Bu çalışma, Virginia Commonwealth Üniversitesi Başkanlık Araştırma Teşvik Programı (PRIP) 144602-3 (PX) tarafından, Sağlık (PX) Ulusal Enstitüleri ile hibe R01DE018138 tarafından kısmen desteklenmiştir. Biz Dr teşekkür ederim. Lei Chen, genom çapında mutantların inşaatı ile yardım için Yuetan Dou ve Wang Xiaojing. Biz de DNA dizi için Virginia Commonwealth Üniversitesi&#39;nde DNA Çekirdek Tesis ederim.

1. Primer Tasarım <ol><li> Astarlar S. dayalı ev komut kullanılarak tasarlanmıştır sanguinis SK36 genom dizisi. Primerler, F1/R1, F2/R2, ve F3/R3 üç set hedef gen, APHA-3 kodlaması, kanamisin e dirençli gen (Km r) protein 3 ve 1 1-kb yukarısında sekans amplifikasyonu için tasarlanmış sırasıyla, hedef gen, bir-kb aşağı sekansı (Şekil 1). Bu primerler arasında, F1 ve R3 programları EMBOSS paketi (içinde ePrimer3 kullanılarak tasarlanmıştır <a href="http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html" target="_blank">http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html</a> hedefin yukarı veya aşağı komşu bölgeleri yükseltmek için) Gen. Gene özgü primerler, R1 ve F3, 5 &#39;ve 3&#39; dizileri hedef genin bağlı olarak tasarlanmıştır. R1 ve F3 primerler APHA-3 tamamlayıcı olan kendi 5 &#39;ucunda 25 bp&#39;lik adaptör dizisi içerenGen. Her bir primerin erime sıcaklığına yakın olan bir ila 60 ° C 96-gözlü formata bütün PCR reaksiyonları için tavlama sıcaklık üniform bir kullanımını sağlamaktır. Olacak şekilde tasarlanmıştır </li><li> F1, R1, F3 ve R3, primerler bir gen sırasına göre 96 oyuklu levhalar içinde sentezlendi. Her bir plaka, aynı gen için primerlerin bir türünü içerir. Çok kanallı bir pipet kullanılarak PCR amplifikasyonu için 10 uM&#39;lik bir son konsantrasyon 96-kuyu çalışma astar levha içinde primerler seyreltilir. </li></ol> 2. Yüksek throughput PCR Amplifikasyon ve Saflaştırılması <ol><li> High-throughput yükseltmek için 1-kb yukarısında veya hedef S. mansap sanguinis genler, 1640 ul GKD 2 O, 250 ul 10xHigh Fidelity PCR Tamponu, 10 mM dNTP karışımı 200 ul, 50 mM 100 ul MgSO4, 100 ul ihtiva eden bir 15-ml konik bir tüp içinde buz üzerinde bir PCR kokteyl karışım birleştirmek 10 ul / ng S. sanguinis SK36 genomik DNA ve 10 ul Platin Taq DNA polymerase yüksek sadakat ve transferi çok kanallı pipet kullanarak 96-PCR plaka üzerinde her kuyuya karışımı 23 ul. Kanallı bir pipet kullanılarak PCR plaka için astar plakalar çalışan 10 uM her F1 ve R1, (ya da F3 ve R3 taban düzenekleri) 1 ul aktarın. PCR plate Mühür ve 1.5 dk 30 sn ve 68 ° C 30 sn 1 dk ve 94 ° C 30 döngü, 54 ° C için 94 ° C&#39;de amplifikasyon gerçekleştirin. </li><li> % 1 agaroz jel 48 kuyu montaj kanallı pipet yükleme ile etidyum bromür içeren hazırlayın. 96-plaka üzerine 5xDNA yükleme tamponu 1 ul 4 ul PCR ürünü karıştırın ve 10-ul kanallı pipet kullanarak agaroz jel üzerinde örnekleri yükleyebilirsiniz. 30 dakika için 135 V elektroforez çalıştırın. UVP dokümantasyon ve analiz sistemi altında jel üzerinde bant inceleyin. </li><li> Üreticinin talimatlarına göre santrifüj kullanılarak PureLink 96 PCR saflaştırma kiti ile PCR ürünleri arındırın. DNA salınımlı için, b kuyuya 40 ul steril GKD 2 O ekleyinplaka inding. </li><li> Rasgele Nanodrop spektrofotometre kullanılarak DNA konsantrasyonları incelemek için plaka üzerinde birçok saflaştırılmış amplikonlarının almak. Plaka üzerinde amplikonlarının konsantrasyon ayarlama için ~ ul / 10 ng. </li><li> Bir plazmid içeren Km r kaset PCR şablon olarak EcoR ben kullanılarak sindirilir. Sindirilen plazmid QIAquick PCR saflaştırma kiti ile arındırıldı ve doğrusal plazmid DNA son DNA konsantrasyonu 10 ng / ml &#39;den ayarlanır. SO 16.4 ul GKD 2 O, 2.5 ul 10xHigh Fidelity PCR Tamponu, 10 mM dNTP karışımı 2 ul 50 mM Mg 1 ul içeren Km r kaset amplikon için 25 ul karışım birleştirin 4, 10 uM, F2, 1 ul 1 ul 10 uM R2, 1 ul doğrusal plazmid DNA ve 0.1 ul Platin Taq DNA polimeraz yüksek aslına uygunluk. ° C 1 dakika, 30 saniye ve 68 saniye için 30 için 1 dakika, ve 94 ° C&#39;de 30 döngü, 55 ° C de 94 ° C &#39;de PCR amplifikasyon gerçekleştirin. % 1 agaroz jel elektroforezi ile PCR ürünü inceleyin. PooQIAquick PCR saflaştırma kiti ile 10 ayrı PCR saflaştırılmış gelen Km r kaset Amplikon la toplu. 