Yabani-tür (Mavs + / +) ve boşaltma (Mavs - / -) fareler, vahşi tip (Mavs + / +) ve boşaltma (Mavs - / -) MEF&#39;ler nezaketen Dr Zhijian J. Chen (University of tarafından sağlandı Texas Güneybatı Tıp Merkezi) 13.. Bu yayın NIH (R01 ve R01 CA134241 DE021445) ve Amerikan Kanser Derneği (RSG-11-162-01-MPC) hibe ile finanse çalışmalarına dayanmaktadır.

Etik Açıklama: Tüm hayvan çalışma Ulusal Sağlık Enstitüleri Laboratuar Hayvanlarının Bakımı ve Kullanımı Kılavuzu önerilerine sıkı göre altında yapıldı. Protokol Southern California Üniversitesi Kurumsal Hayvan Bakım ve Kullanım Komitesi (IACUC) tarafından onaylanmıştır. 1.. ΓHV68 enfeksiyonlu Farelerde ELISA ile kantitatif gerçek zamanlı PCR ve sitokin salgılaması tarafından Gene Expression <ol><li> Periton boşluğu içine ksilazin ketamine/0.12 mg, 1.5 mg ile enjekte cinsiyeti eşleştirilmiş, 6-8 haftalık C57BL / 6 (B6) litermatını (8-12 fare / grup) anestezi, ve 40 ul içinde 40 PFU γHV68 ile intranazal yoldan inoküle (Dong Feng ve 11 ayrıntılı enfeksiyonu). Farklı zaman noktalarında Enfeksiyondan, servikal dislokasyon CO2 inhalasyon ile farelerin euthanize. </li><li> Ster boyunca sol yanal kesim ile göğüs açınnum ve keskin bir makas ile kaburga kesti. Akciğer dokuları toplayın. </li><li> 500 ul 1,0 mm Zirkonyum / Silika boncuklar içeren steril 1.5 ml vidalı kapaklı tüpler içine akciğer dokusunda (sol lob) yarısını toplayın. Tüp içine soğuk serum içermeyen DMEM içinde 1 ml ilave edilir ve 30 saniye boyunca boncuk dövmenin ile akciğer dokusu homojenize edilmiştir. 2 dakika boyunca buz üzerinde tüpler soğuk ve bir kez bu işlemi tekrarlayın. </li><li> Tüpleri (15,000 x santrifüj 4 ° C&#39;de 10 dakika) için g, süpernatan toplamak ve aşağıda tarif edildiği gibi sitokin üretimi ölçülür. </li><li> Üreticinin talimatlarına uygun olarak ticari olarak temin edilebilen ELISA kitleri kullanılarak sitokin sitokinler ölçün. </li><li> Başka bir boncuk içeren tüp içine akciğer dokusunda (sağ lob) diğer yarısını toplayın ve 1 ml TRIzol ekleyin. Homojenizasyon ve üreticinin talimatlarına uygun olarak aşama 1.3 ve RNA ekstresi tarif edildiği gibi supernatant toplamak. 260 ve 280 nm&#39;de absorbans okumaları alarak RNA konsantrasyonu belirleyin. </li&gt; <li> Total RNA&#39;nın 1 | ig ile cDNA&#39;nın hazırlanması ve üreticinin talimatlarına (toplam 20 ul son hacim olarak) göre ters transkriptazı. DNAz ve RNAse içermeyen su ile cDNA 50 kez seyreltilir ve kantitatif gerçek zamanlı PCR gerçekleştirin. </li><li> Kantitatif gerçek zamanlı PCR makinede programı yapın. Her reaksiyon, GAPDH (primerlerin çalışma konsantrasyonu, her bir primerden 10 uM, 500 nM idi CE) gen spesifik primerler veya kontrol primerleri bir çift, 0.5 ul içeren, SYBR ana karışımı 5 ul ve 4 ul seyreltilmiş cDNA. Antiviral sitokinlerin mRNA transkriptlerinin nispi miktarını belirlemek için ΔΔCt hesaplayın. </li></ol> 2. ELISA ve Mah-PCR ile MEF Hücre Enfeksiyon ve sitokin miktarının <ol><li> Mavs + / + ve Mavs büyütün - / - hücreleri kaplama önce alt konfluent (yaklaşık% 80) yoğunluğuna MEF hücreleri. </li><li> 12-biz içine MEF hücreleri bölmede 100,000 hücre / (hücre yoğunluğu ikinci gününde% 70 civarında olacaktır) ll için plakalar. Sitokin indüksiyonu senkronize etmek ve en üst düzeye çıkarmak için, 5-10 arasında bir enfeksiyon çokluğu (MOI) ile üçlü olarak γHV68 enfeksiyonu yürütmek. </li><li> Virüs uygun miktarda (her bir 1 ml) ihtiva eden DMEM ortamı içinde tam γHV68 süspansiyon hazırlayın. </li><li> Ortamı çıkarın ve MEF hücreleri γHV68 ihtiva eden bir süspansiyon ilave edin. </li><li> , Doku kültürü inkübatörü içinde, plakayı her 30 dakikada bir kaya ve inkübasyon 2 saat bir toplam izin verir. </li><li> , ΓHV68 içeren ortam çıkarmak bir kez PBS ile yıkayın ve taze bitmiş DMEM ile değiştirin. </li><li> Çeşitli zaman 1.5 ml Eppendorf tüpleri içine sonrası enfeksiyon, hasat orta işaret. Soğuk PBS ile hücreleri yıkayın ve sindirim tripsin tarafından enfekte hücreleri toplamak. </li><li> Adım 1.5 &#39;de tarif edildiği gibi bir ortam içinde antiviral sitokinler ölçün. </li><li> , RNA ekstrakte cDNA hazırlamak ve antiviral sitokin gen ekspresyonunu tespit etmek QRT-PCR işlemi gerçekleştirmek1,5-1,7 adımları tarif edildiği gibi. </li></ol> 3. Kararlı Hücre Hatları lentivirüstür üretimi, Enfeksiyon ve Üretimi <ol><li> Bölünmüş 293T hücreleri transfeksiyondan bir gün önce ve hücreler transfeksiyon zamanında ~% 40 ortak akışkanlığa ulaşmaya izin verir. </li><li> Ambalaj plazmid (1.2 pVSV-G ug ve 6 ug pDR8.9 arasında) ve 7.2 PCDH-FLAG-Mavs ya da kalsiyum fosfat çökeltme ile PCDH kontrol ug ile 293T hücreleri 10 cm tabak transfekte. </li><li> Taze tam DMEM ile 6-8 saat sonrası transfeksiyon orta yerine. </li><li> 72 saat post-transfeksiyon anda, 0.22 mikron membran orta ihtiva eden lentivirüs, 15 dakika boyunca 4000 x g&#39;de santrifüj ve filtre toplamak. Lentivirüs titresini arttırmak için, 4 ° C&#39;de 2.5 saat boyunca 110,000 x g&#39;de virüs içeren ortam santrifüj Dikkatle ilgi orta küçük bir hacim içinde viral pelletini. </li><li> Tohum Mavs - / - MEF hücreleri veya diğer nakavt MEF hücreleri bir gün befo~% 30-40 birbirine karıştığında, 6 oyuklu plakalar içerisinde yeniden enfeksiyon. </li><li> 1 ml lentivirüs ve 10 ug / ml &#39;lik nihai bir konsantrasyona kadar polibren ile takviye edilmiş, 2 ml taze tam DMEM ile MEF hücreleri enfekte etmektedir. </li><li> 30 dakika boyunca 30 ° C&#39;de 500 x g&#39;de plaka santrifüj ve bir doku kültürü kuluçka makinesine plaka aktarın. </li><li> Taze tam DMEM ile 6 saat sonrası enfeksiyon orta yerine. </li><li> Bölünmüş MEF 24 saat sonrası enfeksiyon hücreleri ve kararlı bir şekilde ifade eden hücreleri seçin Mavs 48 saat sonrası enfeksiyon 1 ug / ml &#39;lik bir nihai konsantrasyona kadar puromisin ekleyin. </li><li> Puromisin-ihtiva eden ortam içinde MEF hücreleri korumak ve bunlara karşılık gelen antikorlar ile immunoblotting protein ekspresyonu doğrulamak. </li><li> Hücreler, viral enfeksiyon, sitokin gen ifadesi ve Protokol 2 de tarif edildiği gibi salgılama deneyleri için de kullanılabilir. </li></ol>

