Yazarlar protokolü yukarıda açıklanan geliştirme konusundaki yardım için Iowa Üniversitesi Minnesota Üniversitesi&#39;nde Branden Moriarty, David Largaespada ve Vincent Keng teşekkür, ve Adam Dupuy olurdu.

1. Yetiştirme ve Transgenik Hayvan Yaşlanma <ol><li> Denemeniz için uygun transgenik farelerin suşları seçin. İstenen kanser için kökenli hücreler olduğu düşünülmektedir hücrelerde Cre rekombinaz eksprese eden bir koşullu transposase fare, transpozonlar bir concatamer barındıran, bir fare, bir fare, bir Tipik bir deneyde üç transjenik çizgileri kullanırlar. Modellenen kanser hastalarının büyük bir kısmı bilinen bir mutasyon olması halinde, başlangıcında bu mutasyon dahil etmek tercih edilebilir. Bu &quot;hazırlayıcı&quot; mutasyon örnekleri aktive Kras, dominant negatif TP53 veya floxed PTEN allel içerir. Predispozan bir mutasyon ekleyerek model daha iyi (1.3) insan kanser temsil edebilir. Çeşitli Sleeping Beauty transposase ve transpozonlar fareler Ulusal Kanser Enstitüsü Fare Deposu (edinilebilir <a href="http://mouse.ncifcrf.gov/" target="_blank">http://mouse.ncifcrf.gov/</a> ). </li><li> Sonunda eğer mümkünse her iki allel için homozigot fareler elde etmek transpozonlar yataklık farelerle Breed koşullu transposase fareler. Sizin üçlü transgenik deney farelerinin (Şekil 2) oluşturmak için Cre Rekombinaz ifade farelere Breed homozigot yavrular. Not: Elde homozigot fareler her zaman mümkün veya ideal değildir. Örneğin, homozigot p53 dominant negatif farelerde çok daha zor heterozigot farelerde daha doğurmak için vardır. Buna ek olarak, ibrelerin ıslahı başarılı olduğunu onaylamak için Mendel genetiği izleyin emin olmanıza yardımcı olur. </li><li> Bir yatkınlık arka kullanıyorsanız, predispozan alleli ile farelere transposase ile ilk cins fareler. Aynı zamanda, ırkı fareler transpozonlar taşıyan farelere Cre Rekombinaz ifade. Her allel mümkünse için homozigot fareler oluşturun. Son olarak, dörtlü transgenik deneysel anim oluşturmak için önceki iki yetiştirme düzenleri homozigot yavrular doğurmakals. </li><li> Deney hayvanları ek olarak, fareler kontrol Kusaklara oluşturur. Kontrol grubuna normal olarak sadece üç allel (Şekil 2) arasında iki devralan deneysel ıslah littermates oluşur. Bir arka plan yatkın olması durumunda, dört allel üçü de dahil olmak üzere fareler de gerekli olacaktır. </li><li> Tümör gelişimi ve / veya can çekişme için günlük deney ve kontrol farelerde izleyin. Sizin kurumsal hayvan bakımı ve hayvancılık için kullanımı komitesi (IACUC) gereksinimleri izleyin. Ayrıca, henüz can çekişmekte olmamıştır eğer bir hayvan kurban edeceği bir yaş belirlemek için tipiktir. Onsekiz ay fareler ötenazi hangi tipik bir yaştır. </li></ol> 2. Transgenik Hayvanlar nekropsi <table border="1"><tbody><tr><td> Reaktif Adı </td><td> Şirket </td><td> Katalog numarası </td></tr><tr><td> Sure-Seal induction Odası </td><td> Beyin Ağacı Bilimsel </td><td> EZ-177 </td></tr><tr><td> Cryovial </td><td> Bioexpress </td><td> C-3355-2 </td></tr><tr><td> % 10 tamponlu formalin </td><td> Sigma Aldrich </td><td> HT501128-4L </td></tr></tbody></table> Tablo 1. Reaktifler gereklidir. <ol><li> Bir fare can çekişen veya belirlenen ömrünün sonuna geldiğinde, sizin IACUC yönergeleri izleyerek bir CO 2 odalarını kullanarak hayvan ötenazi. Genellikle, temiz bir gaz odasında hayvan yerleştirin gaz tankı açmak ve inç kare başına en yüksek 5 daha kilo okumak için regülatörü ayarlayın. CO 2 nazal ve oküler irritasyon ve kaçınma en aza indirmek için yavaş doldurun. Hayvan kalbi artık atıyor ve göz dokunduğu zaman yanıt vermiyor emin olun. </li><li> % 70 etanol ile kurban fare Sprey dış. </li><li> Sıra bir otopsi gemide fare ve diseksiyon iğne ile sabitleyin. Makas bir kullanınd cımbız fare açın ve organları kaldırmak. Toplanan hangi organların belirlenmesi proje bağlıdır. Ancak, bu organlar genellikle fare işlemez hale gelmişti neden çok önemli ipuçları verir her zaman olduğu gibi dalak ve karaciğer toplamak için tavsiye edilir. Ayrıca kemik iliği potansiyeli analizi için sternum toplamak. Buna ek olarak, her zaman anormal görünür herhangi bir organ ya da doku toplamak için faydalıdır. </li><li> Toplanan Dokular ve tümörler dört bölüme ayrılmıştır olmalıdır. % 10% 70 etanol, ardından 18 saat süreyle tamponlu formalin içinde bir kısım düzeltilmiştir. Bu bölüm, H &amp; E boyama ve / veya IHC için de kullanılabilir. Genellikle boyut olarak 50 ila 100 mg olup geri kalan üç bölüm, sıvı nitrojen içinde dondurulur ek bulunmaktadır. Bu DNA, RNA ve protein izolasyonu için de kullanılabilir. </li><li> IACUC kurallarına göre karkas ve kalan dokuların atın. </li></ol> 3. Tümörler genomik DNA İzolasyon <table border="1"><tbody><tr><td> &lt;reaktif strong&gt; adı </td><td> Şirket </td><td> Katalog numarası </td></tr><tr><td> Protein Yağış çözümü </td><td> Qiagen </td><td> 158910 </td></tr><tr><td> Hücre lizis tamponu </td><td> Qiagen </td><td> 158906 </td></tr><tr><td> Proteinaz K </td><td> Qiagen </td><td> 158920 </td></tr><tr><td> RNaz A </td><td> Qiagen </td><td> 158924 </td></tr><tr><td> TE Tampon </td><td> Promega </td><td> V6232 </td></tr></tbody></table> Tablo 2. Reaktifler gereklidir. <ol><li> İnce temiz bir jilet ile dondurulmuş tümör numunesi (50 ila 100 mg) kıyma. </li><li> Sıra bir 1.5 ml mikrosantrifüj tüpü içinde kıyılmış ve doku 5 ul Proteinaz K çözeltisi (20 mg / ml) içeren bir hücre parçalama tamponu 1 ml ekleyin. </li><li> Iyice vorteksleyin. </li><li> ° C çalkalayıcı tercihen gecede en az 4 saat, 250 rpm olarak ayarlanan bir 55 inkübe edin. </li><li> 1 ul RNaz bir çözeltisi (10 mg / ml) eklenir ve boru 25 kez ters. </li><li> 30 dakika süre ile 37 ° C&#39;de inkübe edin. </li><li> 3 dakika için buz üzerine yerleştirilmesi ile oda sıcaklığına soğutun. </li><li> 333 ul Protein yağış çözüm ve şiddetle vorteks ekleyin. </li><li> 14.000 rpm 10 dakika santrifüjleyin. Proteinler pelet gerekir. Pelet tekrar çok küçük, girdap ise, daha sonra 5 dakika, ve yeniden santrifüj boyunca buz üzerinde inkübe edilir. </li><li> Temiz bir 15 ml santrifüj tüp içine supernatant DNA içeren kapalı dökün. </li><li> 100% izopropanol eşit hacmi ekleyin ve yavaşça tersine 50 kat karıştırın. </li><li> 3 dk süreyle 3500 rpm&#39;de santrifüj. </li><li> Süpernatantı atın. </li><li> % 70 etanol 1 ml ekleyin ve pelet yıkamak için tüp birkaç kez ters. </li><li> Bir 1.5 ml mikrosantrifüj tüpüne etanol ile yıkanmış topak aktarın. </li><li> 4 ° C&#39;de 5 dakika boyunca 14,000 rpm&#39;de santrifüje </li><li> Etanol kapalı dökün ve hava kuru (yaklaşık 5 ila 30 dakika) için tüp ters. </li><li> Süspanse DNA pellet TE 50 ila 500 ul DNA pelet boyutuna bağlı olarak. </li><li> 37 İsteğe inkübasyon ° C DNA süspansiyonu. </li><li> Uzun süreli depolama boyunca 4 ° C veya -20 ° C&#39;de depolayın. </li></ol> 4. Tümörler dan Linker Aracılı-PCR kullanarak genomik DNA <table border="1"><tbody><tr><td> Reaktif Adı </td><td> Şirket </td><td> Katalog numarası </td></tr><tr><td> BfaI </td><td> New England Biolabs </td><td> R0568S </td></tr><tr><td> NlaIII </td><td> New England Biolabs </td><td> R0125S </td></tr><tr><td> 96 oyuklu plakalar MinElute </td><td> Qiagen </td><td> 28051 </td></tr><tr><td> QIAvac 96 Vakum manifoldu </td><td> Qiagen </td><td> 19504 </td></tr><tr><td> Multi-mikroplak Genie, 120V </td><td> Scientific Industries, Inc </td><td> SI-4000 </td></tr><tr><td> 5x ligasyon tampon ile T4 DNA ligaz </td><td> Invitrogen </td><html><td> 15224-041 </td></tr><tr><td> BamHI </td><td> New England Biolabs </td><td> R0136S </td></tr><tr><td> 25 mM dNTP </td><td> Bioexpress </td><td> C-5014-200 </td></tr><tr><td> Platinum Taq </td><td> Invitrogen </td><td> 10966-034 </td></tr><tr><td> FastStart