10 ng / ul Amplikon konsantrasyonunu ayarlayın. </li><li> Son lineer rekombinant PCR amplikon elde etmek için, üç PCR amplikonlarının de PCR şablon olarak bir PCR plate her 1 ul (yaklaşık eşit molar miktarlarda) ile birleştirilir. Diğer bileşenler PCR SO 14.4 ul GKD 2 O, 2.5 ul 10xHigh Fidelity PCR Tamponu, 10 mM dNTP karışımı 2 ul 50 mM Mg 1 ul da dahil olmak üzere eklenir 4, 10 uM F1 1 ul, 10 uM, R3 1 ul, 0.1 ul Platinum Taq DNA polimeraz yüksek sadakat. PCR amplifikasyon 4 dk için 3.5 dakika ve son olarak da 68 ° C 30 sn için ve 68 ° C, 30 saniye 55 ° C, 2 dakika, 94 ° C&#39;de 30 döngü için 94 ° C sıcaklıkta gerçekleştirilir. </li><li> Agaroz jel üzerinde PCR amplikonlar inceleyin. Arındırmak ve yukarıda tarif edildiği gibi PCR amplikonlar ölçülmesine imkan verirler. -20 ° C&#39;de rekombine PCR amplikonlarının dondurun </li></ol> 3. Competent Hücreler Hazırlık <ol><li> Todd Hewitt et suyu hazır hale getirilir, oda sıcaklığına kadar soğutuldu ve 0.22 um filtre polistiren 4 kullanarak sterilize sonra kaynamaya kadar ısıtıldı ve 10 N NaOH kullanılarak 7.6 pH değeri ayarlanmış. TH + HS orta telafi etmek için 15 ml konik tüp içinde 11.7 ml Todd Hewitt suyuna 300 ul ısı inaktive at serumu (% 2.5 final konsantrasyon) ekleyin. Tablet TH + HS orta 2 ml ve tüpler 10 ml içine. </li><li> Stokta S. 5 ul inoküle sanguinis SK36 2 ml TH + HS ortama -80 ° C&#39;de dondurulmuş ve 37 sıkıca kapatma ile gecede kültür inkübe 10 ml-TH + HS tüp pre-kuluçkaya eşliğinde ° C,. </li><li> Gece boyunca sonra, 10 ml TH + HS içine 50 ul kültür aktarmak ve 3 saat (0,07-0,08 OD 660 tekabül eder), 37 ° C de inkübe tüp, hemen dönüşüm için kullanarak. </li></ol> 4. Hücre Dönüşüm ve Antibiyotik Seçimi <ol><li> 70 ng S. 2 ul ekleyin sanguinis SK36 yetsistans uyarıcı peptid (CSP) ve 37 blok 96-iyi ve onları ön ısıtma üzerine Eppendorf tüplerine 2 ul doğrusal rekombinant PCR amplikon (~ 50 ng) ° C Her tüpe 3 sa-inkübatöre SK36 kültürün 330 ul aktarın. 1 saat boyunca 37 ° C&#39;de inkübe edin. Kontrol olarak steril GKD 2 O ile DNA değiştirin. </li><li> Buz bloğu yerleştirin ve 500 mg / ml kanamisin beyin kalp infüzyon (BHI) agar plaka üzerinde her dönüşümün 100 ul yayıldı. Mikroaerobik koşullar altında 2 d, 37 ° C de inkübe plakaları. </li></ol> 5. Mutant Onay ve Depolama <ol><li> Her yedek mutant için, rastgele, 2 ayrı koloniler pick up 5 ml BHI 500 mg / ml kanamisin içeren haline koloni aşılamak ve 37 microaerobically gecede inokulum inkübe ° C -80% 30 gliserol, her kültür Cryopreserve ° C </li><li> Beklenen gen replasman içeren mutant, koloni her mutant kullanarak F1 için PCR ve R3 gerçekleştirmek olmadığını incelemek için96-kuyulu plakalı olarak PCR primerleri. Tek koloni ila yaklaşık 1 ul gece boyunca kültür 25 ul PCR amplifikasyon reaksiyonu içinde şablon DNA olarak kullanılmıştır. PCR ° C&#39;de 3.5 dakika ve son olarak da 68 ° C&#39;de 4 dakika için 30 saniye ve 68 için 30 saniye, 55 ° C&#39;de 5 dakika, 94 ° C&#39;de 35 döngü için 94 ° C sıcaklıkta gerçekleştirilir. </li><li> Tam çift bant mutantlar veya kirletici PCR amplikon tanımlamak için, etidyum bromid boyama ile&gt; 12 cm uzunluğunda% 2&#39;lik agaroz jel üzerinde 4 saat elektroforez ile PCR amplikon inceleyin. Bu agaroz jel elektroforez koşulu altında, ≥ 100 bp farkı ile herhangi amplikonlarının açıkça belirlenmiştir. Km r kaset amplifikasyon ve vahşi türdeki kaynaklanan bantları bir iç T1 astar vahşi tip geni PCR ile tespit edilebilir olup olmadığını belirlemek için kullanılır &lt;100 bp, göre farklı beklenen zaman. </li><li> İlave Silme işlemini onaylamak için, amplikonlarının PureLink 96 PCR saflaştırma kiti ile saflaştırılmış ve hangi P1 astar kullanılarak dizilerekKm r kaseti bağlanır. Sekanslama tarafından onaylandıktan sadece doğru mutantlar tutun. </li></ol>

