedings of the National Academy of Sciences. 107 (32), 14263-14268 (2010).</li><li>Fujiki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Branching+pattern+and+morphogenesis+of+medusa+tentacles+in+the+jellyfish+Cladonema+pacificum+(Hydrozoa,+Cnidaria).">Branching pattern and morphogenesis of medusa tentacles in the jellyfish Cladonema pacificum (Hydrozoa, Cnidaria).</a> Zoological Letters. 5 (12), 13 (2019).</li><li>Fujita, S., Kuranaga, E., Nakajima, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+proliferation+controls+body+size+growth,+tentacle+morphogenesis,+and+regeneration+in+hydrozoan+jellyfish+Cladonema+pacificum.">Cell proliferation controls body size growth, tentacle morphogenesis, and regeneration in hydrozoan jellyfish Cladonema pacificum.</a> PeerJ. 7, 7579 (2019).</li><li>Hou, S., Zhu, J., Shibata, S., Nakamoto, A., Kumano, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repetitive+accumulation+of+interstitial+cells+generates+the+branched+structure+of+Cladonema+medusa+tentacles.">Repetitive accumulation of interstitial cells generates the branched structure of Cladonema medusa tentacles.</a> Development. 148 (23), (2021).</li><li>Salic, A., Mitchison, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chemical+method+for+fast+and+sensitive+detection+of+DNA+synthesis+in+vivo.">A chemical method for fast and sensitive detection of DNA synthesis in vivo.</a> Proceedings of the National Academy of Sciences of the United States of America. 105 (7), 2415-2420 (2008).</li><li>Angerer, L. M., Angerer, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+poly+A+++RNA+in+sea+urchin+eggs+and+embryos+by+quantitative+in+situ+hybridization.">Detection of poly A + RNA in sea urchin eggs and embryos by quantitative in situ hybridization.</a> Nucleic Acids Research. 9 (12), 2819-2840 (1981).</li><li>Rakotomamonjy, J., Guemez-Gamboa, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purkinje+cell+survival+in+organotypic+cerebellar+slice+cultures.">Purkinje cell survival in organotypic cerebellar slice cultures.</a> Journal of Visualized Experiments. (154), e60353 (2019).</li><li>Tanaka, E. M., Reddien, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cellular+basis+for+animal+regeneration.">The cellular basis for animal regeneration.</a> Developmental Cell. 21 (1), 172-185 (2011).</li><li>Penzo-M&#233;ndez, A. I., Stanger, B. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organ-size+regulation+in+mammals.">Organ-size regulation in mammals.</a> Cold Spring Harbor Perspectives in Biology. 7 (9), 019240 (2015).</li><li>Sinigaglia, C., Thiel, D., Hejnol, A., Houliston, E., Lecl&#232;re, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+safer,+urea-based+in+situ+hybridization+method+improves+detection+of+gene+expression+in+diverse+animal+species.">A safer, urea-based in situ hybridization method improves detection of gene expression in diverse animal species.</a> Developmental Biology. 434 (1), 15-23 (2018).</li><li>King, R. S., Newmark, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+hybridization+protocol+for+enhanced+detection+of+gene+expression+in+the+planarian+Schmidtea+mediterranea.">In situ hybridization protocol for enhanced detection of gene expression in the planarian Schmidtea mediterranea.</a> BMC Developmental Biology. 13 (1), 8 (2013).</li><li>Flici, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+evolutionarily+conserved+SoxB-Hdac2+crosstalk+regulates+neurogenesis+in+a+cnidarian.">An evolutionarily conserved SoxB-Hdac2 crosstalk regulates neurogenesis in a cnidarian.</a> Cell Reports. 18 (6), 1395-1409 (2017).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+axial+Hox+code+controls+tissue+segmentation+and+body+patterning+in+Nematostella+vectensis.">An axial Hox code controls tissue segmentation and body patterning in Nematostella vectensis.</a> Science. 361 (6409), 1377-1380 (2018).</li><li>Govindasamy, N., Murthy, S., Ghanekar, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Slow-cycling+stem+cells+in+hydra+contribute+to+head+regeneration.">Slow-cycling stem cells in hydra contribute to head regeneration.</a> Biology Open. 3 (12), 1236-1244 (2014).</li><li>Passamaneck, Y. J., Martindale, M. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+proliferation+is+necessary+for+the+regeneration+of+oral+structures+in+the+anthozoan+cnidarian+Nematostella+vectensis.">Cell proliferation is necessary for the regeneration of oral structures in the anthozoan cnidarian Nematostella vectensis.</a> BMC Developmental Biology. 12 (1), 34 (2012).</li><li>Gold, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+developmental+disparity+in+the+tentacles+of+the+moon+jellyfish+Aurelia+sp.1.">Structural and developmental disparity in the tentacles of the moon jellyfish Aurelia sp.1.</a> PLoS One. 10 (8), 0134741 (2015).</li><li>Gold, D. A., Nakanishi, N., Hensley, N. M., Hartenstein, V., Jacobs, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+tracking+supports+secondary+gastrulation+in+the+moon+jellyfish+Aurelia.">Cell tracking supports secondary gastrulation in the moon jellyfish Aurelia.</a> Development Genes and Evolution. 226 (6), 383-387 (2016).</li><li>Cheng, L. -. C., Alvarado, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-mount+BrdU+staining+with+fluorescence+in+situ+hybridization+in+planarians.">Whole-mount BrdU staining with fluorescence in situ hybridization in planarians.</a> Planarian Regeneration. 1774, 423-434 (2018).</li></ol>