<ol>
	<li>Akira, S., Uematsu, S., Takeuchi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen+recognition+and+innate+immunity.">Pathogen recognition and innate immunity.</a> Cell. 124, 783-801 (2006).</li><li>Kato, H., Takahasi, K., Fujita, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIG-I-like+receptors:+cytoplasmic+sensors+for+non-self+RNA.">RIG-I-like receptors: cytoplasmic sensors for non-self RNA.</a> Immunol. Rev. 243, 91-98 (2011).</li><li>Kawai, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IPS-1,+an+adaptor+triggering+RIG-I-+and+Mda5-mediated+type+I+interferon+induction.">IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction.</a> Nat. Immunol. 6, 981-988 (2005).</li><li>Seth, R. B., Sun, L., Ea, C. K., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+MAVS,+a+mitochondrial+antiviral+signaling+protein+that+activates+NF-kappaB+and+IRF+3.">Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3.</a> Cell. 122, 669-682 (2005).</li><li>Xu, L. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VISA+is+an+adapter+protein+required+for+virus-triggered+IFN-beta+signaling.">VISA is an adapter protein required for virus-triggered IFN-beta signaling.</a> Mol. Cell. 19, 727-740 (2005).</li><li>Meylan, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardif+is+an+adaptor+protein+in+the+RIG-I+antiviral+pathway+and+is+targeted+by+hepatitis+C+virus.">Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus.</a> Nature. 437, 1167-1172 (2005).</li><li>Speck, S. H., Virgin, H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host+and+viral+genetics+of+chronic+infection:+a+mouse+model+of+gamma-herpesvirus+pathogenesis.">Host and viral genetics of chronic infection: a mouse model of gamma-herpesvirus pathogenesis.</a> Curr. Opin. Microbiol. 2, 403-409 (1999).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma-herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+initiate+lytic+replication.">Murine gamma-herpesvirus 68 hijacks MAVS and IKKbeta to initiate lytic replication.</a> PLoS Pathog. , (2010).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma+herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+abrogate+NFkappaB+activation+and+antiviral+cytokine+production.">Murine gamma herpesvirus 68 hijacks MAVS and IKKbeta to abrogate NFkappaB activation and antiviral cytokine production.</a> PLoS Pathog. 7, (2011).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gammaherpesvirus+68+evades+host+cytokine+production+via+replication+transactivator-induced+RelA+degradation.">Murine gammaherpesvirus 68 evades host cytokine production via replication transactivator-induced RelA degradation.</a> J. Virol. 86, 1930-1941 (2012).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+Host-virus+Interaction+in+Lytic+Replication+of+a+Model+Herpesvirus.">Dissecting Host-virus Interaction in Lytic Replication of a Model Herpesvirus.</a> J. Vis. Exp. , (2011).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor+interacting+protein+kinase-3+determines+cellular+necrotic+response+to+TNF-alpha.">Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha.</a> Cell. 137, 1100-1111 (2009).</li><li>Sun, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+specific+and+essential+role+of+MAVS+in+antiviral+innate+immune+responses.">The specific and essential role of MAVS in antiviral innate immune responses.</a> Immunity. 24, 633-642 (2006).</li></ol>