<ol>
	<li>Sassetti, C. M., Boyd, D. H., Rubin, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes+required+for+mycobacterial+growth+defined+by+high+density+mutagenesis.">Genes required for mycobacterial growth defined by high density mutagenesis.</a> Mol. Microbiol. 48, 77-84 (2003).</li><li>Kobayashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+Bacillus+subtilis+genes.">Essential Bacillus subtilis genes.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 4678-4683 (2003).</li><li>Trieu-Cuot, P., Courvalin, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+sequence+of+the+Streptococcus+faecalis+plasmid+gene+encoding+the+3'5"-aminoglycoside+phosphotransferase+type+III.">Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3'5"-aminoglycoside phosphotransferase type III.</a> Gene. 23, 331-341 (1983).</li><li>Paik, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+virulence+determinants+for+endocarditis+in+Streptococcus+sanguinis+by+signature-tagged+mutagenesis.">Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis.</a> Infect. Immun. 73, 6064-6074 (2005).</li><li>Lukomski, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonpolar+inactivation+of+the+hypervariable+streptococcal+inhibitor+of+complement+gene+(sic)+in+serotype+M1+Streptococcus+pyogenes+significantly+decreases+mouse+mucosal+colonization.">Nonpolar inactivation of the hypervariable streptococcal inhibitor of complement gene (sic) in serotype M1 Streptococcus pyogenes significantly decreases mouse mucosal colonization.</a> Infect. Immun. 68, 535-542 (2000).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, (2006).</li><li>de Berardinis, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complete+collection+of+single-gene+deletion+mutants+of+Acinetobacter+baylyi+ADP1.">A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1.</a> Mol. Syst. Biol. 4, 174 (2008).</li><li>Rodriguez, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physiological+and+molecular+characterization+of+genetic+competence+in+Streptococcus+sanguinis.">Physiological and molecular characterization of genetic competence in Streptococcus sanguinis.</a> Mol. Oral. Microbiol. 26, 99-116 (2011).</li><li>Perry, D., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+mutans+Infect.">Genetic transformation of Streptococcus mutans Infect.</a> Immun. 32, 1295-1297 (1981).</li><li>Pakula, R., Walczak, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+nature+of+competence+of+transformable+streptococci.">On the nature of competence of transformable streptococci.</a> J. Gen. Microbiol. 31, 125-133 (1963).</li><li>Datsenko, K. A., Wanner, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+inactivation+of+chromosomal+genes+in+Escherichia+coli+K-12+using+PCR+products.">One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 6640-6645 (2000).</li><li>Xu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+essential+gene+identification+in+Streptococcus+sanguinis.">Genome-wide essential gene identification in Streptococcus sanguinis.</a> Sci. Rep. 1, (2011).</li></ol>

Çıkar çatışması ilan etti.