Taq DNA Polimeraz </td><td> Roche </td><td> 12032929001 </td></tr><tr><td> Agaroz </td><td> Promega </td><td> V3121 </td></tr><tr><td> TAE Tampon </td><td> Promega </td><td> V4271 </td></tr><tr><td> TE Tampon </td><td> Promega </td><td> V6232 </td></tr><tr><td> Etidyum bromür </td><td> Promega </td><td> H5041 </td></tr></tbody></table> Tablo 3. Reaktifler gereklidir. Linker Diziler BfaI bağlayıcının + 5 &#39;GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3&#39; BfaI linker-5 &#39;Phos-TAGTCCCTTAAGCGGAG 3&#39;NH2 &quot;&gt; NlaIII bağlayıcı + 5&#39;GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3 &#39; NlaIII linker-5 &#39;-Phos GTCCCTTAAGCGGAGCC 3&#39; Astar Diziler İleri Primer PCR sağ tarafında (NlaIII): Spl IRDR R1 1 GCTTGTGGAAGGCTACTCGAAATGTTTGACCC Spl IRDR L1 1 CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC: Primer PCR ön taraftır (BfaI) sol Sağ ve sol her iki taraf için Birincil PCR ters: Spl Link1 1 GTAATACGACTCACTATAGGGC İkincil PCR sağ ön tarafa: Bir Illumina barkodlu ikincil astar 5 &#39;AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaGgtgtatgtaaacttccgacttcaa Örneği (N adlı 12 bp barkod temsil, büyük harf sırası Illumina platformu için gereklidir, ve küçük harf sırası transpozon bağlanacaktır.) Bir Illumina barkodlu secon Örnek: İkincil PCR ileri sol tarafdary astar 5&#39;AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaAgtgtatgtaaacttccgacttcaa (N adlı 12 bp barkod temsil, büyük harf sırası Illumina platformu için gereklidir, ve küçük harf sırası transpozon bağlanacaktır.) Sağ ve sol her iki taraf için İkincil PCR ters: bağlayıcının iç içe ters primerler 5 &#39;CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC <ol><li> + Tavlama ve - BfaI bağlayıcılara ve NlaII bağlayıcılar her ikisi için bağlayıcı bir ilintileyici (100 uM), 50 ul bağlayıcı ile 50 ul + (100 uM) karıştırılarak ve bir 1.5 ml mikrosantrifüj tüpü içinde 2 ul NaCl (5 M) ilave edilir. 95 5 dak ° C ısıya blok yerleştirin. Isıtma bloğu kapatın ve (bu bir saat veya daha fazla sürer) yavaş yavaş oda sıcaklığına soğumaya bırakın. Gerekinceye kadar soğutulduktan sonra, tavlanmış linkerler bir dondurucuda -20 ° C&#39;de muhafaza edilebilir. </li><li> DNA tümör iki kısım, 1 ug DNA ihtiva eden her bir tablet hazırlanır. Bir kısım zekâ sindirilir olacaktransposonun &quot;doğru&quot; sonuna yakın kesecek ha restriksiyon enzim. İkinci kısım transposonun &quot;sol&quot; sonuna yakın kesen bir kısıtlama enzimi ile sindirilmiş olacaktır. Bu her transpozon insersiyon yükselterek şansını maksimize etmek için yapılır. </li><li> &quot;Sağ&quot; tarafında enzim NlaII kullanarak bir kısım ise tümör DNA sindirimi ve &quot;sol&quot; tarafında enzim BfaI kullanarak diğer kısım ise tümör DNA sindirimi: enzim 1 ul, 5 ul 10x NEB Tampon 4. DNA (birleştir 1 ug) ve 50 ul toplam hacim için GKD 2 O. 37 gecede Digest DNA ° su banyosu veya kuvöz C. </li><li> Enzimleri inaktive ısıtın (BfaI = 80 ° C 20 dakika, NlaIII = 65 ° C, 20 dakika). </li><li> MinElute 96 plaka örnekleri koyarak sindirilmiş örnekler temizleyin, kuyular kadar yaklaşık 15 dakika süreyle vakum manifoldu ve vakum yer plaka kuru gözükmelidir. </li><li> Tüm Liqui çıkarmak için vakum manifoldu ve kağıt havlu ile 96 plaka blot alt plakasını çıkarınd </li><li> Her bir kuyunun 30 ul GKD 2 O ekleyin ve 2 dakika boyunca yüksek orbital çalkalayıcı seti sallamak veya 20 ila 40 kez aşağı yukarı pipetle ve. </li><li> Temiz 96 kuyucuğu içine MinElute 96 plaka kuyularda tüm hacmi (30 ul) aktarın. </li><li> Adım 4.8 ve adım 4,1 linkers gelen sindirilmiş DNA bağlayıcı ligasyon reaksiyonları gerçekleştirin. 10 ul sindirilmiş DNA, 4 ul 5x ligasyon tamponu, 5.5 ul tavlanmış bağlayıcı (950 ug / ul), 0.5 mikrolitre T4 ligaz (5 U / ul) karıştırılır. </li><li> 16 gece boyunca ile 4 saat için inkübe ° C. </li><li> 10 dakika boyunca 65 ° C&#39;de T4 DNA ligaz inaktive ısıtın. </li><li> 4.6 - MinElute 96 kuyucuğu ve gibi adımlar 4,5 açıklandığı bir vakum manifoldu kullanılarak ligasyonu temizleyin. </li><li> 30 ul H 2 O süspanse edin ve temiz bir 96 plaka transfer. </li><li> Concatamer transpozonlar kalan yok etmek için ikinci bir DNA sindirimi gerçekleştirin. Bu plazmid v kesen bir enzimi kullanılarak DNA bir ikinci kesme işlemi ile elde edilirtranspozon concatamer ihtiva eden transjenik farelerin oluşturmak için kullanılan Ector DNA. </li><li> Digest DNA BamHI (hem sağ hem sol tarafında) kullanarak: Mix adım 4.13, 5 ul 10x NEB tampon # 3, 0.5 ul BamHI (20 U / ul), 0.5 ul BSA (den ilintileyiciniz bağlanan DNA 25 ul 10 mg / ml ) ve 19 ul GKD 2 O. </li><li> 37 Digest 3-6 saat veya gece boyunca ° C. </li><li> Linker için transpozon ve astar özel için özel bir astar kullanılarak primer PCR gerçekleştirin. Bunlar kullandığınız ne transpozon ve linker bağlı olarak değişiklik gösterecektir. Primerler T2/Onc ve T2/Onc2 transpozonlar çalışma yukarıdaki astar tabloda listelenmiştir. </li><li> Birincil PCR: 5 ul 10x tampon, 2.0 ul MgCl2 (50 mM), 4 ul dNTP (2.5 nM), 1 ul Primer 1 (20 uM), 1 ul Primer 2 (20 uM), 0.25 ul Taq Platin (5 U / ) ul, linkers 3 ul Sindirilmiş DNA (miktarı değişebilir), en fazla 50 ul GKD 2 O. </li><li> PCR Programı: 94 ° C de 5 dakika, 94 30 döngüleri ° C için 30 sn, 60 ve dörneğin, 30 saniye için C, 90 sn için 72 ° C&#39;dir. 72 Final uzantısı ° C de 5 dakika. </li><li> MinElute 96 oyuklu plakalar ve yukarıda tarif edildiği gibi bir vakum manifoldu kullanılarak PCR ürünü temizleyin. </li><li> 30 ul H 2 O süspanse edin ve temiz bir 96 plaka transfer. </li><li> 148 ul GKD 2 O içine adım 4.21 DNA 2 ul seyreltilmesi ile 1 bir 1:75 seyreltme ° PCR Yap </li><li> Ayrıca Illumina GAIIx makine hem de (bu primerler ile ilgili örnekler için yukarıda astar tabloya bakınız) işlenmiş her bir tümör numune için eşsiz olan bir 12 baz çifti barkod için gerekli dizisine sahip primerlerin iç içe versiyonları ile ikincil PCR gerçekleştirin. </li><li> İkincil PCR: MgCl2 10 ul 10x Tampon, 8 ul dNTP (2.5 mM), 1 ul Illumina ikincil astar (20 uM), 1 ul Illumina Nest 1 ikincil astar (20 uM), 0.25 ul FastStart Taq (barkodlu 5 U / ul ), primer PCR seyreltilmiş 1:75 2 ul DNA, 100 ul GKD 2 O. </li><li> PCR Programı: 94 °, 2 dakika için C, 90 sn için 45 saniye, 72 ° C&#39;de 30 saniye, 53 ° C de 94 ° C arasında 30 devir. 72 Final uzantısı ° C de 5 dakika. </li><li> Etidiyum bromid (0.5 ug / ml) ihtiva eden bir% 1 agaroz jeli üzerinde Bu PCR reaksiyonu 45 ul çalıştırın. Tümör içinde birçok farklı transpozon ekleme (Şekil 3) arasında amplikonlar temsil eden PCR ürünleri bir &quot;smear&quot; olmalıdır. </li><li> MinElute 96 oyuklu plakalar ve yukarıda tarif edildiği gibi bir vakum manifoldu kullanılarak PCR ürünü kalan 50 ul temizleyin. Kuyularda 50 ul GKD 2 O yerleştirerek tekrar vakumlama tarafından bir kez yıkayın. </li><li> 30 ul TE süspanse edin ve temiz bir 96 plaka transfer. </li><li> Her örnek DNA&#39;nın konsantrasyonu tayin edilir. Tek bir 1.5 ml mikrofuge&#39;de tüp DNA eşit miktarda karıştırın. Bu, bir Illumina HiSeq 2000 makine, tek bir şerit halinde sıralı kütüphane olacaktır. Bir Illumina çalışma tek bir şeritte sıra birkaç yüz tümörlerin mümkündür. </li><li> Sunmaksıralama için tüm tümörlerin DNA eşit miktarlarda içeren tek tüp. Bu, kurum ya da ticari olarak yapılabilir. </li></ol> 5. Eklemeler Transposon analizi <ol><li> Transpozon ekleme verileri analiz etmek için yazılım SourceForge (üzerinden ücretsiz indirmek için kullanılabilir <a href="http://sourceforge.net/projects/tapdancebio/" target="_blank">http://sourceforge.net/projects/tapdancebio/</a> ). TapDance adlandırılan program, Illumina platformu ve kütüphane haritası metin dosyasına bir barkod gelen sıra dosyası gerektirir. </li></ol>