Yazarlar çıkar çatışması beyan ederim.

Viral bağışıklık kaçırma viral suç ve konak savunmasını 9 arayüz en dinamik ve etkileyici etkileşimleri biridir. Konak doğuştan gelen bağışıklık bileşenlerini sinyal iletimi etkili başlayan ve sadakatle iletilir şekilde yapılandırılmıştır. Kaskadlarını sinyal hiyerarşisini ve düzenleme çizen doğal bağışıklığın bir önde gelen konudur. Burada, sitokin üretiminin viral kaçırma bir doğuştan gelen bağışıklık bileşen, mavs, düzenleyici rolleri belirlemek için b...

Son çalışmalar konak doğuştan gelen bağışıklık yanıtlarını montaj genel sinyal kaskadlarını hatlarıyla. Ayrı bölmeleri içinde ikamet eden, örüntü tanıma reseptörleri (PRR&#39;ler) 1 sinyalizasyon doğuştan bağışıklık tetiklemek için farklı kökenli patojen ilişkili moleküler şekilleri (PAMPs) algılar. Retinoik asit-indüklenmiş gen I (Rig-I) ve melanoma farklılaşma antigen 5 (MDA5) proteinlerinin spesifik yapısal 2 RNA türlerinin, sitosolik sensörleridir. Aktivasyonu üzerine, Rig-I sırayla, aynı zamanda Ikki olarak bilinen IKK (IKKαβγ) ve IKK-ilişkili kinaz (TBK1 ve IKKε, aktive eder, adaptör (ayrıca IPS-1, VISA ve Cardif olarak da bilinir) alt Mavs ile etkileşime ) 3-6 kompleksleri. Aktif Doğuştan gelen bağışıklık kinazlar, transkripsiyon faktörlerinin ve bunların önleyicileri dahil olmak üzere, gen ekspresyonunun önemli regülatörleri, fosforile ve konakçı antiviral genlerin (örneğin IL-6, TNF ve içinde transkripsiyonel aktivasyonu sağlar945;, CCL5 ve IFNβ). Bu sinyal cascades enfeksiyonunun erken safhaları sırasında patojen yayılma sınırlamak için, bir anti-mikrobiyal devlet kurmak etkili iç doğuştan gelen bağışıklık tepkilerini oluşturmaktadır. Murin γHV68 yakın insan onkojenik KSHV ve EBV ile ilgilidir. Böylece, farelerin γHV68 enfeksiyonu in vivo 7 gamma herpes virüs enfeksiyonu bağışıklık tepkisini incelemek için izlenebilir küçük bir hayvan modeli sağlar. ΓHV68 viral enfeksiyon etkinleştirmek için doğuştan gelen bağışıklık sinyalizasyon ev sahipliği hijacks sayede γHV68 kullanarak, bizim laboratuvar karmaşık bir strateji ortaya çıkardı. Bir yandan, γHV68 çoğaltma transaktivatörü (RTA), γHV68 çoğaltma 8 viral transkripsiyon faktörü anahtar fosforile aktif IKKβ yönlendirilmesi ile viral kopyalama aktivasyonunu desteklemek üzere Mavs-IKKβ yolu aktive eder. Öte yandan, IKKβ aracılı fosforilasyonu bozulması ve bir dönem için göreceli hazırlarNFKB aktivasyonunu 9 inates. Bu nedenle, etkili bir anti-viral enfeksiyon γHV68 sitokin üretimini önler. İlginç bir şekilde, γHV68 bir ifade kütüphanesi kullanan bir tarama RelA bozulmasını uyarmak ve NFKB 10 aktivasyonunu ortadan kaldırmak için, bir E3 ligaz gibi RTA tespit edilmiştir. Bu bulgular üst bağışıklık sinyalizasyon olaylar nihai antiviral sitokin üretimini inkâr γHV68 tarafından boyunduruk sayede karmaşık bir bağışıklık kaçırma stratejisi ortaya çıkarmak. Burada in vivo ve ex viv o iki γHV68 ile enfekte edilmiş farelerdeki antiviral sitokin üretimini ölçmek için bir protokolü tarif eder. Protokolde, bundan başka, anti-viral sitokin üretiminin düzenlenmesinde belirli doğuştan gelen bağışıklık moleküllerin fonksiyonu saptar lentiviral transdüksiyon ile nakavt embriyonik fibroblastlar içinde doğal bağışıklık bileşenlerinin &quot;sulandırılmış&quot; ifade araştırmak. Bu protokol, kolayca diğer Viru uyarlanabilirses ve sinyal yolları.