İlk astar tasarımı sırasında komşu genler üzerinde dışsal antibiyotik gen ile bir hedef genin değiştirilmesi mümkün polar etkilerini en aza indirmek için, iki adım alınır. Silinen genlerin çoğu için, primerler R1 ve F3 önce stop kodonu ile 30 bp için başlangıç ​​kodonu takip eden 6 bp gelen kodlama bölgesindeki silmek için tasarlanmıştır. Son 30 baz çifti bitişik aşağı gen tarafından kullanılan potansiyel ribozomal bağlanma yeri korumak için korunur. Iki komşu genler arasında...

<table border="1"&gt;<tbody&gt;<tr&gt;<td<strong&gt; İsimler</strong</td&gt;<td<strong&gt; Şirket</strong</td&gt;<td<strong&gt; Katalog #</strong</td&gt;<td<strong&gt; Yorumlar (isteğe bağlı)</strong</td&gt;</tr&gt;<tr&gt;<td&gt; Astar F2</td&gt;<td&gt; Entegre DNA Teknolojileri</td&gt;<td</td&gt;<td&gt; TGACTAACTAGGAGGAATAAATG<br/&gt; GCTAAAATGAGAATAT</td&gt;</tr&gt;<tr&gt;<td&gt; Astar R2</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; CATTATTCCCTCCAGGTACTAAAA<br/&gt; CAATTCATCCAGT</td&gt;</tr&gt;<tr&gt;<td&gt; Astar F2P</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GATAAACCCAGCGAACCATTTGA</td&gt;</tr&gt;<tr&gt;<td&gt; Astar P1</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GCTTATATACCTTAGCAGGAGACA</td&gt;</tr&gt;<tr&gt;<td&gt; Astar P2</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GTATGACATTGCCTTCTGCGTCC</td&gt;</tr&gt;<tr&gt;<td&gt; Astar 5 &#39;end_R1_seq</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GCCATTTATTCCTCCTAGTTAGTCA</td&gt;</tr&gt;<tr&gt;<td&gt; Astar 5 &#39;end_F3_seq</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GTTTTAGTACCTGGAGGGAATAATG</td&gt;</tr&gt;<tr&gt;<td&gt; Astar 5 &#39;end_R1p_seq</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; CCTCAAATGGTTCGCTGGGTTTATC</td&gt;</tr&gt;<tr&gt;<td&gt; CSP</td&gt;<td&gt; Synprep</td&gt;<td</td&gt;<td&gt; Dizi: NH2-DLRGVPNPWGWIFGR-COOH</td&gt;</tr&gt;<tr&gt;<td&gt; DNA Polimeraz</td&gt;<td&gt; Invitrogen</td&gt;<td&gt; 11304-102</td&gt;<td&gt; Platinum Taq DNA Polimeraz High Fidelity</td&gt;</tr&gt;<tr&gt;<td&gt; EcoRI</td&gt;<td&gt; New England Biolabs Inc</td&gt;<td&gt; R0101S</td&gt;<td&gt; Restriksiyon enzimi</td&gt;</tr&gt;<tr&gt;<td&gt; Agar</td&gt;<tdBiyoanalitik&gt; Amerikan</td&gt;<td&gt; AB01185</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Agaroz</td&gt;<td&gt; Promega</td&gt;<td&gt; V3125</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; BHI</td&gt;<td&gt; BD Biosciences</td&gt;<td&gt; 237.500</td&gt;<td&gt; Beyin Kalp İnfüzyon</td&gt;</tr&gt;<tr&gt;<td&gt; At serumu</td&gt;<td&gt; Fisher Scientific</td&gt;<td&gt; SH3007403</td&gt;<td&gt; At serumu</td&gt;</tr&gt;<tr&gt;<td&gt; Km</td&gt;<td&gt; Fisher Scientific</td&gt;<td&gt; BP906-5</td&gt;<td&gt; Kanamisin</td&gt;</tr&gt;<tr&gt;<td&gt; TH broth</td&gt;<td&gt; BD Biosciences</td&gt;<td&gt; 249.240</td&gt;<td&gt; Todd Hewitt broth</td&gt;</tr&gt;<tr&gt;<td&gt; PureLink 96</td&gt;<td&gt; Invitrogen</td&gt;<td&gt; K310096</td&gt;<td&gt; PureLink 96 PCR saflaştırma kiti</td&gt;</tr&gt;<tr&gt;<td&gt; QIAquick</td&gt;<td&gt; Qiagen</td&gt;<td&gt; 28106</td&gt;<td&gt; QIAquick PCR saflaştırma kiti</td&gt;</tr&gt;<tr&gt;<td&gt; Filtre</td&gt;<td&gt; Corning</td&gt;<td&gt; 431.117</td&gt;<td&gt; 0.22 mikron polistiren filtre</td&gt;</tr&gt;<tr&gt;<td&gt; Anoxomat Sistemi</td&gt;<td&gt; Mart Mikrobiyoloji bv</td&gt;<td&gt; Anoxomat Mark II</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Masa Üstü Santrifüj</td&gt;<td&gt; Thermo Scientific</td&gt;<td&gt; 75004377</td&gt;<td&gt; Sorvall Legend RT Plus mikroplaka rotor</td&gt;</tr&gt;<tr&gt;<td&gt; Jel Dökümantasyon</td&gt;<td&gt; UVP LLC</td&gt;<td&gt; BioDoc-O 210</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; İnkübatör</td&gt;<td&gt; Fisher Scientific</td&gt;<td&gt; 11-690-625D</td&gt;<td&gt; Isotemp</td&gt;</tr&gt;<tr&gt;<td&gt; Labnet kullanıcısının Jel XL</td&gt;<td&gt; Labnet</td&gt;<td&gt; E0160</td&gt;<td&gt; Labnet kullanıcısının Jel XL</td&gt;</tr&gt;<tr&gt;<td&gt; Mikrosantrifüj</td&gt;<td&gt; Eppendorf</td&gt;<td&gt; 22621408</td&gt;<td&gt; Mikrosantrifüj 5415 R</td&gt;</tr&gt;<tr&gt;<td&gt; Çok Kanallı pipetler</td&gt;<td&gt; Termo scientfic</td&gt;<td&gt; 4661040, 4661020</td&gt;<td&gt; Finnpipette F1</td&gt;</tr&gt;<tr&gt;<td&gt; Termal Cycler</td&gt;<td&gt; Uygulamalı Biosystems Inc</td&gt;<td&gt; N805-0200</td&gt;<td&gt; GeneAmp PCR sistemi 9700</td&gt;</tr&gt;</tbody&gt;</table