The authors have no conflicts of interest to disclose.

Proliferating cells and stem cells are important cellular sources in various processes such as morphogenesis, growth, and regeneration21,22. This paper describes a method for co-staining the stem cell marker Nanos1 by FISH and EdU labeling in Cladonema medusae. Previous work using EdU or BrdU labeling has suggested that proliferative cells localize to the tentacle bulbs16,17, but their m...

Cnidaria is considered a basally branching metazoan phylum containing animals with nerves and muscles, placing them in a unique position for understanding the evolution of animal development and physiology1,2. Cnidarians are categorized into two main groups: Anthozoa (e.g., sea anemones and corals) possess only planula larvae and sessile polyp stages, while Medusozoa (members of Hydrozoa, Staurozoa, Scyphozoa, and Cubozoa) typically take the form of free-swimming medusae, or jellyfish, as well as planula larvae and polyps. Cnidarians commonly exhibit high regenerative capacity, and their underlying cellular mechanisms, particularly their possession of adult stem cells and proliferative cells, have attracted much attention3,4. Initially identified in Hydra, hydrozoan stem cells are located in the interstitial spaces between ectodermal epithelial cells and are commonly referred to as interstitial cells or i-cells3.
Hydrozoan i-cells share common characteristics that include multipotency, the expression of widely conserved stem cell markers (e.g., Nanos, Piwi, Vasa), and migration potential3,5,6,7,8. As functional stem cells, i-cells are extensively involved in the development, physiology, and environmental responses of hydrozoan animals, which attests to their high regenerative capacity and plasticity3. While stem cells, similar to i-cells, have not been identified outside of hydrozoans, even in the established model species Nematostella, proliferative cells are still involved in the maintenance and regeneration of somatic tissue, as well as the germ line9. As studies in cnidarian development and regeneration have been predominantly conducted on polyp-type animals such as Hydra, Hydractinia, and Nematostella, the cellular dynamics and functions of stem cells in jellyfish species remain largely unaddressed.
The hydrozoan jellyfish Clytia hemisphaerica, a cosmopolitan jellyfish species with different habitats around the world, including the Mediterranean Sea and North America, has been utilized as an experimental model animal in several developmental and evolutionary studies10. With its small size, easy handling, and large eggs, Clytia is suitable for lab maintenance, as well as for the introduction of genetic tools such as the recently established transgenesis and knockout methods11, opening up the opportunity for detailed analysis of the cellular and molecular mechanisms underlying jellyfish biology. In the Clytia medusa tentacle, i-cells are localized in the proximal region, called the bulb, and progenitors such as nematoblasts migrate to the distal tip while differentiating into distinct cell types, including nematocytes12.
During regeneration of the Clytia manubrium, the oral organ of jellyfish, Nanos1+ i-cells that are present in the gonads migrate to the region where the manubrium is lost in response to damage and participate in the regeneration of the manubrium7. These findings support the idea that i-cells in Clytia also behave as functional stem cells that are involved in morphogenesis and regeneration. However, given that the properties of i-cells differ among representative polyp-type animals such as Hydra and Hydractinia3, it is possible that the characteristics and functions of stem cells are diversified among jellyfish species. Furthermore, with the exception of Clytia, experimental techniques have been limited for other jellyfish, and the detailed dynamics of proliferative cells and stem cells are unknown13.