<table border="0" cellpadding="0" cellspacing="0" width="684">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">Mouse CCL5 ELISA kit</td>
			<td style="width:211px;">R&#38;D systems</td>
			<td style="width:223px;"><a href="http://www.rndsystems.com/Products/DY478">DY478</a></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">1.0 mm Zirconia/Silica beads</td>
			<td style="width:211px;">BioSpec Products</td>
			<td style="width:223px;">11079110z</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">TRIzol</td>
			<td style="width:211px;">Invitrogen</td>
			<td style="width:223px;"><a href="http://products.invitrogen.com/ivgn/en/US/adirect/invitrogen?cmd=catProductDetail&amp;productID=15596018">15596-018</a></td>
		</tr>
		<tr height="79">
			<td height="98" rowspan="2" style="height:98px;width:251px;">SuperScript II Reverse Transcriptase</td>
			<td rowspan="2" style="width:211px;">Invitrogen</td>
			<td rowspan="2" style="width:223px;">18064-014</td>
		</tr>
		<tr height="19">
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">CCL5 quantitative real-time PCR primers</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">CCTGCTGCTTTGCCTACCTCTC</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">ACACACTTGGCGGTTCCTTCGA</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

dissecting innate immune signaling in viral evasion of cytokine production

Bir viral enfeksiyona yanıt olarak, ana doğuştan gelen bağışıklık tepkisi antiviral sitokin gen ekspresyonu ve üretimi düzenlemek kadar aktive edilir. Tersine, virüsler hayatta kalma ve çoğalma için konakçı bağışıklık sinyalizasyon kaçmasına ve sömürmek için karmaşık stratejiler gelişmiştir. Viral bağışıklık kaçırma, konak savunması ve viral kaçırma gerektiren, ev sahibi-virüs etkileşimi ayırt etmek en büyüleyici ve dinamik arayüzler biri sağlar. Bu çalışmalar doğal bağışıklık düzenlenmesinde anlayışımızı ilerletmek ve yeni antiviral tedaviler geliştirmek için yol açmıştı. Murin γHV68 murin kemirgenler doğal bir patojendir. Farelerin γHV68 enfeksiyonu in vivo virüs-host etkileşimleri pertürbasyon geçerli değildir ki insan KSHV ve EBV antiviral yanıt incelemek için izlenebilir küçük bir hayvan modeli sağlar. Burada antiviral sitokin üretimini belirlemek için bir protokol açıklar. Bu protokol, diğer vir uyarlanabilirkullanır ve sinyal yolları. Son zamanlarda, γHV68 NFKB aktivasyonu ve antiviral sitokin üretimini ortadan kaldırmak için, mavs ve IKKβ, sitosolik Rig-I ve MDA5 alt akışında önemli bir doğuştan gelen bağışıklık sinyal bileşenleri ele geçirilmesini keşfettiler. Özellikle, γHV68 enfeksiyon IKKβ aktif hale gelir ve bu aktive IKKβ RelA bozulma hızlandırmak için ilişki fosforile eder. Bu nedenle, etkili bir anti-viral γ HV68 sitokin gen ekspresyonunu negating akış yukarı aktive IKKβ ikinci NFKB aktivasyon birbirinden ayrılacak. Bu çalışma memba bağışıklık aktivasyonu hemen aşağı transkripsiyonel aktivasyonu geçersiz ve antiviral sitokin üretimini kaçmasına viral patojen tarafından yakalanan sayede karmaşık bir strateji açığa kavuşturmaktadır.