genome-wide gene deletions in streptococcus sanguinis by high throughput pcr

Transposon mutagenez ve tek gen delesyonu bakteriler 1,2 genom gen nakavt uygulanan iki yöntem vardır. Transposon mutagenesis, daha az zaman alan daha az maliyetli ve tamamlanmış genom bilgi gerekli değildir olmasına rağmen, bu yöntem iki zayıf vardır: azalma ile rekabet mutantlar karşı seçer ve bu karışık mutant kütüphanesi içinde bir farklı mutantların (1) olasılığı; ve (2) kısmi gen inaktivasyonu olasılığını sayede genlerin tamamen transposonun yerleştirilmesinin ardından kendi işlevini kaybetmek yok. Tek gen silme analizi transpozon mutasyon ile ilgili dezavantajları telafi edebilir. Genom tek gen delesyonu verimini artırmak için, bir model organizma olarak Streptococcus sanguinis kullanarak genom tek gen delesyonu için yüksek-throughput tekniği kurmaya çalışacaktır. Her gen delesyonu S. inşa sanguinis genom 1 ihtiva şekilde tasarlanmıştırHedefli gen, APHA-3 geni kodlayan, kanamisin e dirençli protein ve hedeflenen gen 1-kb akış aşağı-yukarı kb. Primerler F1/R1, F2/R2, ve F3/R3 üç set, sırasıyla tasarlanmış ve her bir silme, bu üç parçalarını inşa PCR büyütmesi için-96-kuyucuklu bir plaka biçiminde sentezlenir. Primerler, R1 ve F3 kendi 5 &#39;ucunda APHA-3 gen bölgeleri için tamamlayıcı olan 25-bp sekanslar içerir. APHA-3 geninin büyük ölçekli bir PCR amplifikasyon tüm tek gen silme yapıları oluşturmak için bir kez gerçekleştirilir. APHA-3 geninin promotörü başlangıçta kanamisin kaseti potansiyel kutup etkisini en aza indirmek için dahil edilir. Gen silme yapıları oluşturmak için yüksek verimli, PCR saflaştırma 96 çukurlu bir levha formatında gerçekleştirilir. Her gen delesyonu için doğrusal bir rekombinant PCR amplikon yüksek sadakat DNA polimeraz kullanılarak dört PCR reaksiyonları aracılığıyla yapılacaktır. Ilk exponS. ential büyüme fazı % 2.5 inaktive at serumu PCR-rekombinant yapıların dönüşümü için yeteneklerini artırmak için kullanılan Todd Hewitt broth kültürü sanguinis desteklenmiştir. S. Bu koşul altında,% 20&#39;ye kadar sanguinis hücrelerin DNA ~ 50 ng kullanılarak dönüştürülebilir. Bu yaklaşıma göre, tek gen silinmesi ile 2.048 nihai mutant S. 2.270 genler elde edildi dört gen ORF hariç sanguinis S. başka ORF tamamen kaplayabilir sanguinis SK36 ve 218 potansiyel elzem genler. Gen delesyonu yapıları oluşturma konusunda teknik, yüksek verim ve herhangi bir dönüştürülebilir bakteri genomu tek gen delesyonlar kullanımı kolay olabilir.