<ol>
	<li>Fearon, E. R., Vogelstein, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+model+for+colorectal+tumorigenesis.">A genetic model for colorectal tumorigenesis.</a> Cell. 61, 759-767 (1990).</li><li>Wood, L. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Genomic+Landscapes+of+Human+Breast+and+Colorectal+Cancers.">The Genomic Landscapes of Human Breast and Colorectal Cancers.</a> Science. 318, 1108-1113 (2007).</li><li>Ivics, Z., Hackett, P. B., Plasterk, R. H., Izsv&#225;k, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+Reconstruction+of+Sleeping+Beauty,+a+Tc1-like+Transposon+from+Fish,+and+Its+Transposition+in+Human+Cells.">Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells.</a> Cell. 91, 501-510 (1997).</li><li>Starr, T. K., Largaespada, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+gene+discovery+using+the+Sleeping+Beauty+transposon.">Cancer gene discovery using the Sleeping Beauty transposon.</a> Cell Cycle. 4, 1744-1748 (2005).</li><li>Mueller, P. R., Wold, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vivo+Footprinting+of+a+Muscle+Specific+Enhancer+by+Ligation+Mediated+PCR.">In Vivo Footprinting of a Muscle Specific Enhancer by Ligation Mediated PCR.</a> Science. 246, 780-786 (1989).</li><li>Bergemann, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+methods+for+finding+common+insertion+sites+and+co-occurring+common+insertion+sites+in+transposon-+and+virus-based+genetic+screens.">New methods for finding common insertion sites and co-occurring common insertion sites in transposon- and virus-based genetic screens.</a> Nucleic acids research. 40, 3822-3833 (2012).</li><li>Copeland, N. G., Jenkins, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Harnessing+transposons+for+cancer+gene+discovery.">Harnessing transposons for cancer gene discovery.</a> Nature Reviews Cancer. 10, 696-706 (2010).</li><li>Collier, L. S., Carlson, C. M., Ravimohan, S., Dupuy, A. J., Largaespada, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+gene+discovery+in+solid+tumours+using+transposon-based+somatic+mutagenesis+in+the+mouse.">Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse.</a> Nature. 436, 272-276 (2005).</li><li>Starr, T. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transposon-based+genetic+screen+in+mice+identifies+genes+altered+in+colorectal+cancer.">A transposon-based genetic screen in mice identifies genes altered in colorectal cancer.</a> Science. 323, 1747-1750 (2009).</li><li>Keng, V. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conditional+transposon-based+insertional+mutagenesis+screen+for+genes+associated+with+mouse+hepatocellular+carcinoma.">A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma.</a> Nature. 27, 264-274 (2009).</li><li>Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., Jenkins, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+mutagenesis+using+a+highly+mobile+somatic+Sleeping+Beauty+transposon+system.">Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system.</a> Nature. 436, 221-226 (2005).</li></ol>

