Reaktifler kurma ve jeller dökme ve UCLA Erin Sanders ilham, rehberlik ve destek için ve yazının redaksiyon için UCLA Kris Reddi özel teşekkürler. Ben de GAL3 gen yükseltmek için maya genomik DNA ve primer temini için teşekkürler Giancarlo Costaguta ve Gregory S. Payne istiyorum. 4 - Ben de laboratuar ekipmanları ve rakamlar 2 yapmak için kullanılan reaktiflerin resmini çekmek için Bhairav ​​Şah teşekkür etmek istiyorum. Bu proje için finansman HHMI (HHMI Hibe No 52.006.944) tarafından sağlandı.

<ol><li>Albert, J., Fenyo, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Simple+sensitive%2C+and+specific+detection+of+human+immunodeficiency+virus+type+1+in+clinical+specimens+by+polymerase+chain+reaction+with+nested+primers%5BTitle%5D)+AND+%22J.+Clin.+Microbiol%22%5BJournal%5D)">Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers.</a> J. Clin. Microbiol. 28, 1560-1564 (1990).</li>
<li>Baskaran, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Uniform+amplification+of+a+mixture+of+deoxyribonucleic+acids+with+varying+GC+content%5BTitle%5D)+AND+%22Genome+Res%22%5BJournal%5D)">Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content.</a> Genome Res. 6, 633-638 (1996).</li>
<li>Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((PCR+buffer+optimization+with+uniform+temperature+regimen+to+facilitate+automation%5BTitle%5D)+AND+%22PCR+Methods+Appl%22%5BJournal%5D)">PCR buffer optimization with uniform temperature regimen to facilitate automation.</a> PCR Methods Appl. 2, 234-240 (1993).</li>
<li>Borer, P. N., Dengler, B., Tinoco, I. Jr, Uhlenbeck, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Stability+of+ribonucleic+acid+double-stranded+helices%5BTitle%5D)+AND+%22J.+Mol.+Biol%22%5BJournal%5D)">Stability of ribonucleic acid double-stranded helices.</a> J. Mol. Biol. 86, 843-853 (1974).</li>
<li>Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Predicting+DNA+duplex+stability+from+the+base+sequence%5BTitle%5D)+AND+%22Proc.+Natl.+Acad.+Sci.+U.S.A%22%5BJournal%5D)">Predicting DNA duplex stability from the base sequence.</a> Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).</li>
<li>Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Prevention+of+pre-PCR+mis-priming+and+primer+dimerization+improves+low-copy-number+amplifications%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications.</a> Nucleic Acids Res. 20, 1717-1723 (1992).</li>
<li>Coleman, W. B., Tsongalis, G. J. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aColeman%2C+WB+%22Diagnostics+for+the+clinical+laboration%22">Diagnostics for the clinical laboration</a>. , Humana Press. (2005).</li>
<li>D'Aquila, R. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Maximizing+sensitivity+and+specificity+of+PCR+by+pre-amplification+heating%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">Maximizing sensitivity and specificity of PCR by pre-amplification heating.</a> Nucleic Acids Res. 19, 3749(1991).</li>
<li>Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((General+concepts+for+PCR+primer+design%5BTitle%5D)+AND+%22PCR+Methods+Appl%22%5BJournal%5D)">General concepts for PCR primer design.</a> PCR Methods Appl. 3, S30-S37 (1993).</li>
<li>Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((%27Touchdown%27+PCR+to+circumvent+spurious+priming+during+gene+amplification%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">'Touchdown' PCR to circumvent spurious priming during gene amplification.</a> Nucleic Acids Res. 19, 4008(1991).</li>
<li>Erlich, H. A., Gelfand, D., Sninsky, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Recent+advances+in+the+polymerase+chain+reaction%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Recent advances in the polymerase chain reaction.</a> Science. 252, 1643-1651 (1991).</li>
<li>Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((PCR-amplification+of+GC-rich+regions%3A+%27slowdown+PCR%5BTitle%5D)+AND+%22Nat.+Protoc%22%5BJournal%5D)">PCR-amplification of GC-rich regions: 'slowdown PCR.</a> Nat. Protoc. 3, 1312-1317 (2008).</li>
<li>Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Specific+amplification+with+PCR+of+a+refractory+segment+of+genomic+DNA%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">Specific amplification with PCR of a refractory segment of genomic DNA.</a> Nucleic Acids Res. 16, 11844(1988).</li>
<li>Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Betaine+improves+the+PCR+amplification+of+GC-rich+DNA+sequences%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">Betaine improves the PCR amplification of GC-rich DNA sequences.</a> Nucleic Acids Res. 25, 3957-3958 (1997).</li>
<li>Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aInnis%2C+MA+%22PCR+Protocols%3A+A+guide+to+methods+and+applications%22">PCR Protocols: A guide to methods and applications</a>. , Academic Press, Inc. San Diego. (1990).</li>
<li>King, N. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aKing%2C+N+%22Methods+in+Molecular+Biology%22">Methods in Molecular Biology</a>. 630, Humana Press. (2010).</li>
<li>Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Studies+on+polynucleotides.+XCVI.+Repair+replications+of+short+synthetic+DNA%27s+as+catalyzed+by+DNA+polymerases%5BTitle%5D)+AND+%22J.+Mol.+Biol%22%5BJournal%5D)">Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases.</a> J. Mol. Biol. 56, 341-361 (1971).</li>
<li>Korbie, D. J., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Touchdown+PCR+for+increased+specificity+and+sensitivity+in+PCR+amplification%5BTitle%5D)+AND+%22Nat.+Protoc%22%5BJournal%5D)">Touchdown PCR for increased specificity and sensitivity in PCR amplification.</a> Nat. Protoc. 3, 1452-1456 (2008).</li>