Sonra PCR primerleri, F1 ve R1 kullanılarak amplifikasyon, ve F3 ve R3&#39;ün her biri S. yaklaşık 1 kb yukan ve aşağı sanguinis gen 96-gözlü formata, sırasıyla (Şekil 2A) halinde elde edildi. Bizim PCR koşulları ve kullanılarak tasarlanmış primerler altında, belirli bir ürün S. amplifiye edildi Her bir PCR reaksiyonu içinde sanguinis genomik DNA. Bu sonuç primerlerin S. hedeflerine çok özel olduğunu göstermiştir sanguinis....

Watch this Scientific Journal Video about Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR at JoVE.com

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Verimli bir genom tek gen mutasyonu yöntemi kullanılarak oluşturulmuştur<em&gt; Streptococcus sanguinis</em&gt; Bir model organizma olarak. Bu yöntem yüksek verimlilik rekombinant PCR ve dönüşümler yoluyla elde etti.

Genom çapında Gen Delesyonlar içinde<em&gt; Streptococcus sanguinis</em&gt; Yüksek Verimli PCR ile

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

genome-wide-gene-deletions-streptococcus-sanguinis-high-throughput

Research

JoVE Journal

Biology

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

16.4K Görüntüleme.  Virginia Commonwealth University. Verimli bir genom tek gen mutasyonu yöntemi kullanılarak oluşturulmuştur Streptococcus sanguinis Bir model organizma olarak. Bu yöntem yüksek verimlilik rekombinant PCR ve dönüşümler yoluyla elde etti.

Video: Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the protein domains that bind to specific histone modifications. One such domain is the plant homeodomain (PHD), found in several chromatin-binding proteins. The epigenetic factor RBP2 has multiple PHD domains, however, they have different functions (Figure 4). In particular, the C-terminal PHD domain, found in a RBP2 oncogenic fusion in human leukemia, binds to trimethylated lysine 4 in histone H3 (H3K4me3)1. The transcript corresponding to the RBP2 isoform containing the C-terminal PHD accumulates during differentiation of promonocytic, lymphoma-derived, U937 cells into monocytes2. Consistent with both sets of data, genome-wide analysis showed that in differentiated U937 cells, the RBP2 protein gets localized to genomic regions highly enriched for H3K4me33. Localization of RBP2 to its targets correlates with a decrease in H3K4me3 due to RBP2 histone demethylase activity and a decrease in transcriptional activity. In contrast, two other PHDs of RBP2 are unable to bind H3K4me3. Notably, the C-terminal domain PHD of RBP2 is absent in the smaller RBP2 isoform4. It is conceivable that the small isoform of RBP2, which lacks interaction with H3K4me3, differs from the larger isoform in genomic location. The difference in genomic location of RBP2 isoforms may account for the observed diversity in RBP2 function. Specifically, RBP2 is a critical player in cellular differentiation mediated by the retinoblastoma protein (pRB). Consistent with these data, previous genome-wide analysis, without distinction between isoforms, identified two distinct groups of RBP2 target genes: 1) genes bound by RBP2 in a manner that is independent of differentiation; 2) genes bound by RBP2 in a differentiation-dependent manner.
To identify differences in localization between the isoforms we performed genome-wide location analysis by ChIP-Seq. Using antibodies that detect both RBP2 isoforms we have located all RBP2 targets. Additionally we have antibodies that only bind large, and not small RBP2 isoform (Figure 4). After identifying the large isoform targets, one can then subtract them from all RBP2 targets to reveal the targets of small isoform. These data show the contribution of chromatin-interacting domain in protein recruitment to its binding sites in the genome.

Here we are presenting a chromatin immunoprecipitation (ChIP) procedure for genome-wide location analysis of protein isoforms that differ in a histone-binding domain. We are applying it to ChIP-Seq analysis to identify the targets of the KDM5A/JARID1A/RBP2 histone demethylase.

Izoform özel Gen Hedefler Belirlemek için ChIP kullanarak genom analizi

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

Biyoloji

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details).
To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3&#900;TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).

The Target ID Library is a plasmid-based, genome-wide collection of cloned cDNA used to identify miRNA targets. Here we demonstrate its use and application.