Yazarlar ifşa etmek başka bir şey var.

Uyuyan güzel transpozon sistemi kullanan bir ileri genetik ekran neden olan kanser mutasyonları tanımlamak için bir yöntem sağlar. Herhangi hazırlayıcı mutasyon ek olarak Cre rekombinaz kontrol etmek için uygun bir promotörün seçerek, SB ekran bilinen belirlemek ve yeni aday genleri kanser olacaktır. Bir SB ekranının başarısı ekranı yaratmak için seçilen fareler üzerinde büyük ölçüde bağlıdır. Transpozon için, farklı kromozomlar 7...

<table border="1"><tbody><tr><td> Reaktif Adı </td><td> Şirket </td><td> Katalog numarası </td><td> Yorumlar (isteğe bağlı) </td></tr><tr><td> Sure-Seal İndüksiyon Odası </td><td> Beyin Ağacı Bilimsel </td><td> EZ-177 </td><td></td></tr><tr><td> Cryovial </td><td> Bioexpress </td><td> C-3355-2 </td><td></td></tr><tr><td> % 10 tamponlu formalin </td><td> Sigma Aldrich </td><td> HT501128-4L </td><td></td></tr><tr><td> Protein Yağış çözümü </td><td> Qiagen </td><td> 158910 </td><td></td></tr><tr><td> Hücre lizis tamponu </td><td> Qiagen </td><td> 158906 </td><td></td></tr><tr><td> Proteinaz K </td><td> Qiagen </td><td> 158920 </td><td></td></tr><tr><td> RNaz A </td><td> Qiagen </td><td> 158924 </td><td></td></tr><tr><td> TE Tampon </td> &lt;td&gt; Promega </td><td> V6232 </td><td></td></tr><tr><td> BfaI </td><td> New England Biolabs </td><td> R0568S </td><td></td></tr><tr><td> NlaIII </td><td> New England Biolabs </td><td> R0125S </td><td></td></tr><tr><td> 96 oyuklu plakalar MinElute </td><td> Qiagen </td><td> 28051 </td><td></td></tr><tr><td> QIAvac 96 Vakum manifoldu </td><td> Qiagen </td><td> 19504 </td><td></td></tr><tr><td> Multi-mikroplak Genie, 120V </td><td> Scientific Industries, Inc </td><td> SI-4000 </td><td></td></tr><tr><td> 5x ligasyon tampon ile T4 DNA ligaz </td><td> Invitrogen </td><td> 15224-041 </td><td></td></tr><tr><td> BamHI </td><td> New England Biolabs </td><td> R0136S </td><td></td></tr><tr><td> 25mM dNTP </td><td> Bioexpress </td><td> C-5014-200 </td><td></td></tr><tr><td> Platinum Taq </td><td> Invitrogen </td><td&gt; 10966-034 </td><td></td></tr><tr><td> FastStart Taq DNA Polimeraz </td><td> Roche </td><td> 12032929001 </td><td></td></tr><tr><td> Agaroz </td><td> Promega </td><td> V3121 </td><td></td></tr><tr><td> TAE Tampon </td><td> Promega </td><td> V4271 </td><td></td></tr><tr><td> TE Tampon </td><td> Promega </td><td> V6232 </td><td></td></tr><tr><td> Etidyum bromür </td><td> Promega </td><td> H5041 </td><td></td></tr></tbody></table>

identification of sleeping beauty transposon insertions in solid tumors using linker-mediated pcr