The hydrozoan jellyfish Cladonema pacificum is an emerging model organism that can be kept in a laboratory environment without a water pump or filtration system. The Cladonema medusa has branched tentacles, a common characteristic in the Cladonematidae family, and a photoreceptor organ called the ocellus on the ectodermal layer near the bulb14. The tentacle branching process occurs at a new branching site that appears along the adaxial side of the tentacle. Over time, the tentacles continue to elongate and branch, with the older branches being pushed out toward the tip15. In addition, Cladonema tentacles can regenerate within a few days upon amputation. Recent studies have suggested the role of proliferating cells and stem-like cells in tentacle branching and regeneration in Cladonema16,17. However, while conventional in situ hybridization (ISH) has been utilized to visualize gene expression in Cladonema, due to its low resolution, it is currently difficult to observe stem cell dynamics at the cellular level in detail.
This paper describes a method for visualizing stem-like cells in Cladonema by FISH and co-staining with EdU, a marker of cell proliferation18. We visualize the expression pattern of Nanos1, a stem cell marker5,17, by FISH, which allows for the identification of stem-like cell distribution at the single-cell level. In addition, the co-staining of Nanos1 expression with EdU labeling makes it possible to distinguish actively proliferating stem-like cells. This method for monitoring both stem-like cells and proliferative cells can be applied to a wide range of investigative areas, including tentacle branching, tissue homeostasis, and organ regeneration in Cladonema, and a similar approach can be applied to other jellyfish species.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2-Mercaptoethanol&#160;</td>
			<td>Wako</td>
			<td>137-06862</td>
			<td></td>
		</tr>
		<tr>
			<td>3.1 mL transfer pipette</td>
			<td>Thermo Scientific</td>
			<td>233-20S</td>
			<td></td>
		</tr>
		<tr>
			<td>5-Bromo-4-chloro-3-indolyl-&#946;-D-galactopyranoside (X-Gal)</td>
			<td>Wako</td>
			<td>029-15043</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-DIG-POD</td>
			<td>Roche</td>
			<td>11207733910</td>
			<td></td>
		</tr>
		<tr>
			<td>Cladonema pacificum Nanos1 forward primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;-AAGAGACACAGTCATTATCAAGC 
			GA-3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Nanos1 reverse primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;-CGACGTGTCCAATTTTACGTGCT -3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Piwi forward primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;- AAAAGAGCAGCGGCCAGAAAGA 
			AGGC -3&#8217;</td>
		</tr>
		<tr>
			<td>Cladonema pacificum Piwi reverse primer</td>
			<td></td>
			<td></td>
			<td>5&#8217;- GCGGGTCGCATACTTGTTGGTA 
			CTGGC -3&#8217;</td>
		</tr>
		<tr>
			<td>Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 488 dye</td>
			<td>Invitrogen&#160;</td>
			<td>C10337</td>
			<td>EdU kit</td>
		</tr>
		<tr>
			<td>Coroline off</td>
			<td>GEX Co. ltd</td>
			<td>N/A</td>
			<td>chlorine neutralizer</td>
		</tr>
		<tr>
			<td>DIG Nucleic Acid Detection Kit Blocking Reagent</td>
			<td>Roche</td>
			<td>11175041910</td>
			<td>blocking buffer&#160;</td>
		</tr>
		<tr>
			<td>DIG RNA labeling mix&#160;</td>