MİSYON Hedef Kimliği Kütüphane Kullanımı miRNA Hedefler için genom Ekran

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. elegans, gene function can be knocked down simply and efficiently by feeding worms with bacteria expressing a dsRNA corresponding to a specific gene 1. While the creation of libraries of RNAi clones covering most of the C. elegans genome 2,3 opened the way for true functional genomic studies (see for example 4-7), most established methods are laborious. Moy and colleagues have developed semi-automated protocols that facilitate genome-wide screens 8. The approach relies on microscopic imaging and image analysis. 
	Here we describe an alternative protocol for a high-throughput genome-wide screen, based on robotic handling of bacterial RNAi clones, quantitative analysis using the COPAS Biosort (Union Biometrica (UBI)), and an integrated software: the MBioLIMS (Laboratory Information Management System from Modul-Bio) a technology that provides increased throughput for data management and sample tracking. The method allows screens to be conducted on solid medium plates. This is particularly important for some studies, such as those addressing host-pathogen interactions in C. elegans, since certain microbes do not efficiently infect worms in liquid culture.
	We show how the method can be used to quantify the importance of genes in anti-fungal innate immunity in C. elegans. In this case, the approach relies on the use of a transgenic strain carrying an epidermal infection-inducible fluorescent reporter gene, with GFP under the control of the promoter of the antimicrobial peptide gene nlp 29 and a red fluorescent reporter that is expressed constitutively in the epidermis. The latter provides an internal control for the functional integrity of the epidermis and nonspecific transgene silencing9. When control worms are infected by the fungus they fluoresce green. Knocking down by RNAi a gene required for nlp 29 expression results in diminished fluorescence after infection. Currently, this protocol allows more than 3,000 RNAi clones to be tested and analyzed per week, opening the possibility of screening the entire genome in less than 2 months.

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

We describe a protocol using C. elegans and RNAi feeding libraries that allows automated measurement of multiple parameters such as fluorescence, size and opacity of individual worms in a population. We give one example of a screen to identify genes involved in anti-fungal innate immunity in C. elegans.

Nicel ve Otomatik Yüksek throughput Genom çapında RNAi Ekranlar C. elegans</em

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. ...

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition1,2. There are examples where many genes need to be deleted to unmask hidden gene functions3,4. Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative.
In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker5,6,7,8,9,10. However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated.
Here we describe the Green Monster method for routinely engineering multiple deletions in yeast11. In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction.
The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci&#x2014;either Green Monster GMToolkit-a or GMToolkit-&alpha; at the can1&Delta; locus (Figure 3). Using strains from the yeast deletion collection12, GFP-marked deletions can be conveniently generated by replacing the common KanMX4 cassette existing in these strains with a universal GFP-URA3 fragment. Each GMToolkit contains: either the a- or &alpha;-mating-type-specific haploid selection marker1 and exactly one of the two markers that, when both GMToolkits are present, collectively allow for selection of diploids.
The second step is to carry out the sexual cycling through which deletion loci can be combined within a single cell by the random assortment and/or meiotic recombination that accompanies each cycle of mating and sporulation.

The Green Monster method enables the rapid assembly of multiple deletions marked with a reporter gene encoding green fluorescent protein. This method is based on driving yeast strains through repeated cycles of sexual assortment of deletions and fluorescence-based enrichment of cells carrying more deletions.

Çoklu Gen Delesyonlar Taşıma Maya Suşlarında Nesil için Yeşil Canavar Süreci

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.

Single cell gene expression assay is needed for understanding stem cell heterogeneities.

Kantitatif RT-PCR ile Bireysel İnsan Embriyonik Kök Hücreleri profilleme

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay (PCA) in Living Cells

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often depend on its interactions with other proteins. Here, we describe a protocol for the yeast protein-fragment complementation assay (PCA), a powerful method to detect direct and proximal associations between proteins in living cells. The interaction between two proteins, each fused to a dihydrofolate reductase (DHFR) protein fragment, translates into growth of yeast strains in presence of the drug methotrexate (MTX). Differential fitness, resulting from different amounts of reconstituted DHFR enzyme, can be quantified on high-density colony arrays, allowing to differentiate interacting from non-interacting bait-prey pairs. The high-throughput protocol presented here is performed using a robotic platform that parallelizes mating of bait and prey strains carrying complementary DHFR-fragment fusion proteins and the survival assay on MTX. This protocol allows to systematically test for thousands of protein-protein interactions (PPIs) involving bait proteins of interest and offers several advantages over other PPI detection assays, including the study of proteins expressed from their endogenous promoters without the need for modifying protein localization and for the assembly of complex reporter constructs.

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay PCA in Living Cells

Proteins interact with each other and these interactions determine in a large part their functions. Protein interaction partners can be identified at high-throughput in vivo using a yeast fitness assay based on the dihydrofolate reductase protein-fragment complementation assay (DHFR-PCA).