Insan tümörlerinin genomik, proteomik Transkriptomik ve epigenomic analizler eşleştirilmiş normal dokuya göre her kanser genom içerisindeki anomalilerin binlerce olduğunu göstermektedir. Bu analizlere dayanarak kansere 1 keşfedilmeyen birçok genetik sürücü olmadığını açıktır. Ne yazık ki bu sürücüler doğrudan tümör oluşumuna katkıda bulunmayan genomundaki yolcu anomalilerin çok daha fazla sayıda içinde gizlidir. Kanser genomun bir başka yönü de benzer tümör tipleri içinde hatırı sayılır genetik heterojenlik olmasıdır. Her tümör tümör oluşumu 2 bir selektif avantaj sağlayan farklı mutasyon barındırabilir. Yolcu mutasyonlar arka azaltırken farelerde tarafsız bir ileri genetik ekran Sahne, tümörler oluşturmak ve kendi genetik kompozisyon analiz etmek için araçlar sağlar. Sleeping Beauty (SB) transpozon sistemi böyle bir yöntem 3&#39;tür. SB sistemi mobil v kullanırtransposase enzim tarafından genomu boyunca yerleştirilebilir ectors (transpozonlar). Mutasyonlar, Cre rekombinaz tarafından aktive olan bir koşullu transposase alelinin kullanımı ile belirli bir hücre tipi ile sınırlıdır. Birçok fare hatları belli dokularda bulunduğunu ifade Cre Rekombinaz var. Koşullu transposase alleli (örn. Lox-stop-Lox-SB11) şu satırları birini geçerek, SB sistem sadece ifade Cre Rekombinaz hücreleri aktive edilir. Cre Rekombinaz ÖTV durak kaset olacak ki böylece belirlenmiş hücre tipi olan transpozon mutajenez aktive transposase allel blok ifadesi. Deneysel fareler bir şartlı transposase alel, transpozonlar bir concatamer, ve bir doku-spesifik Cre rekombinaz alleli böylece bir SB ekran transgenik farelerde üç cins üreme ile başlatılır. Bu fareler tümörler şeklinde yaşına kadar izin ve can çekişen hale gelir. Daha sonra fareler bulunmaktadırnekropsi ve genomik DNA tümör izole edilmiştir. Daha sonra, genomik DNA bağlayıcı aracılı-PCR ile yapılmıştır (LM-PCR) bir SB transpozon içeren genomik bir lokus amplifikasyon olarak sonuçlanır. LM-PCR, tek bir tümör 4 transpozon eklemeler içeren genomik lokus yüzlerce temsil farklı amplikonlarının yüzlerce neden olacaktır tek bir tümör üzerinde gerçekleştirildi. Tüm tümörlerde transpozon eklemeleri analiz edilir ve ortak ekleme siteleri (CISs) uygun istatistiksel metodun 5 kullanılarak tanımlanır. BDT içindeki genler onkogenler ve tümör baskılayıcı genler olması kuvvetle muhtemeldir, ve aday kanser genleri kabul edilir. Kanser aday genlerin tanımlanması için SB sistemini kullanmanın avantajları şunlardır: kendi dizisi, 2 bilindiğinden, 1) transpozon kolaylıkla aktarılması hemen hemen herhangi bir hücre tipi yönlendirilir ve 3) transpozon yeteneğine sahip olabilir) genomuna yerleştirilebilir tanıtan hem kazanç ve kayıp fonksiyon-mutasyonlar 6. Following protokolü aday kanser genleri (Şekil 1) tanımlamak için SB transpozon sistemini kullanan bir ileri genetik ekran hazırlamak ve yürütmek açıklamaktadır.

Yetiştirme programı kurulduktan sonra, yetiştiriciler her 19-21 günde bir çöp üretmek gerekir. Çöp boyutu yetiştiriciler ve genetik arka plan yaşına bağlı olarak, 5 ila 12 yavru değişecektir. Ayrıca, çöp genotip ıslahı doğru ve başarılı olduğunu teyit etmek için bir yol olarak Mendel genetiği aşağıda olduğundan emin olun. Deney başarılı olması için, deney hayvanlarında tümör oluşumunda kontrol hayvanlarında tümör oluşumunda önemli ölçüde daha ...

Watch this Scientific Journal Video about Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR at JoVE.com

Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

Tarafsız bir yaklaşım kullanarak karsinogenez bilinmeyen sürücüsü tespit için bir yöntem tarif edilmektedir. Yöntem kullanır<em&gt; Sleeping Beauty</emBelirli dokulara yönelik rastgele bir mutajen olarak&gt; transpozon. Tümör oluşumunu tahrik transpozon insersiyon Genomik haritalama roman onkogenler ve tümör baskılayıcı genler belirler

Tanımlanması<em&gt; Sleeping Beauty</emLinker-aracılı PCR kullanarak Solid Tümörlerde&gt; Transposon Eklemeler

Genomic, proteomic, transcriptomic, and epigenomic analyses of human tumors indicate that there are thousands of anomalies within each cancer genome ...

identification-sleeping-beauty-transposon-insertions-solid-tumors

Research

JoVE Journal

Medicine

Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

14.0K Görüntüleme.  University of Minnesota, Minneapolis. Tarafsız bir yaklaşım kullanarak karsinogenez bilinmeyen sürücüsü tespit için bir yöntem tarif edilmektedir. Yöntem kullanır Sleeping Beauty transpozon. Tümör oluşumunu tahrik transpozon insersiyon Genomik haritalama roman onkogenler ve tümör baskılayıcı genler belirler

Video: Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

Establishment and Propagation of Human Retinoblastoma Tumors in Immune Deficient Mice

Culturing retinoblastoma tumor cells in defined stem cell media gives rise to primary tumorspheres that can be grown and maintained for only a limited time. These cultured tumorspheres may exhibit markedly different cellular phenotypes when compared to the original tumors. Demonstration that cultured cells have the capability of forming new tumors is important to ensure that cultured cells model the biology of the original tumor. 
Here we present a protocol for propagating human retinoblastoma tumors in vivo using Rag2-/- immune deficient mice. Cultured human retinoblastoma tumorspheres of low passage or cells obtained from freshly harvested human retinoblastoma tumors injected directly into the vitreous cavity of murine eyes form tumors within 2-4 weeks. These tumors can be harvested and either further passaged into murine eyes in vivo or grown as tumorspheres in vitro. Propagation has been successfully carried out for at least three passages thus establishing a continuing source of human retinoblastoma tissue for further experimentation. 
Wesley S. Bond and Lalita Wadhwa are co-first authors.

A method is described to propagate human retinoblastoma tumors in mice. Tumor cells are directly injected into the eyes of immune deficient mice. Secondary tumors have been successfully established using both cells directly harvested from human tumors and cultured tumorspheres.

Bağışıklık Eksik Fare Kuruluş ve İnsan Retinoblastom Tümörler yayılımı

Culturing retinoblastoma tumor cells in defined stem cell media gives rise to primary tumorspheres that can be grown and maintained for only a limited ...