<li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Enzymatic+amplification+of+DNA+by+PCR%3A+standard+procedures+and+optimization%5BTitle%5D)+AND+%22Curr.+Protoc.+Toxicol%22%5BJournal%5D)">Enzymatic amplification of DNA by PCR: standard procedures and optimization.</a> Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).</li>
<li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+polymerase+chain+reaction%5BTitle%5D)+AND+%22Curr.+Protoc.+Protein+Sci%22%5BJournal%5D)">The polymerase chain reaction.</a> Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J(2002).</li>
<li>Kreader, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Relief+of+amplification+inhibition+in+PCR+with+bovine+serum+albumin+or+T4+gene+32+protein%5BTitle%5D)+AND+%22Appl.+Environ.+Microbiol%22%5BJournal%5D)">Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein.</a> Appl. Environ. Microbiol. 62, 1102-1106 (1996).</li>
<li>Kwok, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Identification+of+human+immunodeficiency+virus+sequences+by+using+in+vitro+enzymatic+amplification+and+oligomer+cleavage+detection%5BTitle%5D)+AND+%22J.+Virol%22%5BJournal%5D)">Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection.</a> J. Virol. 61, 1690-1694 (1987).</li>
<li>McConlogue, L., Brow, M. A., Innis, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Structure-independent+DNA+amplification+by+PCR+using+7-deaza-2%27-deoxyguanosine%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine.</a> Nucleic Acids Res. 16, 9869(1988).</li>
<li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+unusual+origin+of+the+polymerase+chain+reaction%5BTitle%5D)+AND+%22Sci.+Am%22%5BJournal%5D)">The unusual origin of the polymerase chain reaction.</a> Sci. Am. 262, 56-65 (1990).</li>
<li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Target+amplification+for+DNA+analysis+by+the+polymerase+chain+reaction%5BTitle%5D)+AND+%22Ann.+Biol.+Clin.+%28Paris%29%22%5BJournal%5D)">Target amplification for DNA analysis by the polymerase chain reaction.</a> Ann. Biol. Clin. (Paris). 48, 579-582 (1990).</li>
<li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+polymerase+chain+reaction+in+an+anemic+mode%3A+how+to+avoid+cold+oligodeoxyribonuclear+fusion%29%5BTitle%5D)+AND+%22PCR+Methods+Appl%22%5BJournal%5D)">The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion).</a> PCR Methods Appl. 1, 1-4 (1991).</li>
<li>Mullis, K. B., Faloona, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Specific+synthesis+of+DNA+in+vitro+via+a+polymerase-catalyzed+chain+reaction%5BTitle%5D)+AND+%22Methods+Enzymol%22%5BJournal%5D)">Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction.</a> Methods Enzymol. 155, 335-350 (1987).</li>
<li>Paabo, S., Gifford, J. A., Wilson, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mitochondrial+DNA+sequences+from+a+7000-year+old+brain%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">Mitochondrial DNA sequences from a 7000-year old brain.</a> Nucleic Acids Res. 16, 9775-9787 (1988).</li>
<li>Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Betaine+can+eliminate+the+base+pair+composition+dependence+of+DNA+melting%5BTitle%5D)+AND+%22Biochemistry%22%5BJournal%5D)">Betaine can eliminate the base pair composition dependence of DNA melting.</a> Biochemistry. 32, 137-144 (1993).</li>
<li>Roux, K. H., Hecker, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((One-step+optimization+using+touchdown+and+stepdown+PCR%5BTitle%5D)+AND+%22Methods+Mol.+Biol%22%5BJournal%5D)">One-step optimization using touchdown and stepdown PCR.</a> Methods Mol. Biol. 67, 39-45 (1997).</li>
<li>Rychlik, W., Spencer, W. J., Rhoads, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Optimization+of+the+annealing+temperature+for+DNA+amplification+in+vitro%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">Optimization of the annealing temperature for DNA amplification in vitro.</a> Nucleic Acids Res. 18, 6409-6412 (1990).</li>
<li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Primer-directed+enzymatic+amplification+of+DNA+with+a+thermostable+DNA+polymerase%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase.</a> Science. 239, 487-491 (1988).</li>
<li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Enzymatic+amplification+of+beta-globin+genomic+sequences+and+restriction+site+analysis+for+diagnosis+of+sickle+cell+anemia%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia.</a> Science. 230, 1350-1354 (1985).</li>
<li>Sambrook, J. A. R., David, W. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aSambrook%2C+JAR+%22Molecular+Cloning+A+Laboratory+Manual%22">Molecular Cloning A Laboratory Manual</a>. 2, 3, Cold Spring Harbor Laboratory Press. (2001).</li>
<li>Sarkar, G., Kapelner, S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Formamide+can+dramatically+improve+the+specificity+of+PCR%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">Formamide can dramatically improve the specificity of PCR.</a> Nucleic Acids Res. 18, 7465(1990).</li>
<li>Smit, V. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((KRAS+codon+12+mutations+occur+very+frequently+in+pancreatic+adenocarcinomas%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas.</a> Nucleic Acids Res. 16, 7773-7782 (1988).</li>
<li>Wilson, I. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Inhibition+and+facilitation+of+nucleic+acid+amplification%5BTitle%5D)+AND+%22Appl.+Environ.+Microbiol%22%5BJournal%5D)">Inhibition and facilitation of nucleic acid amplification.</a> Appl. Environ. Microbiol. 63, 3741-3751 (1997).</li>
<li>Wu, R. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aWu%2C+R+%22Methods+in+Enzymology%22">Methods in Enzymology</a>. 218, Academic Press, Inc. San Diego. (1993).</li>
</ol>