Üç örnek şekiller γHV68 enfeksiyonlu Mavs akciğerinde sitokin üretimi de dahil olmak üzere, burada gösterilmektedir + / + ve Mavs-/ - / - - γHV68 enfekte Mavs + / + ve Mavs fare, sitokin salgılama ve gen ekspresyon seviyesi MEF&#39;ler ve γHV68-enfekte Mavs sitokin mRNA seviyeleri - / - MEF&#39;ler Mavs ile &quot;yeniden&quot;. Bu örnek deneyler, in vivo olarak anti-viral sitokin üretimini incelemek ve düzenl...

Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

İnsan Kaposi sarkomu ile ilişkili Herpes (KSHV) ve Epstein-Barr virüsü (EBV) ile yakından ilgili olan bir model herpesvirüs, kemirgen gamma herpes virüsü 68 (γ HV68) ile enfekte olan fareler içindeki antiviral sitokin üretimini ölçmek için bir protokolü tarif eder. Genetik olarak modifiye edilmiş olan fare soyları ve fare embriyonik fibroblastlar (MEF&#39;ler) kullanarak, biz antiviral sitokin üretimini in vivo ve ex vivo hem de değerlendirildi. Lentiviral transdüksiyonu ile nakavt embriyonik fibroblastlar içinde doğal bağışıklık bileşenlerinin ifade &quot;yeniden kurgulamak&quot;, daha fazla belirli doğuştan gelen bağışıklık moleküllerin kesin ve diferansiyel antiviral sitokin üretimini düzenler, anahtar sinyal olayları incelemek.

Sitokin Üretimi Viral Evasion Doğuştan Bağışıklık Sinyalizasyonu Diseksiyon

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

dissecting-innate-immune-signaling-viral-evasion-cytokine

Research

JoVE Journal

Immunology and Infection

10.4K Görüntüleme.  Keck School of Medicine, University of Southern California.  İnsan Kaposi sarkomu ile ilişkili Herpes (KSHV) ve Epstein-Barr virüsü (EBV) ile yakından ilgili olan bir model herpesvirüs, kemirgen gamma herpes virüsü 68 (γ HV68) ile enfekte olan fareler içindeki antiviral sitokin üretimini ölçmek için bir protokolü tarif eder. Genetik olarak modifiye edilmiş olan fare soyları ve fare embriyonik fibroblastlar (MEF'ler) kullanar...

Video: Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

Production and Titering of Recombinant Adeno-associated Viral Vectors

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently being tested in human clinical trials. Wild-type AAV is a non-pathogenic member of the parvoviridae family and inherently replication-deficient. The broad transduction profile, low immune response as well as the strong and persistent transgene expression achieved with these vectors has made them a popular and versatile tool for in vitro and in vivo gene delivery. rAAVs can be easily and cheaply produced in the laboratory and, based on their favourable safety profile, are generally given a low safety classification. Here, we describe a method for the production and titering of chimeric rAAVs containing the capsid proteins of both AAV1 and AAV2. The use of these so-called chimeric vectors combines the benefits of both parental serotypes such as high titres stocks (AAV1) and purification by affinity chromatography (AAV2). These AAV serotypes are the best studied of all AAV serotypes, and individually have a broad infectivity pattern. The chimeric vectors described here should have the infectious properties of AAV1 and AAV2 and can thus be expected to infect a large range of tissues, including neurons, skeletal muscle, pancreas, kidney among others. The method described here uses heparin column purification, a method believed to give a higher viral titer and cleaner viral preparation than other purification methods, such as centrifugation through a caesium chloride gradient. Additionally, we describe how these vectors can be quickly and easily titered to give accurate reading of the number of infectious particles produced.

Recombinant adeno-associated virus (rAAVs) vectors are becoming increasingly valuable for in vivo studies in animals. We describe how rAAVs can be produced in the laboratory and how these vectors can be titered to give an accurate reading of the number of infectious particles produced.