			<td>Roche</td>
			<td>11277073910</td>
			<td></td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>Promega</td>
			<td>P117B</td>
			<td></td>
		</tr>
		<tr>
			<td>ECOS competent cell DH5&#945;</td>
			<td>NIPPON GENE</td>
			<td>316-06233</td>
			<td>competent cell</td>
		</tr>
		<tr>
			<td>Fast gene Gel/PCR Extraction kit</td>
			<td>Fast gene</td>
			<td>FG-91302</td>
			<td>gel extraction kit</td>
		</tr>
		<tr>
			<td>Fast gene plasmid mini kit</td>
			<td>Fast gene</td>
			<td>FG-90502</td>
			<td>plasmid miniprep</td>
		</tr>
		<tr>
			<td>Formamide</td>
			<td>Wako&#160;</td>
			<td>068-00426</td>
			<td></td>
		</tr>
		<tr>
			<td>Heparin sodium salt from porcine</td>
			<td>SIGMA-ALDRICH&#160;</td>
			<td>H3393-10KU</td>
			<td></td>
		</tr>
		<tr>
			<td>Isopropyl-&#946;-D(-)-thiogalactopyranoside (IPTG)</td>
			<td>Wako</td>
			<td>096-05143</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Agar</td>
			<td>Invitrogen</td>
			<td>22700-025</td>
			<td>agar plate</td>
		</tr>
		<tr>
			<td>LB Broth Base</td>
			<td>Invitrogen</td>
			<td>12780-052</td>
			<td>LB medium</td>
		</tr>
		<tr>
			<td>Maleic acid</td>
			<td>Wako</td>
			<td>134-00495</td>
			<td></td>
		</tr>
		<tr>
			<td>mini Quick spin RNA columns</td>
			<td>Roche</td>
			<td>11814427001</td>
			<td>clean-up column</td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Wako&#160;</td>
			<td>191-01665</td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop OneC Microvolume UV-Vis Spectrophotometer with Wi-Fi</td>
			<td>Thermo Scientific</td>
			<td>ND-ONEC-W</td>
			<td>spectrophotometer</td>
		</tr>
		<tr>
			<td>Polyoxyethlene (20) Sorbitan Monolaurate (Tween-20)</td>
			<td>Wako&#160;</td>
			<td>166-21115</td>
			<td></td>
		</tr>
		<tr>
			<td>PowerMasher 2</td>
			<td>nippi&#160;</td>
			<td>891300</td>
			<td>homogenizer</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Nacarai Tesque&#160;</td>
			<td>29442-14</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase Inhibitor</td>
			<td>TaKaRa</td>
			<td>2313A</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini kit</td>
			<td>Qiagen&#160;</td>
			<td>74004</td>
			<td>total RNA isolation kit</td>
		</tr>
		<tr>
			<td>RQ1 RNase-Free Dnase</td>
			<td>Promega</td>
			<td>M6101</td>
			<td></td>
		</tr>
		<tr>
			<td>Saline Sodium Citrate Buffer 20x powder (20x SSC)</td>
			<td>TaKaRa</td>
			<td>T9172</td>
			<td></td>
		</tr>
		<tr>
			<td>SEA LIFE</td>
			<td>Marin Tech</td>
			<td>N/A</td>
			<td>mixture of mineral salts</td>
		</tr>
		<tr>
			<td>T3 RNA polymerase&#160;</td>
			<td>Roche</td>
			<td>11031163001</td>
			<td></td>
		</tr>
		<tr>
			<td>T7 RNA polymerase&#160;</td>
			<td>Roche</td>
			<td>10881767001</td>
			<td></td>
		</tr>
		<tr>
			<td>TAITEC HB-100</td>
			<td>TAITEC</td>
			<td>0040534-000</td>
			<td>Hybridization incuvator</td>
		</tr>
		<tr>
			<td>TaKaRa Ex Taq&#160;</td>
			<td>TaKaRa</td>
			<td>RR001A</td>
			<td>Taq DNA polymerase</td>
		</tr>
		<tr>
			<td>TaKaRa PrimeScript 2 1st strand cDNA Synthesis Kit</td>
			<td>TaKaRa</td>
			<td>6210A</td>
			<td>cDNA synthesis kit</td>
		</tr>
		<tr>
			<td>Target Clone</td>
			<td>TOYOBO&#160;</td>
			<td>TAK101</td>
			<td>pTA2 Vector</td>
		</tr>
		<tr>
			<td>tRNA</td>
			<td>Roche</td>
			<td>10109541001</td>
			<td></td>
		</tr>
		<tr>
			<td>TSA Plus Cyanine 5</td>
			<td>AKOYA Biosciences</td>
			<td>NEL745001KT</td>
			<td>tyramide signal amplification (TSA) technique</td>
		</tr>
		<tr>
			<td>Zeiss LSM 880</td>
			<td>ZEISS</td>
			<td>N/A</td>
			<td>laser scanning confocal microscope</td>
		</tr>
	</tbody>
</table>