Tıp

Evaluation of Nanoparticle Uptake in Tumors in Real Time Using Intravital Imaging

Current technologies for tumor imaging, such as ultrasound, MRI, PET and CT, are unable to yield high-resolution images for the assessment of nanoparticle uptake in tumors at the microscopic level1,2,3, highlighting the utility of a suitable xenograft model in which to perform detailed uptake analyses. Here, we use high-resolution intravital imaging to evaluate nanoparticle uptake in human tumor xenografts in a modified, shell-less chicken embryo model. The chicken embryo model is particularly well-suited for these in vivo analyses because it supports the growth of human tumors, is relatively inexpensive and does not require anesthetization or surgery 4,5. Tumor cells form fully vascularized xenografts within 7 days when implanted into the chorioallantoic membrane (CAM) 6. The resulting tumors are visualized by non-invasive real-time, high-resolution imaging that can be maintained for up to 72 hours with little impact on either the host or tumor systems. Nanoparticles with a wide range of sizes and formulations administered distal to the tumor can be visualized and quantified as they flow through the bloodstream, extravasate from leaky tumor vasculature, and accumulate at the tumor site. We describe here the analysis of nanoparticles derived from Cowpea mosaic virus (CPMV) decorated with near-infrared fluorescent dyes and/or polyethylene glycol polymers (PEG) 7, 8, 9,10,11. Upon intravenous administration, these viral nanoparticles are rapidly internalized by endothelial cells, resulting in global labeling of the vasculature both outside and within the tumor7,12. PEGylation of the viral nanoparticles increases their plasma half-life, extends their time in the circulation, and ultimately enhances their accumulation in tumors via the enhanced permeability and retention (EPR) effect 7, 10,11. The rate and extent of accumulation of nanoparticles in a tumor is measured over time using image analysis software. This technique provides a method to both visualize and quantify nanoparticle dynamics in human tumors.

We present a novel approach to quantify nanoparticle localization in the vasculature of human xenografted tumors using dynamic, real-time intravital imaging in an avian embryo model.

Intravital Görüntüleme Gerçek Zamanlı tümörler Nanopartikül Alımı Değerlendirme

Current technologies for tumor imaging, such as ultrasound, MRI, PET and CT, are unable to yield high-resolution images for the assessment of nanoparticle ...

Heterogeneity Mapping of Protein Expression in Tumors using Quantitative Immunofluorescence

Morphologic heterogeneity within an individual tumor is well-recognized by histopathologists in surgical practice. While this often takes the form of areas of distinct differentiation into recognized histological subtypes, or different pathological grade, often there are more subtle differences in phenotype which defy accurate classification (Figure 1). Ultimately, since morphology is dictated by the underlying molecular phenotype, areas with visible differences are likely to be accompanied by differences in the expression of proteins which orchestrate cellular function and behavior, and therefore, appearance. The significance of visible and invisible (molecular) heterogeneity for prognosis is unknown, but recent evidence suggests that, at least at the genetic level, heterogeneity exists in the primary tumor1,2, and some of these sub-clones give rise to metastatic (and therefore lethal) disease. 
Moreover, some proteins are measured as biomarkers because they are the targets of therapy (for instance ER and HER2 for tamoxifen and trastuzumab (Herceptin), respectively). If these proteins show variable expression within a tumor then therapeutic responses may also be variable. The widely used histopathologic scoring schemes for immunohistochemistry either ignore, or numerically homogenize the quantification of protein expression. Similarly, in destructive techniques, where the tumor samples are homogenized (such as gene expression profiling), quantitative information can be elucidated, but spatial information is lost. Genetic heterogeneity mapping approaches in pancreatic cancer have relied either on generation of a single cell suspension3, or on macrodissection4. A recent study has used quantum dots in order to map morphologic and molecular heterogeneity in prostate cancer tissue5, providing proof of principle that morphology and molecular mapping is feasible, but falling short of quantifying the heterogeneity. Since immunohistochemistry is, at best, only semi-quantitative and subject to intra- and inter-observer bias, more sensitive and quantitative methodologies are required in order to accurately map and quantify tissue heterogeneity in situ.
We have developed and applied an experimental and statistical methodology in order to systematically quantify the heterogeneity of protein expression in whole tissue sections of tumors, based on the Automated QUantitative Analysis (AQUA) system6. Tissue sections are labeled with specific antibodies directed against cytokeratins and targets of interest, coupled to fluorophore-labeled secondary antibodies. Slides are imaged using a whole-slide fluorescence scanner. Images are subdivided into hundreds to thousands of tiles, and each tile is then assigned an AQUA score which is a measure of protein concentration within the epithelial (tumor) component of the tissue. Heatmaps are generated to represent tissue expression of the proteins and a heterogeneity score assigned, using a statistical measure of heterogeneity originally used in ecology, based on the Simpson's biodiversity index7.
To date there have been no attempts to systematically map and quantify this variability in tandem with protein expression, in histological preparations. Here, we illustrate the first use of the method applied to ER and HER2 biomarker expression in ovarian cancer. Using this method paves the way for analyzing heterogeneity as an independent variable in studies of biomarker expression in translational studies, in order to establish the significance of heterogeneity in prognosis and prediction of responses to therapy.

Here we describe a method to quantify molecular heterogeneity in histological sections of tumor material using quantitative immunofluorescence, image analysis, and a statistical measure of heterogeneity. The method is intended for use in clinical biomarker development and analysis.

Kantitatif İmmünofloresan kullanarak Tümörler Protein İfade heterojenite Haritalama

Morphologic heterogeneity within an individual tumor is well-recognized by histopathologists in surgical practice. While this often takes the form of ...

MicroRNA Detection in Prostate Tumors by Quantitative Real-time PCR (qPCR)