Rekombinant Adeno ilişkili Viral Vektörlerin Üretimi ve Titering

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

İmmünoloji ve Enfeksiyon

Quantification of the Respiratory Burst Response as an Indicator of Innate Immune Health in Zebrafish

The phagocyte respiratory burst is part of the innate immune response to pathogen infection and involves the production of reactive oxygen species (ROS). ROS are toxic and function to kill phagocytized microorganisms. In vivo quantification of phagocyte-derived ROS provides information regarding an organism's ability to mount a robust innate immune response. Here we describe a protocol to quantify and compare ROS in whole zebrafish embryos upon chemical induction of the phagocyte respiratory burst. This method makes use of a non-fluorescent compound that becomes fluorescent upon oxidation by ROS. Individual zebrafish embryos are pipetted into the wells of a microplate and incubated in this fluorogenic substrate with or without a chemical inducer of the respiratory burst. Fluorescence in each well is quantified at desired time points using a microplate reader. Fluorescence readings are adjusted to eliminate background fluorescence and then compared using an unpaired t-test. This method allows for comparison of the respiratory burst potential of zebrafish embryos at different developmental stages and in response to experimental manipulations such as protein knockdown, overexpression, or treatment with pharmacological agents. This method can also be used to monitor the respiratory burst response in whole dissected kidneys or cell preparations from kidneys of adult zebrafish and some other fish species. We believe that the relative simplicity and adaptability of this protocol will complement existing protocols and will be of interest to researchers who seek to better understand the innate immune response.

The innate immune response protects organisms against pathogen infection. A critical component of the innate immune response, the phagocyte respiratory burst, generates reactive oxygen species that kill invading microorganisms. We describe a respiratory burst assay that quantifies reactive oxygen species produced when the innate immune response is chemically induced.

Zebra balığı Doğuştan Bağışıklık Sağlık Bir Göstergesi Olarak Solunum Burst Tepki Kantitasyonu

The phagocyte respiratory burst is part of the innate immune response to  pathogen infection and involves the production of reactive oxygen species (ROS). ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Macrophages are key phagocytic innate immune cells. When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the pathogen, produce various cytokines and chemokines to recruit and stimulate other immune cells, and present antigens to stimulate the adaptive immune response. Thus, being able to efficiently manipulate macrophages with techniques such as RNA-interference (RNAi) is critical to our ability to investigate this important innate immune cell. However, macrophages can be technically challenging to transfect and can exhibit inefficient RNAi-induced gene knockdown. In this protocol, we describe methods to efficiently transfect two mouse macrophage cell lines (RAW264.7 and J774A.1) with siRNA using the Amaxa Nucleofector 96-well Shuttle System and describe procedures to maximize the effect of siRNA on gene knockdown. Moreover, the described methods are adapted to work in 96-well format, allowing for medium and high-throughput studies. To demonstrate the utility of this approach, we describe experiments that utilize RNAi to inhibit genes that regulate lipopolysaccharide (LPS)-induced cytokine production.

In this protocol, we describe methods to efficiently transfect murine macrophage cell lines with siRNAs using the Amaxa Nucleofector 96-well Shuttle System, stimulate the macrophages with lipopolysaccharide, and monitor the effects on inflammatory cytokine production.

Fare Makrofagların yılında Doğuştan Bağışıklık Tepkisi Soruşturma RNA girişimi kullanma

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of causing systemic disease in both fish and humans. A better understanding of S. iniae disease pathogenesis requires an appropriate model system. The genetic tractability and the optical transparency of the early developmental stages of zebrafish allow for the generation and non-invasive imaging of transgenic lines with fluorescently tagged immune cells. The adaptive immune system is not fully functional until several weeks post fertilization, but zebrafish larvae have a conserved vertebrate innate immune system with both neutrophils and macrophages. Thus, the generation of a larval infection model allows the study of the specific contribution of innate immunity in controlling S. iniae infection.
The site of microinjection will determine whether an infection is systemic or initially localized. Here, we present our protocols for otic vesicle injection of zebrafish aged 2-3 days post fertilization as well as our techniques for fluorescent confocal imaging of infection. A localized infection site allows observation of initial microbe invasion, recruitment of host cells and dissemination of infection. Our findings using the zebrafish larval model of S. iniae infection indicate that zebrafish can be used to examine the differing contributions of host neutrophils and macrophages in localized bacterial infections. In addition, we describe how photolabeling of immune cells can be used to track individual host cell fate during the course of infection.

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

Here, we present a protocol for the generation and imaging of a localized bacterial infection in the zebrafish otic vesicle.

Bir Zebra balığı Larva Modeli Doğuştan Bağışıklık Tepki Non-invaziv Görüntüleme<em&gt; Streptococcus iniae</em&gt; Enfeksiyon

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of ...

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research is deciphering how these dynamic protein complexes act to integrate signals from multiple sources in order to direct a specific biological response, and how this becomes deregulated in many disease settings. Despite the importance of this key biochemical mechanism, there is a lack of experimental techniques that can facilitate the specific and sensitive deconvolution of these multi-molecular signaling complexes.
Here this shortcoming is addressed through the combination of a protein complementation assay with a conformation-specific nanobody, which we have termed Bimolecular Complementation Affinity Purification (BiCAP). This novel technique facilitates the specific isolation and downstream proteomic characterization of any pair of interacting proteins, to the exclusion of un-complexed individual proteins and complexes formed with competing binding partners. 
The BiCAP technique is adaptable to a wide array of downstream experimental assays, and the high degree of specificity afforded by this technique allows more nuanced investigations into the mechanics of protein complex assembly than is currently possible using standard affinity purification techniques.