Ben ifşa hiçbir şey yok.

PCR biyolojik bilim cephanelik vazgeçilmez bir araç haline gelmiştir. PCR genomlar ve çeşitliliğin yanı sıra, daha fazla biyokimyasal analiz için sadece klonlama genler ilgili bilgi sağlamak, özel ve doğru bir klinik test sağlayan, biyologlar genomlarını gücü verim ve yeni fonksiyonları ile hibrid genlerin yapmak için izin bilim elbette değiştirdi. PCR uygulaması sadece kendi gücünü kullanır bilim adamı hayal gücü ile sınırlıdır. Orada PCR yeni özel kullanır tanımlayan pek çok kitap ve makaleler, ve daha birçok biyolojik bilim nesil içinde geliştirilecektir. Ancak, ne olursa olsun, beklenen yaklaşımlar, temel çerçeve aynı kalmıştır. PCR, tüm Haşmetli, DNA segment belirli bir miktarda elde etmek için bir in vitro bir uygulamadır. PCR deney tasarlama düşünce ve sabır gerektirir. Şekil 3&#39;te gösterilen sonuçlar büyük CH biri örneklendirmekPCR için bir optimizasyon stratejisini tasarlarken allenges. PCR ile bir parametre olarak değişir, bu, başka bir etkileyebilir. İlk PCR optimal bir Mg 2 2.0 mM + konsantrasyonu ile optimal tavlama sıcaklığında (58 ° C) gerçekleştirilmiştir halinde, örnek olarak, daha sonra Sonuç Şekil 3c &#39;de görüldüğü gibi, bir yayma üretecektir. Smear çözmek için bir girişimde 2.0 mM MgCl2 içeren reaksiyonlar PCR koşulları kurma ve 61 ° C&#39;ye tavlama sıcaklığının ayarlanması içerebilir Bununla birlikte, Şekil 3a de görüldüğü gibi, bu herhangi bir ürünü vermek olmaz. Sonuç olarak, daha ziyade istenmeyen sonuçlar giderme olduğunda, tek bir reaksiyon için bir konsantrasyonda eklenmesi dışında, reaktifler titre tavsiye edilir. Ayrıca, bir PCR deneyi optimize etmek için gerekli olan en yaygın ayarlamalar Mg 2 + konsantrasyonu değiştirmek için ve tavlama düzeltmek için bulunmaktadır. Ancak, bu değişiklikler en aza indirmek veya anormal sonuçlar feshetmek, katk titrasyonu yoksaves ve / veya Tablo 2-6 açıklanan bisiklet koşulu protokolleri değiştirerek sorunu hafifletmek olabilir. Tümü başarısız olursa, astar yeniden tasarlamak ve denemek, yeniden deneyin.