fluorescent in situ hybridization and 5-ethynyl-2'-deoxyuridine labeling for stem-like cells in the hydrozoan jellyfish cladonema pacificum

Cnidarians, including sea anemones, corals, and jellyfish, exhibit diverse morphology and lifestyles that are manifested in sessile polyps and free-swimming medusae. As exemplified in established models such as Hydra and Nematostella, stem cells and/or proliferative cells contribute to the development and regeneration of cnidarian polyps. However, the underlying cellular mechanisms in most jellyfish, particularly at the medusa stage, are largely unclear, and, thus, developing a robust method for identifying specific cell types is critical. This paper describes a protocol for visualizing stem-like proliferating cells in the hydrozoan jellyfish Cladonema pacificum. Cladonema medusae possess branched tentacles that continuously grow and maintain regenerative capacity throughout their adult stage, providing a unique platform with which to study the cellular mechanisms orchestrated by proliferating and/or stem-like cells. Whole-mount fluorescent in situ hybridization (FISH) using a stem cell marker allows for the detection of stem-like cells, while pulse labeling with 5-ethynyl-2&#39;-deoxyuridine (EdU), an S phase marker, enables the identification of proliferating cells. Combining both FISH and EdU labeling, we can detect actively proliferating stem-like cells on fixed animals, and this technique can be broadly applied to other animals, including non-model jellyfish species.

Cladonema tentacles have been used as a model to study the cellular processes of morphogenesis and regeneration15,16,17. The tentacle structure is composed of an epithelial tube where stem-like cells, or i-cells, are located in the proximal region, called the tentacle bulb, and new branches are sequentially added to the rear of the distal region of the bulb along the adaxial side (Figure 3A...

Watch this Scientific Journal Video about Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum at JoVE.com

Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

Here, we describe a protocol for visualizing stem-like proliferating cells in the jellyfish Cladonema. Whole-mount fluorescent in situ hybridization with a stem cell marker allows for the detection of stem-like cells, and 5-ethynyl-2&#39;-deoxyuridine labeling enables the identification of proliferating cells. Together, actively proliferating stem-like cells can be detected.&#160;

Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

Cnidarians, including sea anemones, corals, and jellyfish, exhibit diverse morphology and lifestyles that are manifested in sessile polyps and ...

fluorescent-situ-hybridization-5-ethynyl-2-deoxyuridine-labeling-for

Universidad San Sebastian

Research

JoVE Journal

Developmental Biology

3.0K Views.  Tohoku University. Here, we describe a protocol for visualizing stem-like proliferating cells in the jellyfish Cladonema. Whole-mount fluorescent in situ hybridization with a stem cell marker allows for the detection of stem-like cells, and 5-ethynyl-2'-deoxyuridine labeling enables the identification of proliferating cells. Together, actively proliferating stem-like cells can be detected. 

Video: Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

Organogenesis is the study of how organs are specified and then acquire their specific shape and functions during development. The Xenopuslaevis embryo is very useful for studying organogenesis because their large size makes them very suitable for identifying organs at the earliest steps in organogenesis. At this time, the primary method used for identifying a specific organ or primordium is whole mount in situ hybridization with labeled antisense RNA probes specific to a gene that is expressed in the organ of interest. In addition, it is relatively easy to manipulate genes or signaling pathways in Xenopus and in situ hybridization allows one to then assay for changes in the presence or morphology of a target organ. Whole mount in situ hybridization is a multi-day protocol with many steps involved. Here we provide a simplified protocol with reduced numbers of steps and reagents used that works well for routine assays. In situ hybridization robots have greatly facilitated the process and we detail how and when we utilize that technology in the process. Once an in situ hybridization is complete, capturing the best image of the result can be frustrating. We provide advice on how to optimize imaging of in situ hybridization results. Although the protocol describes assessing organogenesis in Xenopus laevis, the same basic protocol can almost certainly be adapted to Xenopus tropicalis and other model systems.

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

The Xenopus laevis embryo continues to be exceptionally useful in the study of early development due to its large size and ease of manipulation. A simplified protocol for whole mount in situ hybridization protocol is provided that can be used in the identification of specific organs in this model system.

Organogenesis is the study of how organs are specified and then acquire their specific shape and functions during development.  The Xenopuslaevis embryo ...

Application of the DNA-Specific Stain Methyl Green in the Fluorescent Labeling of Embryos

Methyl green has long been known as a histological stain with a specific affinity for DNA, although its fluorescent properties have remained unexplored until recently. In this article, we illustrate the method for preparing a methyl green aqueous stock solution, that when diluted can be used as a very convenient fluorescent nuclear label for fixed cells and tissues. Easy procedures to label whole zebrafish and chick embryos are detailed, and examples of images obtained shown. Methyl green is maximally excited by red light, at 633 nm, and emits with a relatively sharp spectrum that peaks at 677 nm. It is very inexpensive, non-toxic, highly stable in solution and very resistant to photobleaching when bound to DNA. Its red emission allows for unaltered high resolution scanning confocal imaging of nuclei in thick specimens. Finally, this methyl green staining protocol is compatible with other cell staining procedures, such as antibody labeling, or actin filaments labeling with fluorophore-conjugated phalloidin.