MicroRNAs (miRNAs) are single-stranded, 18&#x2013;24 nucleotide long, non-coding RNA molecules. They are involved in virtually every cellular process including development1, apoptosis2, and cell cycle regulation3. MiRNAs are estimated to regulate the expression of 30% to 90% of human genes4 by binding to their target messenger RNAs (mRNAs)5. Widespread dysregulation of miRNAs has been reported in various diseases and cancer subtypes6. Due to their prevalence and unique structure, these small molecules are likely to be the next generation of biomarkers, therapeutic agents and/or targets.
Methods used to investigate miRNA expression include SYBR green I dye- based as well as Taqman-probe based qPCR. If miRNAs are to be effectively used in the clinical setting, it is imperative that their detection in fresh and/or archived clinical samples be accurate, reproducible, and specific. qPCR has been widely used for validating expression of miRNAs in whole genome analyses such as microarray studies7. The samples used in this protocol were from patients who underwent radical prostatectomy for clinically localized prostate cancer; however other tissues and cell lines can be substituted in. Prostate specimens were snap-frozen in liquid nitrogen after resection. Clinical variables and follow-up information for each patient were collected for subsequent analysis8.
Quantification of miRNA levels in prostate tumor samples. The main steps in qPCR analysis of tumors are: Total RNA extraction, cDNA synthesis, and detection of qPCR products using miRNA-specific primers. Total RNA, which includes mRNA, miRNA, and other small RNAs were extracted from specimens using TRIzol reagent. Qiagen's miScript System was used to synthesize cDNA and perform qPCR (Figure 1). Endogenous miRNAs are not polyadenylated, therefore during the reverse transcription process, a poly(A) polymerase polyadenylates the miRNA. The miRNA is used as a template to synthesize cDNA using oligo-dT and Reverse Transcriptase. A universal tag sequence on the 5' end of oligo-dT primers facilitates the amplification of cDNA in the PCR step. PCR product amplification is detected by the level of fluorescence emitted by SYBR Green, a dye which intercalates into double stranded DNA. Specific miRNA primers, along with a Universal Primer that binds to the universal tag sequence will amplify specific miRNA sequences. 
The miScript Primer Assays are available for over a thousand human-specific miRNAs, and hundreds of murine-specific miRNAs. Relative quantification method was used here to quantify the expression of miRNAs. To correct for variability amongst different samples, expression levels of a target miRNA is normalized to the expression levels of a reference gene. The choice of a gene on which to normalize the expression of targets is critical in relative quantification method of analysis. Examples of reference genes typically used in this capacity are the small RNAs RNU6B, RNU44, and RNU48 as they are considered to be stably expressed across most samples. In this protocol, RNU6B is used as the reference gene.

MicroRNA Detection in Prostate Tumors by Quantitative Real-time PCR qPCR

Quantitative Real Time polymerase chain reaction (qPCR) is a rapid and sensitive method to investigate the expression levels of various microRNA (miRNA) molecules in tumor samples. Using this method expression of hundreds of different miRNA molecules can be amplified, quantified, and analyzed from the same cDNA template.

Kantitatif Gerçek-zamanlı PCR (qPCR) tarafından Prostat tümörlerinde mikroRNA Algılama

MicroRNAs (miRNAs) are single-stranded, 18&#x2013;24 nucleotide long, non-coding RNA molecules. They are involved in virtually every cellular process ...

In vitro Organoid Culture of Primary Mouse Colon Tumors

Several human and murine colon cancer cell lines have been established, physiologic integrity of colon tumors such as multiple cell layers, basal-apical polarity, ability to differentiate, and anoikis are not maintained in colon cancer derived cell lines. The present study demonstrates a method for culturing primary mouse colon tumor organoids adapted from Sato T et al. 1, which retains important physiologic features of colon tumors. This method consists of mouse colon tumor tissue collection, adjacent normal colon epithelium dissociation, colon tumor cells digestion into single cells, embedding colon tumor cells into matrigel, and selective culture based on the principle that tumor cells maintain growth on limiting nutrient conditions compared to normal epithelial cells.
The primary tumor organoids if isolated from genetically modified mice provide a very useful system to assess tumor autonomous function of specific genes. Moreover, the tumor organoids are amenable to genetic manipulation by virus meditated gene delivery; therefore signaling pathways involved in the colon tumorigenesis could also be extensively investigated by overexpression or knockdown. Primary tumor organoids culture provides a physiologic relevant and feasible means to study the mechanisms and therapeutic modalities for colon tumorigenesis.

In vitro Organoid Culture of Primary Mouse Colon Tumors

A simple method to establish primary murine colon tumor organoid is described. This method utilizes the feature that colon tumor cells survive and grow into organoids in media containing limited growth factors, whereas normal colon epithelial do not.

Birincil Fare Colon Tümörler in vitro organoid Kültür

Several  human and murine colon cancer cell lines have been established, physiologic  integrity of colon tumors such as multiple cell layers, basal-apical ...

Cerebrospinal Fluid MicroRNA Profiling Using Quantitative Real Time PCR

MicroRNAs (miRNAs) constitute a potent layer of gene regulation by guiding RISC to target sites located on mRNAs and, consequently, by modulating their translational repression. Changes in miRNA expression have been shown to be involved in the development of all major complex diseases. Furthermore, recent findings showed that miRNAs can be secreted to the extracellular environment and enter the bloodstream and other body fluids where they can circulate with high stability. The function of such circulating miRNAs remains largely elusive, but systematic high throughput approaches, such as miRNA profiling arrays, have lead to the identification of miRNA signatures in several pathological conditions, including neurodegenerative disorders and several types of cancers. In this context, the identification of miRNA expression profile in the cerebrospinal fluid, as reported in our recent study, makes miRNAs attractive candidates for biomarker analysis.
There are several tools available for profiling microRNAs, such as microarrays, quantitative real-time PCR (qPCR), and deep sequencing. Here, we describe a sensitive method to profile microRNAs in cerebrospinal fluids by quantitative real-time PCR. We used the Exiqon microRNA ready-to-use PCR human panels I and II V2.R, which allows detection of 742 unique human microRNAs. We performed the arrays in triplicate runs and we processed and analyzed data using the GenEx Professional 5 software.
Using this protocol, we have successfully profiled microRNAs in various types of cell lines and primary cells, CSF, plasma, and formalin-fixed paraffin-embedded tissues.

We describe a protocol of real time PCR to profile microRNAs in the cerebrospinal fluid (CSF). With the exception of RNA extraction protocols, the procedure can be extended to RNA extracted from other body fluids, cultured cells, or tissue specimens.

Kantitatif Real Time PCR kullanarak Beyin Omurilik Sıvısı MicroRNA Profil

MicroRNAs (miRNAs) constitute a potent layer of gene regulation by guiding RISC to target sites located on mRNAs and, consequently, by modulating their ...

In Vivo Optical Imaging of Brain Tumors and Arthritis Using Fluorescent SapC-DOPS Nanovesicles

We describe a multi-angle rotational optical imaging (MAROI) system for in vivo monitoring of physiopathological processes labeled with a fluorescent marker. Mouse models (brain tumor and arthritis) were used to evaluate the usefulness of this method. Saposin C (SapC)-dioleoylphosphatidylserine (DOPS) nanovesicles tagged with CellVue Maroon (CVM) fluorophore were administered intravenously. Animals were then placed in the rotational holder (MARS) of the in vivo imaging system. Images were acquired in 10&#176; steps over 380&#176;. A rectangular&#160;region of interest (ROI) was placed across the full image width at the model disease site. Within the ROI, and for every image, mean fluorescence intensity was computed after background subtraction. In the mouse models studied, the labeled nanovesicles were taken up in both the orthotopic and transgenic brain tumors, and in the arthritic sites (toes and ankles). Curve analysis of the multi angle image ROIs determined the angle with the highest signal. Thus, the optimal angle for imaging each disease site was characterized. The MAROI method applied to imaging of fluorescent compounds is a noninvasive, economical, and precise tool for in vivo quantitative analysis of the disease states in the described mouse models.