<table border="1"><tbody><tr><td> Reaktif Adı </td><td> Şirket </td><td> Katalog numarası </td><td> Yorumlar </td></tr><tr><td> Taq Polymeras </td><td> Sigma </td><td> D4545-25UN </td><td></td></tr><tr><td> dNTP </td><td> Qiagen </td><td> 201225 </td><td></td></tr><tr><td> 0.2 ml İnce Duvar Tüpler PCR tüpleri </td><td> Bio Rad </td><td> 223-9469 </td><td></td></tr><tr><td> 0.2 ml İnce Duvar Tüp kapakları </td><td> Bio Rad </td><td> 223-9472 </td><td></td></tr><tr><td> TE Tamponu: </td><td></td><td></td><td></td></tr><tr><td> EDTA disodyum tuzu dihidrat </td><td> Sigma </td><td> E5134 </td><td></td></tr><tr><td> Trizma-HCl </td><td> Sigma </td><td> T-3253 </td><td></td></tr><tr><td> Özel Faj Astar </td><td> Invitrogen </td><td colspan="2"> 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG </td></tr><tr><td> Özel Faj Astar </td><td> Invitrogen </td><td colspan="2"> 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT </td></tr><tr><td> Özel Maya Astar </td><td> Entegre DNA Teknolojileri </td><td colspan="2"> SacI-Gal3 (-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG </td></tr><tr><td> Özel Maya Astar </td><td> Entegre DNA Teknolojileri </td><td colspan="2"> Gal3 (1848)-SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG </td></tr><tr><td> Termal Cycler </td><td> Bio Rad </td><td> 170-9703 </td><td> Benim Cycler </td></tr><tr><td> Agaroz </td><td> ISC BioExpress </td><td> E-3120-500 </td><td></td></tr><tr><td> Jel elektroforez </td><td> Hoeffer Bilimsel Aletler </td><td> Model HE33 </td><td></td></tr><tr><td> 1 kb DNA Ladder </td><td> New England Biolabs </td><td> N3232S </td><td></td></tr><tr><td> Bio Rad Power Pack </td><td> Bio Rad </td><td> 164-5050 </td><td> PowerPac Temel </td></tr><tr><td> Gel Doc sistemi </td><td> Fotodyne Incorporated </td><td colspan="2"> FOTO / Analist Araştırmacı FX İstasyonu </td></tr></tbody></table>

polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies

Biyolojik bilimler keşfin altın çağına disiplin mancınık teknolojik gelişmeler olmuştur. Örneğin, mikrobiyoloji alanında bilim adamları ilk kez prokaryotlarda görselleştirmek için izin Anton van Leeuwenhoek en mikroskop, gelişine dönüştürüldü. Polimeraz zincir reaksiyonu (PCR) geliştirilmesi etkisini biyolojinin sayısız alt disiplinleri kapsayan ile moleküler bilimin gidişatını değiştiren bu yeniliklerden biri. Teorik süreci 1971 yılında Keppe ve arkadaşları tarafından ana hatlarıyla ortaya koydu; tam PCR yöntemi Balina Corporation, 1985 yılında ise Kary Mullis tarafından açıklanan ve deneysel olarak uygulanmıştır kadar ancak, başka bir 14 yıl oldu. Bu tekniğin Otomasyon ve arıtma bakteri Thermus aquaticus, dolayısıyla adı Taq DNA polimeraz bir termal dayanıklı DNA polimeraz tanıtımıyla ilerledi. PCR powe olduğunuBaşlangıç ​​malzemesi sadece küçük bir miktarı (yani, DNA şablonu veya hedef dizisi) DNA (yani, bir amplikon) belirli bir bölümü, zengin bir besleme oluşturabilir rful amplifikasyon tekniği. Basit ve genel olarak sorunsuz olsa da, sahte sonuçlar üreten reaksiyon komplike tuzaklar vardır. PCR başarısız olduğunda bunu agaroz jel üzerindeki bantların bir merdiven ya da smear olarak görünür büyüklü küçüklü birçok non-spesifik DNA ürünlere de yol açabilir. Bazen herhangi bir ürün hiç oluştururlar. Mutasyonlar istemeden PCR ürünlerinin heterojen nüfus sonuçlanan amplikonlar başlatıldığında diğer bir olası sorun oluşur. Sabır ve dikkatli bir sorun giderme sıralamak ve sorun (lar) çözmek için istihdam sürece PCR hataları sinir bozucu hale gelebilir. Bu protokol, PCR temel ilkelerini özetlenmektedir en hedef dizilerinin amplifikasyonu ile sonuçlanacaktır bir yöntem sağlar, ve bir reaksiyon optimize etmek için stratejiler sunar. Bu PCR kılavuzu, st takip ederekudents gerekir: <ul><li> Geleneksel PCR deney için reaksiyonlar ve ısıl koşulları ayarlama </li><li> Çeşitli reaksiyon bileşenlerinin fonksiyonu ve PCR deney üzerindeki genel etkisi Anlayın </li><li> Herhangi bir DNA örneğinin bir PCR deney tasarlayın ve optimize </li><li> Başarısız PCR deneyler giderme </li></ul>

Watch this Scientific Journal Video about Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies at JoVE.com

Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

PCR birçok moleküler biyoloji laboratuvarlarında yaygın bir teknik olarak ortaya çıkmıştır. Pek çok geleneksel PCR protokolleri için hızlı bir kılavuzdur burada sağlanan. Her bir reaksiyon benzersiz bir deneyde, bir ürün üretmek için gerekli değişir uygun koşullar olmasıdır. Bir reaksiyonla değişkenlerini anlama büyük ölçüde böylece istenilen sonucu elde etmek şansı artan giderme verimi artıracaktır.

Polimeraz Zincir Reaksiyonu: Temel Protokol Plus, Sorun ve Optimizasyon Stratejileri

In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of ...

polymerase-chain-reaction-basic-protocol-plus-troubleshooting

Research

JoVE Journal

Biology

403.6K Görüntüleme.  University of California, Los Angeles. PCR birçok moleküler biyoloji laboratuvarlarında yaygın bir teknik olarak ortaya çıkmıştır. Pek çok geleneksel PCR protokolleri için hızlı bir kılavuzdur burada sağlanan. Her bir reaksiyon benzersiz bir deneyde, bir ürün üretmek için gerekli değişir uygun koşullar olmasıdır. Bir reaksiyonla değişkenlerini anlama büyük ölçüde böylece istenilen sonucu elde etmek şansı artan giderme verimi artıracaktır.

Video: Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

DNA Polymerase Activity Assay Using Near-infrared Fluorescent Labeled DNA Visualized by Acrylamide Gel Electrophoresis

For any enzyme, robust, quantitative methods are required for characterization of both native and engineered enzymes. For DNA polymerases, DNA synthesis can be characterized using an in vitro DNA synthesis assay followed by polyacrylamide gel electrophoresis. The goal of this assay is to quantify synthesis of both natural DNA and modified DNA (M-DNA). These approaches are particularly useful for resolving oligonucleotides with single nucleotide resolution, enabling observation of individual steps during enzymatic oligonucleotide synthesis. These methods have been applied to the evaluation of an array of biochemical and biophysical properties such as the measurement of steady-state rate constants of individual steps of DNA synthesis, the error rate of DNA synthesis, and DNA binding affinity. By using modified components including, but not limited to, modified nucleoside triphosphates (NTP), M-DNA, and/or mutant DNA polymerases, the relative utility of substrate-DNA polymerase pairs can be effectively evaluated. Here, we detail the assay itself, including the changes that must be made to accommodate nontraditional primer DNA labeling strategies such as near-infrared fluorescently labeled DNA. Additionally, we have detailed crucial technical steps for acrylamide gel pouring and running, which can often be technically challenging.

This protocol describes the characterization of DNA polymerase synthesis of modified DNA through observation of changes to near-infrared fluorescently labeled DNA using gel electrophoresis and gel imaging. Acrylamide gels are used for high resolution imaging of the separation of short nucleic acids, which migrate at different rates depending on size.