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification BiCAP

This manuscript describes the protocol for Bimolecular Complementation Affinity Purification (BiCAP). This novel method facilitates the specific isolation and downstream proteomic characterization of any two interacting proteins, while excluding un-complexed individual proteins as well as complexes formed with competing binding partners.

Bimolecular tamamlayıcı benzeşme arıtma (BiCAP) tarafından parçalanmış çok protein sinyal kompleksleri

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research ...

Single-cell Analysis of Immunophenotype and Cytokine Production in Peripheral Whole Blood via Mass Cytometry

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies in an attempt to understand the precise mechanisms that lead to the breakdown of self-tolerance and subsequent autoimmunity. Approaches thus far have been based on the study of one specific aspect of the immune system (a single or few cell types or cytokines), and do not offer a global assessment of complex autoimmune disease. While patient sera-based studies have afforded important insights into autoimmunity, they do not provide the specific cellular source of the dysregulated cytokines detected. A comprehensive single-cell approach to evaluate cytokine production in multiple immune cell subsets, within the context of &#34;intrinsic&#34; patient-specific plasma circulating factors, is described here. This approach enables monitoring of the patient-specific immune phenotype (surface markers) and function (cytokines), either in its native &#34;intrinsic pathogenic&#34; disease state, or in the presence of therapeutic agents (in vivo or ex vivo).

Here we describe a single-cell proteomic approach to evaluate immune phenotypic and functional (intracellular cytokine induction) alterations in peripheral whole blood samples, analyzed via mass cytometry.

Tek hücreli Immunophenotype ve sitokin üretimde kitle sitometresi ile periferik tam kan analizi

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies ...

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence rates of S. aureus infection climbing annually, there is a demand for additional research in its&#160;pathogenicity. Animal models of infectious disease advance our understanding of the host-pathogen response and lead to the development of effective therapeutics. Neutrophils play a primary role in the innate immune response that controls S. aureus infections by forming an abscess to wall off the infection and facilitate bacterial clearance; the number of neutrophils that infiltrate an S. aureus skin infection often correlates with disease outcome. LysM-EGFP mice, which possess the enhanced green fluorescent protein (EGFP) inserted in the Lysozyme M (LysM) promoter region (expressed primarily by neutrophils), when used in conjunction with in vivo whole animal fluorescence imaging (FLI) provide&#160;a means of quantifying neutrophil emigration noninvasively and longitudinally into wounded skin. When combined with a bioluminescent S. aureus strain and sequential in vivo whole animal bioluminescent imaging (BLI), it is possible to longitudinally monitor both the neutrophil recruitment dynamics and in vivo bacterial burden at the site of infection in anesthetized mice from onset of infection to resolution or death. Mice are more resistant to a number of virulence factors produced by S. aureus that facilitate effective colonization and infection in humans. Immunodeficient mice provide a more sensitive animal model to examine persistent S. aureus infections and the ability of therapeutics to boost innate immune responses. Herein, we characterize responses in LysM-EGFP mice that have been bred to MyD88-deficient mice (LysM-EGFP&#215;MyD88-/- mice) along with wild-type LysM-EGFP mice to investigate S. aureus skin wound infection. Multispectral simultaneous detection enabled study of neutrophil recruitment dynamics by using in vivo FLI, bacterial burden by using in vivo BLI, and wound healing longitudinally and noninvasively over time.

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

An approach is described for real-time detection of the innate immune response to cutaneous wounding and Staphylococcus aureus infection of mice. By comparing LysM-EGFP mice (which possess fluorescent neutrophils) with a LysM-EGFP crossbred immunodeficient mouse strain, we advance our understanding of infection and the development of approaches to combat infection.

Bir fare modeli için değerlendirmek doğuştan gelen bağışıklık yanıtı Staphylococcus aureus enfeksiyon

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence ...

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal host-microbe interactions. It is well established that different commensals exhibit a different potential to stimulate the host intestinal immune system. Such investigations involve vertebrate animals, especially rodents. Since increasing ethical concerns are linked with experiments involving vertebrates, there is a high demand for invertebrate replacements models. 
Here, we provide a Galleria mellonella oral administration model using commensal non-pathogenic bacteria and the possible assessment of the immunogenic potential of commensals on the G. mellonella immune system. We demonstrate that G. mellonella is a useful alternative invertebrate replacement model that allows the analysis of commensals with different immunogenic potential such as Bacteroides vulgatus and Escherichia coli. Interestingly, the bacteria exhibited no killing effect on the larvae, which is similar to mammals. The immune responses of G. mellonella were comparable with vertebrate innate immune responses and involve recognition of the bacteria and production of antimicrobial molecules. We propose that G. mellonella was able to restore previous microbiota balance, which is well known from healthy mammalian individuals. Although providing comparable innate immune responses in both G. mellonella and vertebrates, G. mellonella does not harbor an adaptive immune system. Since the investigated components of the innate immune system are evolutionary conserved, the model allows a prescreening and first analysis of bacterial immunogenic properties.