Yaşayan Hücrelerde Protein-fragmanı tamamlama Assay (PCA) ile genom Protein-protein etkileşimi Eleme

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

Post-transkripsiyonel ayarlı genlerin kimyasal Modülatörler için yüksek verimli tarama

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

qPCRTag Analysis - A High Throughput, Real Time PCR Assay for Sc2.0 Genotyping

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic chromosome, synIII1, and one synthetic chromosome arm, synIXR2, have been constructed and their in vivo function validated in the absence of the corresponding wild type chromosomes. An important design feature of Sc2.0 chromosomes is the introduction of PCRTags, which are short, re-coded sequences within open reading frames (ORFs) that enable differentiation of synthetic chromosomes from their wild type counterparts. PCRTag primers anneal selectively to either synthetic or wild type chromosomes and the presence/absence of each type of DNA can be tested using a simple PCR assay. The standard readout of the PCRTag assay is to assess presence/absence of amplicons by agarose gel electrophoresis. However, with an average PCRTag amplicon density of one per 1.5 kb and a genome size of ~12 Mb, the completed Sc2.0 genome will encode roughly 8,000 PCRTags. To improve throughput, we have developed a real time PCR-based detection assay for PCRTag genotyping that we call qPCRTag analysis. The workflow specifies 500 nl reactions in a 1,536 multiwell plate, allowing us to test up to 768 PCRTags with both synthetic and wild type primer pairs in a single experiment.

Designer chromosomes of the Synthetic Yeast Genome project, Sc2.0, can be distinguished from their native counterparts using a PCR-based genotyping assay called PCRTagging, which has a presence/absence endpoint. Here we describe a high-throughput real time PCR detection method for PCRTag genotyping.

qPCRTag Analizi - A Yüksek Verimli, Sc2.0 Genotiplendirme için Real Time PCR Testi

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic ...

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC (Crosslinking of Small Molecules to Isolate Chromatin)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to dose-limiting toxicity and many adverse side effects. Targeting the genome with sequence-specific small molecules may enable molecules with increased therapeutic index and fewer off-target effects. N-methylpyrrole/N-methylimidazole polyamides are molecules that can be rationally designed to target specific DNA sequences with exquisite precision. And unlike most natural transcription factors, polyamides can bind to methylated and chromatinized DNA without a loss in affinity. The sequence specificity of polyamides has been extensively studied in vitro with cognate site identification (CSI) and with traditional biochemical and biophysical approaches, but the study of polyamide binding to genomic targets in cells remains elusive. Here we report a method, the crosslinking of small molecules to isolate chromatin (COSMIC), that identifies polyamide binding sites across the genome. COSMIC is similar to chromatin immunoprecipitation (ChIP), but differs in two important ways: (1) a photocrosslinker is employed to enable selective, temporally-controlled capture of polyamide binding events, and (2) the biotin affinity handle is used to purify polyamide&#8211;DNA conjugates under semi-denaturing conditions to decrease DNA that is non-covalently bound. COSMIC is a general strategy that can be used to reveal the genome-wide binding events of polyamides and other genome-targeting chemotherapeutic agents.

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC Crosslinking of Small Molecules to Isolate Chromatin

Identifying the direct targets of genome-targeting molecules remains a major challenge. To understand how DNA-binding molecules engage the genome, we developed a method that relies on crosslinking of small molecules to isolate chromatin (COSMIC).

COSMIC ile Hücrelerde İlaç-DNA Etkileşimlerinin genom Haritalama (Küçük moleküllerinin çapraz bağlanmasını Kromatin yalıtmak için)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is an alternative approach to chromatin immunoprecipitation (ChIP). An expressed fusion protein consisting of the protein of interest and the E. coli DNA adenine methyltransferase can methylate the adenine base in GATC motifs near the sites of protein-DNA interactions. Adenine-methylated DNA fragments can then be specifically amplified and detected. The original DamID assay detects the genomic locations of methylated DNA fragments by hybridization to DNA microarrays, which is limited by the availability of microarrays and the density of predetermined probes. In this paper, we report the detailed protocol of integrating high throughput DNA sequencing into DamID (DamID-seq). The large number of short reads generated from DamID-seq enables detecting and localizing protein-DNA interactions genome-wide with high precision and sensitivity. We have used the DamID-seq assay to study genome-nuclear lamina (NL) interactions in mammalian cells, and have noticed that DamID-seq provides a high resolution and a wide dynamic range in detecting genome-NL interactions. The DamID-seq approach enables probing NL associations within gene structures and allows comparing genome-NL interaction maps with other functional genomic data, such as ChIP-seq and RNA-seq.

We describe herein an assay by coupling DNA adenine methyltransferase identification (DamID) to high throughput sequencing (DamID-seq). This improved method provides a higher resolution and a wider dynamic range, and allows analyzing DamID-seq data in conjunction with other high throughput sequencing data such as ChIP-seq, RNA-seq, etc.

DamID seq: Adenin-metillenmiş DNA Fragments Yüksek Verimli Dizileme tarafından Protein-DNA Etkileşimleri genom Haritalama

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...