DNA polimeraz etkinliği tahlil Akrilamid Jel Elektroforez tarafından görüntülenmiştir yakın kızılötesi floresan etiketli DNA'yı kullanarak

For any enzyme, robust, quantitative methods are required for characterization of both native and engineered enzymes. For DNA polymerases, DNA synthesis ...

Biyokimya

Adapting 3' Rapid Amplification of CDNA Ends to Map Transcripts in Cancer

Maturation of eukaryotic mRNAs involves 3&#39; end formation, which involves the addition of a poly(A) tail. In order to map the 3&#39; end of a gene, the traditional method of choice is 3&#39; rapid amplification of cDNA ends (3&#39; RACE). Protocols for 3&#39; RACE require the careful design and selection of nested primers within the 3&#39; untranslated region (3&#39; UTR) of the target gene of interest. However, with a few modifications the protocol can be used to include the entire 3&#39; UTR and sequences within the open reading frame (ORF), providing a more comprehensive picture of the relationship between the ORF and the 3&#39; UTR. This is in addition to identification of the polyadenylation signal (PAS), as well as the cleavage and polyadenylation site provided by conventional 3&#39; RACE. Expanded 3&#39; RACE can detect unusual 3&#39; UTRs, including gene fusions within the 3&#39; UTR, and the sequence information can be used to predict potential miRNA binding sites as well as AU rich destabilizing elements that may affect the stability of the transcript.

The two different 3&#39; rapid amplification of cDNA ends (3&#39; RACE) protocols described here make use of two different DNA polymerases to map sequences that include a segment of the open reading frame (ORF), the stop codon, and the entire 3&#39; UTR of a transcript using RNA obtained from different cancer cell lines.

3' adapte CDNA hızlı amplifikasyon transkript kanser eşlemek için sona erer

Maturation of eukaryotic mRNAs involves 3&#39; end formation, which involves the addition of a poly(A) tail. In order to map the 3&#39; end of a gene, the ...

Genetik

Use of Alu Element Containing Minigenes to Analyze Circular RNAs

In addition to linear mRNAs, many eukaryotic genes generate circular RNAs. Most circular RNAs are generated by joining a 5&#39; splice site with an upstream 3&#39; splice site within a pre-mRNA, a process called back-splicing. This circularization is likely aided by secondary structures in the pre-mRNA that bring the splice sites into close proximity. In human genes, Alu elements are thought to promote these secondary RNA structures, as Alu elements are abundant and exhibit base complementarities with each other when present in opposite directions in the pre-mRNA. Here, we describe the generation and analysis of large, Alu element containing reporter genes that form circular RNAs. Through optimization of cloning protocols, reporter genes with up to 20 kb insert length can be generated. Their analysis in co-transfection experiments allows the identification of regulatory factors. Thus, this method can identify RNA sequences and cellular components involved in circular RNA formation.

Use of Alu Element Containing Minigenes to Analyze Circular RNAs

We clone and analyze reporter genes generating circular RNAs. These reporter genes are larger than constructs to analyze linear splicing and contain Alu elements. To investigate the circular RNAs, the constructs are transfected into cells and resulting RNA is analyzed using RT-PCR after removal of linear RNA.

Dairesel RNA'ları Analiz Etmek Için Minigen İçeren Alu Elementin Kullanımı

In addition to linear mRNAs, many eukaryotic genes generate circular RNAs. Most circular RNAs are generated by joining a 5&#39; splice site with an ...

Primer Extension Capture: Targeted Sequence Retrieval from Heavily Degraded DNA Sources

We present a method of targeted DNA sequence retrieval from DNA sources which are heavily degraded and contaminated with microbial DNA, as is typical of ancient bones. The method greatly reduces sample destruction and sequencing demands relative to direct PCR or shotgun sequencing approaches. We used this method to reconstruct the complete mitochondrial DNA (mtDNA) genomes of five Neandertals from across their geographic range. The mtDNA genetic diversity of the late Neandertals was approximately three times lower than that of contemporary modern humans. Together with analyses of mtDNA protein evolution, these data suggest that the long-term effective population size of Neandertals was smaller than that of modern humans and extant great apes.

We present a method of targeted ancient DNA sequence retrieval, which we used to reconstruct the complete mitochondrial genomes of five Neandertal individuals. Comparison of these sequences with present day humans suggests that Neandertals had a long term low effective population size.