In Vivo Optical Imaging of Brain Tumors and Arthritis Using Fluorescent SapC-DOPS Nanovesicles

We describe a multi-angle rotational optical imaging (MAROI) system for in vivo quantitation of a fluorescent marker delivered by saposin C (SapC)-dioleoylphosphatidylserine (DOPS) nanovesicles. Employing mouse models of cancer and arthritis, we demonstrate how the MAROI signal curve analysis can be used for the precise mapping and biological characterization of disease processes.

Floresan SapC-DOPS Nanovesicles kullanma Beyin Tümörleri ve Artrit Vivo Optik Görüntüleme

We describe a multi-angle rotational optical imaging (MAROI) system for in vivo monitoring of physiopathological processes labeled with a fluorescent ...

Quantitative Mass Spectrometric Profiling of Cancer-cell Proteomes Derived From Liquid and Solid Tumors

In-depth analyses of cancer cell proteomes are needed to elucidate oncogenic pathomechanisms, as well as to identify potential drug targets and diagnostic biomarkers. However, methods for quantitative proteomic characterization of patient-derived tumors and in particular their cellular subpopulations are largely lacking. Here we describe an experimental set-up that allows quantitative analysis of proteomes of cancer cell subpopulations derived from either liquid or solid tumors. This is achieved by combining cellular enrichment strategies with quantitative Super-SILAC-based mass spectrometry followed by bioinformatic data analysis. To enrich specific cellular subsets, liquid tumors are first immunophenotyped by flow cytometry followed by FACS-sorting; for solid tumors, laser-capture microdissection is used to purify specific cellular subpopulations. In a second step, proteins are extracted from the purified cells and subsequently combined with a tumor-specific, SILAC-labeled spike-in standard that enables protein quantification. The resulting protein mixture is subjected to either gel electrophoresis or Filter Aided Sample Preparation (FASP) followed by tryptic digestion. Finally, tryptic peptides are analyzed using a hybrid quadrupole-orbitrap mass spectrometer, and the data obtained are processed with bioinformatic software suites including MaxQuant. By means of the workflow presented here, up to 8,000 proteins can be identified and quantified in patient-derived samples, and the resulting protein expression profiles can be compared among patients to identify diagnostic proteomic signatures or potential drug targets.

In-depth analyses of cancer cell proteomes facilitate identification of novel drug targets and diagnostic biomarkers. We describe an experimental workflow for quantitative analysis of (phospho-)proteomes in cancer cell subpopulations derived from liquid and solid tumors. This is achieved by combining cellular enrichment strategies with quantitative Super-SILAC-based mass spectrometry.

Sıvı ve Katı Tümörler Kaynaklanan Kanser hücre Proteomlar Kantitatif Kitle Spektrometrik Profil

In-depth analyses of cancer cell proteomes are needed to elucidate oncogenic pathomechanisms, as well as to identify potential drug targets and diagnostic ...

Spatial Measurements of Perfusion, Interstitial Fluid Pressure and Liposomes Accumulation in Solid Tumors

The heterogeneous intra-tumoral accumulation of liposomes is a critical determinant of their efficacy. Both the chaotic tumor microcirculation and elevated IFP are linked to the heterogeneous intra-tumoral distribution of nanotechnology-based drug delivery systems such as liposomes. In the present study, the relationship between tumor microcirculation, elevated IFP, and accumulation of nanoparticles was investigated through in vivo experimentation. This was accomplished by evaluation of the tumor microcirculation using dynamic contrast enhanced computed tomography (DCE-CT) and measurement of tumor IFP using a novel image-guided robotic needle placement system connected to the micro-CT scanner. The intra-tumoral accumulation of liposomes was determined by CT image-based assessment of a nanoparticle liposomal formulation that stably encapsulate the contrast agent iohexol (CT-liposomes). CT imaging allowed for co-localization of the spatial distribution of tumor hemodynamics, IFP and CT-liposome accumulation in an individual subcutaneous xenograft mouse model of breast cancer. Measurements led to the discovery that perfusion and plasma volume fraction are strong mediators of the intra-tumoral distribution of liposomes. Furthermore, the results suggest that IFP plays an indirect role in mediating liposome distribution through modulating blood flow.

The heterogeneous intra-tumoral accumulation of liposomes has been linked to an abnormal tumor microenvironment. Herein methods are presented to measure tumor microcirculation by perfusion imaging and elevated interstitial fluid pressure (IFP) using an image-guided robotic system. Measurements are compared to the intra-tumoral accumulation of liposomes, determined using volumetric micro-CT imaging.

Perfüzyon Mekansal Ölçümler, Solid Tümörlerde interstisyel sıvı basınç ve lipozomlar Birikim

The heterogeneous intra-tumoral accumulation of liposomes is a critical determinant of their efficacy. Both the chaotic tumor microcirculation and ...

Multicolor 3D Printing of Complex Intracranial Tumors in Neurosurgery

Three-dimensional (3D) printing technologies offer the possibility of visualizing patient-specific pathologies in a physical model of correct dimensions. The model can be used for planning and simulating critical steps of a surgical approach. Therefore, it is important that anatomical structures such as blood vessels inside a tumor can be printed to be colored not only on their surface, but throughout their whole volume. During simulation this allows for the removal of certain parts (e.g., with a high-speed drill) and revealing internally located structures of a different color. Thus, diagnostic information from various imaging modalities (e.g., CT, MRI) can be combined in a single compact and tangible object.
However, preparation and printing of such a fully colored anatomical model remains a difficult task. Therefore, a step-by-step guide is provided, demonstrating the fusion of different cross-sectional imaging data sets, segmentation of anatomical structures, and creation of a virtual model. In a second step the virtual model is printed with volumetrically colored anatomical structures using a plaster-based color 3D binder jetting technique. This method allows highly accurate reproduction of patient-specific anatomy as shown in a series of 3D-printed petrous apex chondrosarcomas. Furthermore, the models created can be cut and drilled, revealing internal structures that allow for simulation of surgical procedures.

The protocol describes the fabrication of fully colored three-dimensional prints of patient-specific, anatomical skull models to be used for surgical simulation. The crucial steps of combining different imaging modalities, image segmentation, three-dimensional model extraction, and production of the prints are explained.

Nöroşirürjide Kompleks İntrakraniyal Tümörlerin Çok Renkli 3D Baskısı

Three-dimensional (3D) printing technologies offer the possibility of visualizing patient-specific pathologies in a physical model of correct dimensions. ...