A method for fluorescent staining of fixed biological material with the specific DNA label methyl green is described. Methyl green is used in a diluted aqueous solution and is very resistant to photobleaching. Its far-red emission allows for deep specimen imaging, making it particularly adequate for whole embryos.

Methyl green has long been known as a histological stain with a specific affinity for DNA, although its fluorescent properties have remained unexplored ...

Multi-target Chromogenic Whole-mount In Situ Hybridization for Comparing Gene Expression Domains in Drosophila Embryos

To analyze gene regulatory networks active during embryonic development and organogenesis it is essential to precisely define how the different genes are expressed in spatial relation to each other in situ. Multi-target chromogenic whole-mount in situ hybridization (MC-WISH) greatly facilitates the instant comparison of gene expression patterns, as it allows distinctive visualization of different mRNA species in contrasting colors in the same sample specimen. This provides the possibility to relate gene expression domains topographically to each other with high accuracy and to define unique and overlapping expression sites. In the presented protocol, we describe a MC-WISH procedure for comparing mRNA expression patterns of different genes in Drosophila embryos. Up to three RNA probes, each specific for another gene and labeled by a different hapten, are simultaneously hybridized to the embryo samples and subsequently detected by alkaline phosphatase-based colorimetric immunohistochemistry. The described procedure is detailed here for Drosophila, but works equally well with zebrafish embryos.

Multi-target Chromogenic Whole-mount In Situ Hybridization for Comparing Gene Expression Domains in Drosophila Embryos

We describe a multi-target chromogenic whole-mount in situ hybridization (MC-WISH) procedure in intact Drosophila embryos allowing simultaneous and specific detection of three different mRNA distribution patterns by contrasting color precipitates.

To analyze gene regulatory networks active during embryonic development and organogenesis it is essential to precisely define how the different genes are ...

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the proteins involved in these pathways are evolutionarily conserved between mammals and other eukaryotes, such as the fruit fly Drosophila melanogaster, suggesting that similar organizing principles exist during the development of these organisms. Importantly, Drosophila has been used extensively to identify cellular and molecular mechanisms regulating processes that are required in mammals including neurogenesis, differentiation, axonal guidance, and synaptogenesis. Flies have also been used successfully to model a variety of human neurodevelopmental diseases. Here we describe a protocol for the step-by-step microdissection, fixation, and immunofluorescent localization of proteins within the adult Drosophila brain. This protocol focuses on two example neuronal populations, mushroom body neurons and retinal photoreceptors, and includes optional steps to trace individual mushroom body neurons using Mosaic Analysis with a Repressible Cell Marker (MARCM) technique. Example data from both wild-type and mutant brains are shown along with a brief description of a scoring criteria for axonal guidance defects. While this protocol highlights two well-established antibodies for investigating the morphology of mushroom body and photoreceptor neurons, other Drosophila brain regions and the localization of proteins within other brain regions can also be investigated using this protocol.

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

This protocol describes the dissection and immunostaining of adult Drosophila melanogaster brain tissues. Specifically, this protocol highlights the use of Drosophila mushroom body and photoreceptor neurons as example neuronal subsets that can be accurately used to uncover general principles underlying many aspects of neuronal development.

Nervous system development involves a sequential series of events that are coordinated by several signaling pathways and regulatory networks. Many of the ...

Visualizing Multiciliated Cells in the Zebrafish Through a Combined Protocol of Whole Mount Fluorescent In Situ Hybridization and Immunofluorescence

In recent years, the zebrafish embryo has emerged as a popular model to study developmental biology due to traits such as ex utero embryo development and optical transparency. In particular, the zebrafish embryo has become an important organism to study vertebrate kidney organogenesis as well as multiciliated cell (MCC) development. To visualize MCCs in the embryonic zebrafish kidney, we have developed a combined protocol of whole-mount fluorescent in situ hybridization (FISH) and whole mount immunofluorescence (IF) that enables high resolution imaging. This manuscript describes our technique for co-localizing RNA transcripts and protein as a tool to better understand the regulation of developmental programs through the expression of various lineage factors.