Primer Uzatma Yakalama: Ağır Bozulmuş DNA Kaynakları Hedefli Sıra Alma

We present a method of targeted DNA sequence retrieval from DNA sources which are heavily degraded and contaminated with microbial DNA, as is typical of ...

Biyoloji

Rapid, Enzymatic Methods for Amplification of Minimal, Linear Templates for Protein Prototyping using Cell-Free Systems

This protocol describes the design of a minimal DNA template and the steps for enzymatic amplification, enabling rapid prototyping of assayable proteins in less than 24 h using cell-free expression. After receiving DNA from a vendor, the gene fragment is PCR-amplified, cut, circularized, and cryo-banked. A small amount of the banked DNA is then diluted and amplified significantly (up to 106x) using isothermal rolling circle amplification (RCA). RCA can yield microgram quantities of the minimal expression template from picogram levels of starting material (mg levels if all starting synthetic fragment is used). In this work, a starting amount of 20 pg resulted in 4 &#181;g of the final product. The resulting RCA product (concatemer of the minimal template) can be added directly to a cell-free reaction with no purification steps. Due to this method being entirely PCR-based, it may enable future high-throughput screening efforts when coupled with automated liquid handling systems.

The study describes a protocol for creating large (&#181;g-mg) quantities of DNA for protein screening campaigns from synthetic gene fragments without cloning or using living cells. The minimal template is enzymatically digested and circularized and then amplified using isothermal rolling circle amplification. Cell-free expression reactions could be performed with the unpurified product.

Hücresiz Sistemler Kullanarak Protein Prototipleme için Minimal, Doğrusal Şablonların Amplifikasyonu için Hızlı, Enzymatik Yöntemler

This protocol describes the design of a minimal DNA template and the steps for enzymatic amplification, enabling rapid prototyping of assayable proteins ...

Biyomühendislik

Rapid Characterization of Genetic Parts with Cell-Free Systems

Characterizing and cataloging genetic parts are critical to the design of useful genetic circuits. Having well-characterized parts allows for the fine-tuning of genetic circuits, such that their function results in predictable outcomes. With the growth of synthetic biology as a field, there has been an explosion of genetic circuits that have been implemented in microbes to execute functions pertaining to sensing, metabolic alteration, and cellular computing. Here, we show a rapid and cost-effective method for characterizing genetic parts. Our method utilizes cell-free lysate, prepared in-house as a medium to evaluate parts via the expression of a reporter protein. Template DNA is prepared by PCR amplification using inexpensive primers to add variant parts to the reporter gene, and the template is added to the reaction as linear DNA without cloning. Parts that can be added in this way include promoters, operators, ribosome binding sites, insulators, and terminators. This approach, combined with the incorporation of an acoustic liquid handler and 384-well plates, allows the user to carry out high-throughput evaluations of genetic parts in a single day. By comparison, cell-based screening approaches require time-consuming cloning and have longer testing times due to overnight culture and culture density normalization steps. Further, working in cell-free lysate allows the user to exact tighter control over the expression conditions through the addition of exogenous components and DNA at precise concentrations. Results obtained from cell-free screening can be used directly in applications of cell-free systems or, in some cases, as a way to predict function in whole cells.

Well-characterized genetic parts are necessary for the design of novel genetic circuits. Here we describe a cost-effective, high-throughput method for rapidly characterizing genetic parts. Our method reduces cost and time by combining cell-free lysates, linear DNA to avoid cloning, and acoustic liquid handling to increase throughput and reduce reaction volumes.

Genetik Parçaların Hücresiz Sistemlerle Hızlı Karakterizasyonu

Characterizing and cataloging genetic parts are critical to the design of useful genetic circuits. Having well-characterized parts allows for the ...

Tuning Degradation to Achieve Specific and Efficient Protein Depletion

The plant auxin binding receptor, TIR1, recognizes proteins containing a specific auxin-inducible degron (AID) motif in the presence of auxin, targeting them for degradation. This system is exploited in many non-plant eukaryotes, such that a target protein, tagged with the AID motif, is degraded upon auxin addition. The level of TIR1 expression is critical; excessive expression leads to degradation of the AID-tagged protein even in the absence of auxin, whereas low expression leads to slow depletion. A &#946;-estradiol-inducible AID system was created, with expression of TIR1 under the control of a &#946;-estradiol inducible promoter. The level of TIR1 is tunable by changing the time of incubation with &#946;-estradiol before auxin addition. This protocol describes how to rapidly deplete a target protein using the AID system. The appropriate &#946;-estradiol incubation time depends on the abundance of the target protein. Therefore, efficient depletion depends on optimal timing that also minimizes auxin-independent depletion.