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

Here, we provide a detailed protocol for an oral administration model using Galleria mellonella larvae and how to characterize induced innate immune responses. Using this protocol, researchers without practical experience will be able to use the G. mellonella force-feeding method.

Bir Galleria mellonella Oral yönetim modeli için Study Commensal-Induced doğuştan gelen bağışıklık yanıtı

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal ...

Isolation of Tonsillar Mononuclear Cells to Study Ex Vivo Innate Immune Responses in a Human Mucosal Lymphoid Tissue

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal immunity, because they can model host-pathogen interactions in the tissue. While isolated cells derived from tissues were the first cell culture model, their use has been neglected because tissue can be hard to obtain. In the present protocol, we explain how to easily process and culture tonsillar mononuclear cells (TMCs) from healthy human tonsils to study innate immune responses upon activation, mimicking viral infection in mucosal tissues. Isolation of TMCs from the tonsils is quick, because the tonsils barely have any epithelium and yield up to billions of all major immune cell types. This method allows detection of cytokine production using several techniques, including immunoassays, qPCR, microscopy, flow cytometry, etc., similar to the use of peripheral mononuclear cells (PBMCs) from blood. Furthermore, TMCs show a higher sensitivity to drug testing than PBMCs, which needs to be considered for future toxicity assays. Thus, ex vivo TMCs cultures are an easy and accessible mucosal model.

In the present protocol, we explain how to easily process and culture tonsillar mononuclear cells from healthy humans undergoing partial surgical tonsillectomy to study innate immune responses upon activation, mimicking viral infection in mucosal tissues.

Bademcikler Mononükleer Hücrelerin İzolasyon Ex Vivo Doğuştan Gelen Bağışıklık Yanıtları Bir İnsan Mukozal Lenfoid Doku Çalışma

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal ...

Microfluidic Co-Culture Models for Dissecting the Immune Response in in vitro Tumor Microenvironments

Complex disease models demand cutting-edge tools able to deliver physiologically and pathologically relevant, actionable insights, and unveil otherwise invisible processes. Advanced cell assays closely mimicking in vivo scenery are establishing themselves as novel ways to visualize and measure the bidirectional tumor-host interplay influencing the progression of cancer. Here we describe two versatile protocols to recreate highly controllable 2D and 3D co-cultures in microdevices, mimicking the complexity of the tumor microenvironment (TME), under natural and therapy-induced immunosurveillance. In section 1, an experimental setting is provided to monitor crosstalk between adherent tumor cells and floating immune populations, by bright field time-lapse microscopy. As an applicative scenario, we analyze the effects of anti-cancer treatments, such as the so-called immunogenic cancer cell death inducers on the recruitment and activation of immune cells. In section 2, 3D tumor-immune microenvironments are assembled in a competitive layout. Differential immune infiltration is monitored by fluorescence snapshots up to 72 h, to evaluate combination therapeutic strategies. In both settings, image processing steps are illustrated to extract a plethora of immune cell parameters (e.g., immune cell migration and interaction, response to therapeutic agents). These simple and powerful methods can be further tailored to simulate the complexity of the TME encompassing the heterogeneity and plasticity of cancer, stromal and immune cells subtypes, as well as their reciprocal interactions as drivers of cancer evolution. The compliance of these rapidly evolving technologies with live-cell high-content imaging can lead to the generation of large informative datasets, bringing forth new challenges. Indeed, the triangle &#39;&#39;co-cultures/microscopy/advanced data analysis&#34; sets the path towards a precise problem parametrization that may assist tailor-made therapeutic protocols. We expect that future integration of cancer-immune on-a-chip with artificial intelligence for high-throughput processing will synergize a large step forward in leveraging the capabilities as predictive and preclinical tools for precision and personalized oncology.

In the age of immunotherapy and single-cell genomic profiling, cancer biology requires novel in vitro and computational tools for investigating the tumor-immune interface in a proper spatiotemporal context. We describe protocols to exploit tumor-immune microfluidic co-cultures in 2D and 3D settings, compatible with dynamic, multiparametric monitoring of cellular functions.

İn vitro tümör mikroortamlarında immün yanıtı diseksiyon için mikroakışkan ko-kültür modelleri

Complex disease models demand cutting-edge tools able to deliver physiologically and pathologically relevant, actionable insights, and unveil otherwise ...