Visualizing Multiciliated Cells in the Zebrafish Through a Combined Protocol of Whole Mount Fluorescent In Situ Hybridization and Immunofluorescence

Cilia development is vital to proper organogenesis. This protocol describes an optimized method to label and visualize ciliated cells of the zebrafish.

In recent years, the zebrafish embryo has emerged as a popular model to study developmental biology due to traits such as ex utero embryo development and ...

Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in C. elegans

Studying the cell biological processes during converting the identities of specific cell types provides important insights into mechanism that maintain and protect cellular identities. The conversion of germ cells into specific neurons in the nematode Caenorhabditis elegans (C. elegans) is a powerful tool for performing genetic screens in order to dissect regulatory pathways that safeguard established cell identities. Reprogramming of germ cells to a specific type of neurons termed ASE requires transgenic animals that allow broad over-expression of the Zn-finger transcription factor (TF) CHE-1. Endogenous CHE-1 is expressed exclusively in two head neurons and is required to specify the glutamatergic ASE neurons fate, which can easily be visualized by the gcy-5prom::gfp reporter. A trans gene containing the heat-shock promoter-driven che-1 gene expression construct allows broad mis-expression of CHE-1 in the entire animal upon heat-shock treatment. The combination of RNAi against the chromatin-regulating factor LIN-53 and heat-shock-induced che-1 over-expression leads to reprogramming of germ cell into ASE neuron-like cells. We describe here the specific RNAi procedure and appropriate conditions for heat-shock treatment of transgenic animals in order to successfully induce germ cell to neuron conversion.

Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in C. elegans

This protocol describes how to study cellular processes during cell fate conversion in Caenorhabditis elegans in vivo. Using transgenic animals, allowing heat-shock promoter-driven overexpression of the neuron fate-inducing transcription factor CHE-1 and RNAi-mediated depletion of the chromatin-regulating factor LIN-53 germ cell to neuron reprogramming can be observed in vivo.

Studying the cell biological processes during converting the identities of specific cell types provides important insights into mechanism that maintain ...

Single-cell Photoconversion in Living Intact Zebrafish

Animal and plant tissue is composed of distinct populations of cells. These cells interact over time to build and maintain the tissue and can cause disease when disrupted. Scientists have developed clever techniques to investigate characteristics and natural dynamics of these cells within intact tissue by expressing fluorescent proteins in subsets of cells. However, at times, experiments require more selected visualization of cells within the tissue, sometimes at the single-cell or population-of-cells manner. To achieve this and visualize single cells within a population of cells, scientists have utilized single-cell photoconversion of fluorescent proteins. To demonstrate this technique, we show here how to direct UV light to an Eos-expressing cell of interest in an intact, living zebrafish. We then image those photoconverted Eos+ cells 24 h later to determine how they changed in the tissue. We describe two techniques: single cell photoconversion and photoconversions of populations of cell. These techniques can be used to visualize cell-cell interactions, cell-fate and differentiation, and cell migrations, making it a technique that is applicable in numerous biological questions.

Here, we present a protocol to show how cell photoconversion is achieved through UV exposure to specific areas expressing the fluorescent protein, Eos, in living animals.

Animal and plant tissue is composed of distinct populations of cells. These cells interact over time to build and maintain the tissue and can cause ...

Visualizing the Node and Notochordal Plate In Gastrulating Mouse Embryos Using Scanning Electron Microscopy and Whole Mount Immunofluorescence

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is the formation of the transient organizers, the node and notochordal plate, from cells that have passed through the primitive streak. The proper formation of these signaling centers is essential for the development of the body plan and techniques to visualize them are of high interest to mouse developmental biologists. The node and notochordal plate lie on the ventral surface of gastrulating mouse embryos around embryonic day (E) 7.5 of development. The node is a cup-shaped structure whose cells possess a single slender cilium each. The proper subcellular localization and rotation of the cilia in the node pit determines left-right asymmetry. The notochordal plate cells also possess single cilia albeit shorter than those of the node cells. The notochordal plate forms the notochord which acts as an important signaling organizer for somitogenesis and neural patterning. Because the cells of the node and notochordal plate are transiently present on the surface and possess cilia, they can be visualized using scanning electron microscopy (SEM). Among other techniques used to visualize these structures at the cellular level is whole mount immunofluorescence (WMIF) using the antibodies against the proteins that are highly expressed in the node and notochordal plate. In this report, we describe our optimized protocols to perform SEM and WMIF of the node and notochordal plate in developing mouse embryos to help in the assessment of tissue shape and cellular organization in wild-type and gastrulation mutant embryos.