Here, we present a protocol to effectively and specifically deplete a protein of interest in the yeast Saccharomyces cerevisiae using the &#946;-est AID system.

Belirli ve verimli protein tükenmesi elde etmek için bozulma ayarlama

The plant auxin binding receptor, TIR1, recognizes proteins containing a specific auxin-inducible degron (AID) motif in the presence of auxin, targeting ...

İmmünoloji ve Enfeksiyon

PCR: The Polymerase Chain Reaction

The polymerase chain reaction, or PCR, is a technique used to amplify DNA through thermocycling &#8211; cyles of temperature changes at fixed time intervals. Using a thermostable DNA polymerase, PCR can create numerous copies of DNA from DNA building blocks called dNTPs. There are&#160;three steps in PCR: denaturation, annealing, and elongation. Denaturation is the first step in the cycle and causes the DNA to melt by disrupting hydrogen bonds between the bases resulting in single-stranded DNA. Annealing lowers the temperature enough to allow the binding of oligonucleotide primers to the DNA template. During the elongation step DNA polymerase will synthesize new double-stranded DNA.
This video provides an introduction to the PCR procedure. The basic principles of PCR are described as well as a step-by-step procedure for setting up a generalized PCR reaction. The video shows the necessary components for a PCR reaction, includes instruction for primer design, and provides helpful hints for ensuring successful PCR reactions.

PCR: Principle, Instrumentation, and Applications

The polymerase chain reaction, or PCR, is a technique used to amplify DNA through thermocycling &#8211; cyles of temperature changes at fixed time ...

Education

JoVE Science Education

Temel Biyoloji

Hücresel ve Moleküler Biyolojide Temel Yöntemler

Detecting Environmental Microorganisms with the Polymerase Chain Reaction and Gel Electrophoresis

Source: Laboratories of Dr. Ian Pepper and Dr. Charles Gerba - Arizona University 
Demonstrating Author: Bradley Schmitz
Polymerase chain reaction (PCR) is a technique used to detect microorganisms that are present in soil, water, and atmospheric environments. By amplifying specific sections of DNA, PCR can facilitate the detection and identification of target microorganisms down to the species, strain, and serovar/pathovar level. The technique can also be utilized to characterize entire communities of microorganisms in samples.
The culturing of microorganisms in the laboratory using specialized growth media is a long-established technique and remains in use for the detection of microorganisms in environmental samples. Many microbes in the natural environment, while alive, maintain low levels of metabolic activity and/or doubling times and are thus referred to as viable but non-culturable (VBNC) organisms. The use of culture-based techniques alone cannot detect these microbes and, therefore, does not provide a thorough assessment of microbial populations in samples. The use of PCR allows for the detection of culturable microbes, VBNC organisms, and those that are no longer alive or active, as the amplification of genetic sequences does not generally require the pre-enrichment of microorganisms present in environmental samples. However, PCR cannot differentiate the aforementioned states of viability and activity. When combined with one or more culture-based techniques, the viability of certain subsets of microorganisms may still be determined.

Detecting Environmental Microorganisms Using PCR

Source: Laboratories of Dr. Ian Pepper and Dr. Charles Gerba - Arizona University
Demonstrating Author: Bradley Schmitz
Polymerase chain reaction (PCR) is ...

Çevre Bilimleri

Çevre Mikrobiyolojisi

Gradient Polymerase Chain Reaction to Determine the Optimum Annealing Temperature

Source: Tsujimoto, H. et al., <a href="https://app.jove.com/v/63008">Indel Detection following CRISPR/Cas9 Mutagenesis using High-resolution Melt Analysis in the Mosquito Aedes aegypti.</a> J. Vis. Exp. (2021).
This video demonstrates the gradient polymerase chain reaction for optimization of the annealing temperature of primers, which sets gradient annealing temperature along wells. The effect of different annealing temperatures is determined by the yield of amplified products that helps to optimize the reaction condition.

Optimum Tavlama Sıcaklığını Belirlemek için Gradyan Polimeraz Zincir Reaksiyonu

Source: Tsujimoto, H. et al., Indel Detection following CRISPR/Cas9 Mutagenesis using High-resolution Melt Analysis in the Mosquito Aedes aegypti. J. Vis. ...