The node and notochordal plate are transient signaling organizers in developing mouse embryos that can be visualized using several techniques. Here, we describe in detail how to perform two of the techniques to study their structure and morphogenesis: 1) scanning electron microscopy (SEM); and 2) whole mount immunofluorescence (WMIF).

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is ...

Wholemount In Situ Hybridization for Astyanax Embryos

In recent years, a draft genome for the blind Mexican cavefish (Astyanax mexicanus) has been released, revealing the sequence identities for thousands of genes. Prior research into this emerging model system capitalized on comprehensive genome-wide investigations that have identified numerous quantitative trait loci (QTL) associated with various cave-associated phenotypes. However, the ability to connect genes of interest to the heritable basis for phenotypic change remains a significant challenge. One technique that can facilitate deeper understanding of the role of development in troglomorphic evolution is whole-mount in situ hybridization. This technique can be implemented to directly compare gene expression between cave- and surface-dwelling forms, nominate candidate genes underlying established QTL, identify genes of interest from next-generation sequencing studies, or develop other discovery-based approaches. In this report, we present a simple protocol, supported by a flexible checklist, that can be widely adapted for use well beyond the presented study system. It is hoped that this protocol can serve as a broad resource for the Astyanax community and beyond.

Wholemount In Situ Hybridization for Astyanax Embryos

This protocol enables visualization of gene expression in embryonic Astyanax cavefish. This approach has been developed with the goal of maximizing gene expression signal, while minimizing non-specific background staining.

In recent years, a draft genome for the blind Mexican cavefish (Astyanax mexicanus) has been released, revealing the sequence identities for thousands of ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give rise to multiple cell types, including the myotome (MYO), sclerotome (SCL), dermatome (D), and syndetome (SYN), which in turn develop into skeletal muscle, axial skeleton, dorsal dermis, and axial tendon/ligament, respectively. Therefore, the generation of SMs and their derivatives from human induced pluripotent stem cells (iPSCs) is critical to obtain pluripotent stem cells (PSCs) for application in regenerative medicine and for disease research in the field of orthopedic surgery. Although the induction protocols for MYO and SCL from PSCs have been previously reported by several researchers, no study has yet demonstrated the induction of SYN and D from iPSCs. Therefore, efficient induction of fully competent SMs remains a major challenge. Here, we recapitulate human SM patterning with human iPSCs in vitro by mimicking the signaling environment during chick/mouse SM development, and report on methods of systematic induction of SM derivatives (MYO, SCL, D, and SYN) from human iPSCs under chemically defined conditions through the presomitic mesoderm (PSM) and SM states. Knowledge regarding chick/mouse&#160;SM development was successfully applied to the induction of SMs with human iPSCs. This method could be a novel tool for studying human somitogenesis and patterning without the use of embryos and for cell-based therapy and disease modeling.

We present here a protocol for the differentiation of human induced pluripotent stem cells into each somite derivative (myotome, sclerotome, dermatome, and syndetome) in chemically defined conditions, which has applications in future disease modeling and cell-based therapies in orthopedic surgery.

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...

Fluorescent In Situ Hybridization and 5-Ethynyl-2'-Deoxyuridine Labeling for Stem-Like Cells in the Hydrozoan Jellyfish Cladonema pacificum

Summary

Explore More Videos

Chapters in this video

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

Application of the DNA-Specific Stain Methyl Green in the Fluorescent Labeling of Embryos

Multi-target Chromogenic Whole-mount In Situ Hybridization for Comparing Gene Expression Domains in Drosophila Embryos

Dissection and Immunofluorescent Staining of Mushroom Body and Photoreceptor Neurons in Adult Drosophila melanogaster Brains

Visualizing Multiciliated Cells in the Zebrafish Through a Combined Protocol of Whole Mount Fluorescent In Situ Hybridization and Immunofluorescence

Application of RNAi and Heat-shock-induced Transcription Factor Expression to Reprogram Germ Cells to Neurons in C. elegans

Single-cell Photoconversion in Living Intact Zebrafish

Visualizing the Node and Notochordal Plate In Gastrulating Mouse Embryos Using Scanning Electron Microscopy and Whole Mount Immunofluorescence

Wholemount In Situ Hybridization for Astyanax Embryos

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells