Bu çalışma, Biyomedikal Araştırma Mükemmellik Batı Virginia IDeA Ağı Ulusal Havacılık ve Uzay Dairesi Batı Virginia Uzay Grant Konsorsiyumu (NASA WVSGC), Kistik Fibrozis Vakfı (CFF-YU11G0) ve NIH P20RR016477 ve P20GM103434 tarafından desteklenmiştir. Biz bu çalışma ile teknik yardım için Vonya M. Eisinger teşekkür ederim.

1.. Bakteriyel Suşlarında hazırlanması ve Biparental Konjugasyon <ol><li> E. aşılamak 37 ° C&#39;de gece boyunca bir çalkalama inkübatöründe gentamisin ve yerine 15 ug / ml &#39;si ile desteklenen Luria Broth&#39;ta (LB), 5 ml coli SM10/λpir/pFAC </li><li> P ismi aşılamak aeruginosa ırk LB 5 ml PAO1 ve bir çalkalama inkübatör içinde bir gece boyunca bir yer 42 ° C </li><li> OD gecede kültürlerin 600 ölçmek ve PAO1 ve E. eşit miktarda karıştırın coli pFAC son hacim 1-1.4 ml arasında olduğu şekilde. </li><li> 5 dakika boyunca 6000 x g&#39;de santrifüjleyin karışımı ile gerçekleştirilmektedir. </li><li> Bu arada, konjugasyon için LB plakaları kuru: 10-15 dakika boyunca 37 ° C&#39;de inkübatör içinde açık plakaları bırakın. </li><li> Hücre karışımından süpernatan 50 ul ama çıkarın. </li><li> Tek bir küçük damlacık kuru LB plakası üzerine yüzer ve pipet kalan 50 ul hücre pelletini. </li><li> Dikkatle (impo kuruması için bir davlumbaz plaka koyunRTANT Not:) plaka yayılmış hücreler, bu anlamlı konjugasyon etkinliğini azaltacaktır izin vermeyin. </li><li> Damlacık kuruduktan sonra, LB plaka ters çevirin ve 4-6 saat boyunca 37 ° C&#39;de inkübe edin. </li><li> Hücre karışımı inkübe edilirken, gentamisin, 300 ug / ml &#39;si ile büyük (150 OD x 15 mm) PIA plakaları hazırlar. Kullanmadan önce, 15-20 dakika boyunca 37 ° C&#39;de bir inkübatör içinde yerleştirilerek kalan nemi çıkarmak. </li><li> Hücre karışımının kuluçka tamamlandıktan sonra steril bir aşılama döngü kullanarak hücreleri toplamak ve 1 ml LB ve girdap veya pipet ihtiva eden bir mikrosantrifüj tüpü içinde, iyice karıştırın. </li><li> Büyük PIA levhalar 300 ug / ml gentamisin içeren hücreleri üzerine düzgün biçimde yayılmış. (ÖNEMLİ: vb), 500 ul: 10 ul, Levha 2: 50 ul, Levha 3: 100 ul, Plate 4 Bu adım için, bu örneğin Plate 1 (plakalarını ayırmak için hücre karışımı hacimleri artmaktadır eklemek için en iyi . </li><li> 37 ° C&#39;de gece boyunca inkübe° C. </li></ol> 2. Algılama ve Mucoid Kolonileri İzolasyonu <ol><li> Inkübatör plakaları kaldırmak ve mukoid koloniler için inceleyin. </li><li> Küçük tabaklar PIA ve gentamisin&#39;den 300 ug / ml (OD 100 x 10 mm) üzerine, izolasyonu için tek bir koloni sümüksü ve çizgi izole edin. </li><li> 37 ° C de bir gece inkübe </li><li> Önceki gecede kültüre adımı 2.2 tekrarlayın. </li><li> Tekrar mukoid izolatın stabilitesini belirlemek için 2.2-2.4 adımları iki kere daha. </li><li> Nihai izole aşamasından sonra, tek bir koloni ile sümüksü LB 4,5 ml aşılamak ve 37 ° C&#39;de gece boyunca çalkalayıcıda inkübe </li><li> Ertesi gün, her mükoid mutant için etiket 3. mikrosantrifüj tüpleri. </li><li> Genomik DNA ekstre etme ve transpozon ekleme sitesinin tanımlanması için 2 boruların (Protokol: 3) içine bir gece boyunca kültür iki 1.25 ml&#39;lik numuneler hazırlayın. </li><li> Ayrıca, bir appropriat içine 1 ml gecede kültür pipetleyerek her mukoid mutant arşivi% 10 kaymağı alınmış süt ihtiva eden eşit hacimde ely etiketli cryovial. -86 ° C&#39;de saklayın </li></ol> 3. gDNA sınırlama sindirimi ve ligasyon <ol><li> Istediğiniz yöntemi (örn.. Fenol-kloroform, spin kolon, vb) kullanılarak sümüksü mutanta gDNA ayıklayın. </li><li> GDNA konsantrasyonunu belirlemek, sınırlama endonükleaz SalI 2 ug ile 1 ul bir toplam sindirmek, büyükbaş hayvan serum albümini, Sall enzim tamponu (100 mM NaCl, 50 mM Tris-HCI, 10 mM MgCI2, 5 ul 0.5 ul , 1 mM Dithiothrietol (DTT), oda sıcaklığında pH 7.9), 50 ul toplam hacim elde etmek dH 2 O uygun hacmi. </li><li> 37 ° C de bir gece DNA Digest (Dikkat:. Kısıtlama enzimi verimliliğine bağlı olarak, bir gece boyunca sindirmek için ek bir 1 ul ekleyin ve 1-2 saat boyunca 37 ° C&#39;de inkübe etmek gerekli olabilir Bu, bir gece boyunca özetle ek olarak). </li><li> Dige arındırınHer tercih edilen bir yöntem (örneğin, agaroz jel saflaştırma spin kolonları) ve tamponun 25 ul ile elüte kullanılarak sted DNA. </li><li> ~ 10-20 ng / ul tercih edilen bir konsantrasyon, ligasyon tamponu, 1.5 ul (330 mM Tris-asetat pH 7.5, 660 mM potasyum asetat, 100 mM magnezyum asetat, 5 mM ile saflaştırılmış DNA 11 ul karıştırılması ile sindirilmiş DNA ligate DTT), 100 mM ATP, 1.5 ul, 1 ul DNA ligaz. </li><li> Oda sıcaklığında 15 dakika boyunca inkübe karışımı, ve daha sonra 70 ° C&#39;de 15 dakika boyunca inkübe edilerek enzimi inaktive (Not: daha uzun süre oda sıcaklığında karışımın, ligasyon başarısını arttırabilir.) </li></ol> 4. Ters PCR (RAPD&#39;yi) ve Dizi Analizi <ol><li> Ileri ve geri primerler aşağıdaki ve koşulları termodöngüleme kullanarak ligasyonu ürün üzerinde IPCR gerçekleştirin: -İleri Primer (Gm3OUT): GGGCATACGGGAAGAAGTGA -Ters Primer (Gm5OUT): GACTGCCCTGCTGCGTAACA Termosikler Condiular: 1.. 1 dakika boyunca 94 ° C. 2. 1 dakika boyunca 94 ° C. 3. 2 dakika süreyle 58 ° C. 4. 2 dakika boyunca 72 ° C. 5. 8 dakika boyunca 72 ° C. 6. 10 ° C tutun. Tekrar 34 döngüleri için 2-4. (NOT: AMPLİFİYE RAPD&#39;yi ürünler 4 ° C&#39;de saklanabilir) </li><li> Başarılı RAPD&#39;yi amplifikasyon onaylamak için agaroz jel elektroforezi gerçekleştirin. </li><li> Gm3OUT ve Gm5OUT primerleri kullanılarak RAPD&#39;yi ürün üzerinde sıralama yapmak. Ekleme site ve himar1 yönünü dışarı eşleştirilir. </li></ol>

<ol>
	<li>Govan, J. R., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+pathogenesis+in+cystic+fibrosis:+mucoid+Pseudomonas+aeruginosa+and+Burkholderia+cepacia.">Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia.</a> Microbiol. Rev. 60, 539-574 (1996).</li><li>Chitnis, C. E., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+the+alginate+biosynthetic+gene+cluster+of+Pseudomonas+aeruginosa+shows+evidence+of+an+operonic+structure.">Genetic analysis of the alginate biosynthetic gene cluster of Pseudomonas aeruginosa shows evidence of an operonic structure.</a> Mol. Microbiol. 8, 583-593 (1993).</li><li>Franklin, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pseudomonas+aeruginosa+AlgG+is+a+polymer+level+alginate+C5-mannuronan+epimerase.">Pseudomonas aeruginosa AlgG is a polymer level alginate C5-mannuronan epimerase.</a> J. Bacteriol. 176, 1821-1830 (1994).</li><li>Franklin, M. J., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutant+analysis+and+cellular+localization+of+the+AlgI,+AlgJ,+and+AlgF+proteins+required+for+O+acetylation+of+alginate+in+Pseudomonas+aeruginosa.">Mutant analysis and cellular localization of the AlgI, AlgJ, and AlgF proteins required for O acetylation of alginate in Pseudomonas aeruginosa.</a> J. Bacteriol. 184, 3000-3007 (2002).</li><li>Deretic, V., Gill, J. F., Chakrabarty, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+algD+coding+for+GDPmannose+dehydrogenase+is+transcriptionally+activated+in+mucoid+Pseudomonas+aeruginosa.">Gene algD coding for GDPmannose dehydrogenase is transcriptionally activated in mucoid Pseudomonas aeruginosa.</a> J. Bacteriol. 169, 351-358 (1987).</li><li>Mathee, K., McPherson, C. J., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posttranslational+control+of+the+algT+(algU)-encoded+sigma22+for+expression+of+the+alginate+regulon+in+Pseudomonas+aeruginosa+and+localization+of+its+antagonist+proteins+MucA+and+MucB+(AlgN)..">Posttranslational control of the algT (algU)-encoded sigma22 for expression of the alginate regulon in Pseudomonas aeruginosa and localization of its antagonist proteins MucA and MucB (AlgN)..</a> J. Bacteriol. 179, 3711-3720 (1997).</li><li>Boucher, J. C., Schurr, M. J., Yu, H., Rowen, D. W., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pseudomonas+aeruginosa+in+cystic+fibrosis:+role+of+mucC+in+the+regulation+of+alginate+production+and+stress+sensitivity.">Pseudomonas aeruginosa in cystic fibrosis: role of mucC in the regulation of alginate production and stress sensitivity.</a> Microbiology. 143, 3473-3480 (1997).</li><li>Martin, D. W., Holloway, B. W., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+locus+determining+the+mucoid+status+of+Pseudomonas+aeruginosa:+AlgU+shows+sequence+similarities+with+a+Bacillus+sigma+factor.">Characterization of a locus determining the mucoid status of Pseudomonas aeruginosa: AlgU shows sequence similarities with a Bacillus sigma factor.</a> J. Bacteriol. 175, 1153-1164 (1993).</li><li>Damron, F. H., Goldberg, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteolytic+regulation+of+alginate+overproduction+in+Pseudomonas+aeruginosa.">Proteolytic regulation of alginate overproduction in Pseudomonas aeruginosa.</a> Mol. Microbiol. 84 (4), 595-607 (2012).</li><li>Browne, P., Barret, M., O'Gara, F., Morrissey, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+prediction+of+the+Crc+regulon+identifies+genus-wide+and+species-specific+targets+of+catabolite+repression+control+in+Pseudomonas+bacteria.">Computational prediction of the Crc regulon identifies genus-wide and species-specific targets of catabolite repression control in Pseudomonas bacteria.</a> BMC Microbiol. 10, 300 (2010).</li><li>Damron, F. H., Qiu, D., Yu, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pseudomonas+aeruginosa+sensor+kinase+KinB+negatively+controls+alginate+production+through+AlgW-dependent+MucA+proteolysis.">The Pseudomonas aeruginosa sensor kinase KinB negatively controls alginate production through AlgW-dependent MucA proteolysis.</a> J. Bacteriol. 191, 2285-2295 (2009).</li><li>Damron, F. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Pseudomonas+aeruginosa+regulon+controlled+by+the+sensor+kinase+KinB+and+sigma+factor+RpoN.">Analysis of the Pseudomonas aeruginosa regulon controlled by the sensor kinase KinB and sigma factor RpoN.</a> J. Bacteriol. 194, 1317-1330 (2012).</li><li>Qiu, D., Eisinger, V. M., Rowen, D. W., Yu, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulated+proteolysis+controls+mucoid+conversion+in+Pseudomonas+aeruginosa.">Regulated proteolysis controls mucoid conversion in Pseudomonas aeruginosa.</a> Proc. Natl. Acad. Sci. U.S.A. 104, 8107-8112 (2007).</li><li>Schurr, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Which+bacterial+biofilm+exopolysaccharide+is+preferred,+Psl+or+alginate.">Which bacterial biofilm exopolysaccharide is preferred, Psl or alginate.</a> J. Bacteriol. 195, 1623-1626 (2013).</li><li>Wong, S. M., Mekalanos, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+footprinting+with+mariner-based+transposition+in+Pseudomonas+aeruginosa.">Genetic footprinting with mariner-based transposition in Pseudomonas aeruginosa.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 10191-10196 (2000).</li><li>Lampe, D. J., Akerley, B. J., Rubin, E. J., Mekalanos, J. J., Robertson, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hyperactive+transposase+mutants+of+the+Himar1+mariner+transposon.">Hyperactive transposase mutants of the Himar1 mariner transposon.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 11428-11433 (1999).</li></ol>

Yazar Hongwei D. Yu Baş Bilim Görevlisi ve Progenesis Teknolojileri kurucularından, LLC.

Bu yöntem, bu değişiklikler ile başka Pseudomonas türleri de kullanılabileceğini belirtmek önemlidir: K. inkübe fluorescens ve P. 30 ° C&#39;de putida ve P. 42 ° C &#39;de stutzeri, P. stutzeri gentamisin 150 ug / mL &#39;si ile takviye edilmiş LB levhaları üzerinde kültür olmalıdır; adım 1.11, P. stutzeri hücreler LB 500 ul yerine 1 ml transfer edilmelidir. Ayrıca, bu protokol için iki kritik adımlar vardır. İlk olarak, al?...

Alginat fazla üretmek için fırsatçı, Gram-negatif patojen Pseudomonas aeruginosa yeteneği bir biyofilm kurma yeteneğinde önemli bir faktördür. Alginatm aşırı üretimi genellikle Mukus adlandırılan bir fenotip. Kistik fibroz (CF) ile tutulmuş bireylerin balgam numune sümüksü koloni izolasyonu kronik enfeksiyonun göstergesidir ve doğrudan hastanın sağlığına 1 &#39;de genel bir azalma ile ilişkilidir. Şu anda, bu anlaşılmaktadır P. aljinat düzenleme ve üretimi aeruginosa öncelikle iki operonlar oluşur. Arasında aljinat polimerin sentezi ve ihracat sorumludur (Alga - alg8 - alg44 - algK - alge - algG - algX - algL - Algı - algJ - - algF algD) ilk 12 genleri içeren aljinat bio-sentetik operonu, bir hücre dışı environme için periplazmant 2-5. İkinci operonu alternatif sigma faktörü Algü / T ile başlayan ve Muca, mucB ve mucD devam genlerin bir kümesidir. MucAB-D aljinat üretimi 6-8 negatif düzenleyicileri olarak sınıflandırılır ise Algü / T, pozitif bir düzenleyicisidir. Buna ek olarak, bu tür transkripsiyonel AlgB, AlgQ, Algr ve rpoN olarak düzenleyiciler, yanı sıra, transkripsiyon sonrası katabolik baskı ve kontrol, kinaz aktivitesi (KinB) ve zar içi proteoliz ile post-translasyonel değişikliği, aynı zamanda alginat dahil olmak gösterilmiştir düzenleme 9-14. PFAC olarak bilinen mini himar1 transpozonunun vektör aslında Harvard Tıp Fakültesi&#39;nde 15 Dr Mekalanos &#39;laboratuarda yaratılmış. PFAC plasmidi, iki 27 baz arasında ters çevrilmiş tekrarlar ve ortasında bir gentamisin direnç kaseti (aacC1: 534 bp) ile çevrili bir transpoze edilebilir elemanın oluşur hyperact kodlayan bir genmariner transposaz 16 ve bir gen kodlayan β-laktamaz (bla) (Şekil 1) ive. DQ366300 13: pFAC ve transpoze edilebilir eleman için sekans bilgileri, GenBank erişim numarası mevcuttur. PFAC olarak, ters PCR kullanılarak kromozomal sokma yerinin tanımlanması için kullanılan aacC1 geni arkasındaki bir çoklu klonlama bölgesinin (MCS) bulunmaktadır. Mini himar1 transpozonunda kullanarak önemli bir avantajı belirli bir konak faktörleri aktarılması (mutagenez) için gerekli olmasıdır. Ayrıca, P. genom genelinde bulunan TA dinükleotid ekleme siteleri yüksek bolluk var aeruginosa. Sırasıyla, genomları, örneğin, TA dinükleotid ekleme siteleri PAO1 yılında 94.404 ve 100.229 kez oluşur (6264404 bps, GenBank erişim numarası NC_002516.2) ve PA14 (GenBank erişim numarası NC_008463 6537648 bps). Çünkü genom, mini himar1 TA dinükleotidin bolluğu </em&gt; Transpozon hastalık oluşturma genlerin analizi ve son derece düzenlenir genleri için özellikle uygun olan yüksek yoğunluklu ve rasgele mutagenezi, neden olabilir. Teorik olarak, mini-transpozon himar1 P. genomu içinde herhangi bir gerekli olmayan gen içine entegre olabilir aeruginosa. Bu, PAO1 genomuna açık okuma çerçevesinin başına yaklaşık 18 TA ekleme bölgelerini içerir. Burada, P. Mukus sahip yeni regülatörleri belirlemek için bir mini transpozon himar1 dolayımlı mutagenez kullanılarak bir protokol açıklar aeruginosa. Daha özel olarak, E. biparentally bir mini transpozon içeren himar1 pFAC vektör konjüge nonmucoid prototrofik suşu PAO1 içine coli SM10/λpir. Transpozon genomuna entegre sonra, alıcı suşu Pseudomonas izolasyon agar E büyümesini inhibe eder (PIA) triklosan ihtiva eden kültürlenir coli. Dolayısı ile de, mutantlarının bir kütüphane <em&gt; P. aeruginosa gentamisin ve mukoid fenotip varlığı ile takviye PIA plakası üzerindeki büyüme ile seçilebilir. Gerçek bir transpozon aracılı entegrasyon mutantın genel bir gentamisin dirençli ve karbenisilin duyarlı fenotipe sahip olacaktır, dikkat edin. Bu çalışmada, PAO1 yaklaşık 80,000 sokma mutantlan dört ayrı çekimleri ile izole edilmiştir. Daha sonra sümüksü izolatları için tarandı ve kısıtlayıcı enzim sindirimi, ligasyon ve ters PCR ile ek bölgesine tespit edilmiştir. Bu genom başına ekleme sayısının görmek için bir prob olarak gentamisin direnç kasedi kullanılarak Southern blot analizi yapıldı. Bu protokol kullanılarak konjugasyon başına elde mutantlarının fazla% 90 genomunda himar1 sadece tek bir kopyasına sahip ve gentamisin dirençli ve karbenisilin duyarlı fenotip gösterdiği tespit edilmiştir. 32 sümüksü izolat toplam tespit edilmiştir, bunlardan 22 P. farklı loci eşleştirilmiş aeruginosa PAO1kromozom. Yerleştirme Bu oran aljinat aşırı birkaç yeni regülatörleri tanımlamak için yeterli kapsama alanı sağlar.

<table border="0" cellpadding="0" cellspacing="0" width="780">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="22">
			<td height="22" style="height:22px;width:267px;">Luria Broth</td>
			<td style="width:187px;">Difco</td>
			<td style="width:125px;">240230</td>
			<td style="width:203px;">via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pseudomonas isolation agar</td>
			<td>Difco</td>
			<td>292710</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Small Plates (100 O.D. x 10 mm)</td>
			<td>Fisher Scientific</td>
			<td>08-757-13</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Large Plates (150 O.D. x 15 mm)</td>
			<td>Fisher Scientific</td>
			<td>08-757-14</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glycerol</td>
			<td>Fisher Scientific</td>
			<td>BP229-4</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Benchtop Shaking Incubator</td>
			<td>New Brunswick Scientific</td>
			<td>Innova 4080</td>
			<td>shake at 200 rpm</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cabinet Incubator</td>
			<td>VWR</td>
			<td>1540</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Benchtop Microcentrifuge</td>
			<td>Sorvall</td>
			<td>75-003-287</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SmartSpec Plus Spectrophotometer</td>
			<td>Bio-Rad</td>
			<td>170-2525</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Diposable Inoculation Loops</td>
			<td>Fisher Scientific</td>
			<td>22-363-597</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1.5 mL Microcentrifuge Tubes</td>
			<td>Fisher Scientific</td>
			<td>05-408-129</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2.0 mL Cryogenic Vials</td>
			<td>Corning</td>
			<td>430659</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">15 mL Tubes</td>
			<td>Fisher Scientific</td>
			<td>05-539-12</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Skim Milk</td>
			<td>Difco</td>
			<td>DF0032-17-3</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNeasy Blood and Tissue (250)&#160;</td>
			<td>Qiagen</td>
			<td>69506</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAquick PCR Purification Kit (250)</td>
			<td>Qiagen</td>
			<td>28106</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAprep Spin Miniprep Kit (250)&#160;</td>
			<td>Qiagen</td>
			<td>27106</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastLink II DNA Ligation Kit</td>
			<td>Epicentre Technologies</td>
			<td>LK6201H</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Accu block Digital Dry Bath&#160;</td>
			<td>Labnet</td>
			<td>NC0205808</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sal1, restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0138L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EasyStart Micro 50</td>
			<td>Molecular BioProducts</td>
			<td>6020</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Taq DNA Polymerase</td>
			<td>New England BioLabs</td>
			<td>M0267L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iCycler, Thermocycler</td>
			<td>Bio-Rad</td>
			<td>170-8740</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LE agarose</td>
			<td>Genemate</td>
			<td>3120-500</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gentamycin Sulfate</td>
			<td>Fisher Scientific</td>
			<td>BP918-1</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">2.0 mL Cryogenic Vials</td>
			<td>Corning</td>
			<td>430659</td>
			<td>via Fisher Scientific</td>
		</tr>
	</tbody>
</table>

identification of novel genes associated with alginate production in pseudomonas aeruginosa using mini-himar1 mariner transposon-mediated mutagenesis

Pseudomonas aeruginosa yönlü metabolik yetenekleri olan bir Gram-negatif, çevresel bir bakteridir. P. aeruginosa kistik fibrozis (KF) hastalarda, kronik akciğer enfeksiyonları kuran bir fırsatçı bakteriyel patojendir. Ayrıca Mukus olarak bilinen alginat adlandırılan bir kapsüler polisakarit, bir aşırı antibiyotik kemoterapi ve bir ev sahibi savunma için planktonik hücrelerden daha fazla dirençli olan mukoid biyofilm oluşumunu teşvik eder. Buna ek olarak, sümüksü fenotipine nonmucoid gelen dönüşüm CF kronik enfeksiyonun başlaması için klinik bir belirteçtir. P. Alginate aşırı aeruginosa ağır hücresel enerji vergileri bir endergonic süreçtir. Bu nedenle, aljinat üretimi son derece P. düzenlenir aeruginosa. Alginat düzenleme daha iyi anlamak için, yeni bir aljinat regülatörü tanımlanması için mini-himar1 transposon mutagenez kullanılarak bir protokol açıklarbir prototipi gerginlik PAO1 s. Prosedürü iki temel aşamadan oluşmaktadır. İlk olarak, konakçı E. mini himar1 transpozonunda (pFAC) transfer alıcı P. içine coli SM10/λpir gentamisin ile takviye edilmiş Pseudomonas izolasyon agar levhaları üzerinde seçilmiştir, yüksek yoğunluklu bir ekleme mutant kütüphanesi oluşturmak için biparental konjügasyon yoluyla aeruginosa PAO1. İkincisi, biz ekranlı ve gentamisin kaset ve DNA dizilimi dışa dönük DNA primerleri kullanılarak ters PCR yoluyla ekleme sitesi haritasına mukoid koloniler izole. Bu protokolü kullanarak, (22 σ AlgT,) bir vahşi tip muca ana aljinat regülatör Algü için anti-sigma faktörü muca kodlayan ile gerginlik PAO1 iki roman aljinat regülatörleri, muce (PA4033) ve kinB (PA5484) belirledik . Bu, yüksek verimli mutajenez protokolü Colo değişime neden olan diğer hastalık oluşturma ilişkili genlerin tanımlanması için değiştirilebilirny morfolojisi.

Şekil 1 &#39;de gösterildiği gibi, mini-transpozon himar1 mariner vektörü, pFAC, TA yerleştirme siteleri ile σ 70 bağımlı promoteri ve bir çok klonlama bölgesinin (MCS) ile aacC1 gentamisin direnç kasedi komşu olan iki 27 bp ters çevrilmiş tekrar içerir. Buna ek olarak, vektör pFAC yüksek ölçüde aktif himar1 transposaz, β-laktamaz (bla) ve tra aktarma operon&#39;u şifreleyen genleri içerir. TA yerleştirme siteleri P.</...

Watch this Scientific Journal Video about Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis at JoVE.

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Burada, ekrana yüksek yoğunluklu ekleme mutant kütüphanesi oluşturmak için mini-transpozon himar1 mariner dolayımlı mutagenez kullanılarak bir protokol açıklar izole edilmesi ve prototipik Pseudomonas aeruginosa&#39;nın PAO1 in yeni alginat regülatörleri belirlemek.

Alginat içinde üretimi ile ilişkili yeni genlerin tanımlanması<em&gt; Pseudomonas aeruginosa</emKullanma&gt; Mini-<em&gt; Himar1</em&gt; Mariner Transposon dolayımlı mutagenez

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial ...

identification-novel-genes-associated-with-alginate-production

Research

JoVE Journal

Immunology and Infection

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

12.2K Görüntüleme.  Marshall University.  Burada, ekrana yüksek yoğunluklu ekleme mutant kütüphanesi oluşturmak için mini-transpozon himar1 mariner dolayımlı mutagenez kullanılarak bir protokol açıklar izole edilmesi ve prototipik Pseudomonas aeruginosa'nın PAO1 in yeni alginat regülatörleri belirlemek. 

Video: Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Co-culture Models of Pseudomonas aeruginosa Biofilms Grown on Live Human Airway Cells

Bacterial biofilms have been associated with a number of different human diseases, but biofilm development has generally been studied on non-living surfaces. In this paper, we describe protocols for forming Pseudomonas aeruginosa biofilms on human airway epithelial cells (CFBE cells) grown in culture. In the first method (termed the Static Co-culture Biofilm Model), P. aeruginosa is incubated with CFBE cells grown as confluent monolayers on standard tissue culture plates. Although the bacterium is quite toxic to epithelial cells, the addition of arginine delays the destruction of the monolayer long enough for biofilms to form on the CFBE cells. The second method (termed the Flow Cell Co-culture Biofilm Model), involves adaptation of a biofilm flow cell apparatus, which is often used in biofilm research, to accommodate a glass coverslip supporting a confluent monolayer of CFBE cells. This monolayer is inoculated with P. aeruginosa and a peristaltic pump then flows fresh medium across the cells. In both systems, bacterial biofilms form within 6-8 hours after inoculation. Visualization of the biofilm is enhanced by the use of P. aeruginosa strains constitutively expressing green fluorescent protein (GFP). The Static and Flow Cell Co-culture Biofilm assays are model systems for early P. aeruginosa infection of the Cystic Fibrosis (CF) lung, and these techniques allow different aspects of P. aeruginosa biofilm formation and virulence to be studied, including biofilm cytotoxicity, measurement of biofilm CFU, and staining and visualizing the biofilm.

Co-culture Models of Pseudomonas aeruginosa Biofilms Grown on Live Human Airway Cells

This paper describes different methods of growing Pseudomonas aeruginosa biofilms on cultured human airway epithelial cells. These protocols can be adapted to study different aspects of biofilm formation, including visualization of the biofilm, staining of the biofilm, measuring the colony forming units (CFU) of the biofilm, and studying biofilm cytotoxicity.

Co-kültür Modelleri Pseudomonas aeruginosa</emCanlı İnsan Havayolu Hücreler Yetiştirilen> Biyofilmler

Bacterial biofilms have been associated with a number of different human diseases, but biofilm development has generally been studied on non-living ...

İmmünoloji ve Enfeksiyon

Transfection and Mutagenesis of Target Genes in Mosquito Cells by Locked Nucleic Acid-modified Oligonucleotides

Plasmodium parasites, the causative agent of malaria, are transmitted through the bites of infected Anopheles mosquitoes resulting in over 250 million new infections each year. Despite decades of research, there is still no vaccine against malaria, highlighting the need for novel control strategies. One innovative approach is the use of genetically modified mosquitoes to effectively control malaria parasite transmission. Deliberate alterations of cell signaling pathways in the mosquito, via targeted mutagenesis, have been found to regulate parasite development 1. From these studies, we can begin to identify potential gene targets for transformation. Targeted mutagenesis has traditionally relied upon the homologous recombination between a target gene and a large DNA molecule. However, the construction and use of such complex DNA molecules for generation of stably transformed cell lines is costly, time consuming and often inefficient. Therefore, a strategy using locked nucleic acid-modified oligonucleotides (LNA-ONs) provides a useful alternative for introducing artificial single nucleotide substitutions into episomal and chromosomal DNA gene targets (reviewed in 2). LNA-ON-mediated targeted mutagenesis has been used to introduce point mutations into genes of interest in cultured cells of both yeast and mice 3,4. We show here that LNA-ONs can be used to introduce a single nucleotide change in a transfected episomal target that results in a switch from blue fluorescent protein (BFP) expression to green fluorescent protein (GFP) expression in both Anopheles gambiae and Anopheles stephensi cells. This conversion demonstrates for the first time that effective mutagenesis of target genes in mosquito cells can be mediated by LNA-ONs and suggests that this technique may be applicable to mutagenesis of chromosomal targets in vitro and in vivo.

Oligonucleotides can be used to site specifically substitute a single nucleotide of transfected target genes in both Anopheles gambiae and Anopheles stephensi cells.

Kilitli Nükleik Asit modifiye Oligonükleotidler Transfeksiyon ve Sivrisinek Hücreler Hedef Genler Mutagenez

Plasmodium parasites, the causative agent of malaria, are transmitted through the bites of infected Anopheles mosquitoes resulting in over 250 million new ...

Pseudomonas aeruginosa and Saccharomyces cerevisiae Biofilm in Flow Cells

Many microbial cells have the ability to form sessile microbial communities defined as biofilms that have altered physiological and pathological properties compared to free living microorganisms. Biofilms in nature are often difficult to investigate and reside under poorly defined conditions1. Using a transparent substratum it is possible to device a system where simple biofilms can be examined in a non-destructive way in real-time: here we demonstrate the assembly and operation of a flow cell model system, for in vitro 3D studies of microbial biofilms generating high reproducibility under well-defined conditions2,3.
The system consists of a flow cell that serves as growth chamber for the biofilm. The flow cell is supplied with nutrients and oxygen from a medium flask via a peristaltic pump and spent medium is collected in a waste container. This construction of the flow system allows a continuous supply of nutrients and administration of e.g. antibiotics with minimal disturbance of the cells grown in the flow chamber. Moreover, the flow conditions within the flow cell allow studies of biofilm exposed to shear stress. A bubble trapping device confines air bubbles from the tubing which otherwise could disrupt the biofilm structure in the flow cell.
The flow cell system is compatible with Confocal Laser Scanning Microscopy (CLSM) and can thereby provide highly detailed 3D information about developing microbial biofilms. Cells in the biofilm can be labeled with fluorescent probes or proteins compatible with CLSM analysis. This enables online visualization and allows investigation of niches in the developing biofilm. Microbial interrelationship, investigation of antimicrobial agents or the expression of specific genes, are of the many experimental setups that can be investigated in the flow cell system.

Pseudomonas aeruginosa and Saccharomyces cerevisiae Biofilm in Flow Cells

Protocol describing the application of a flow cell system for growing and analyzing microbial biofilms for Confocal Laser Scanning Microscopy (CLSM).

Pseudomonas aeruginosa ve Saccharomyces cerevisiae Biyofilm Akış Hücreler

Many microbial cells have the ability to form sessile microbial communities defined as biofilms that have altered physiological and pathological ...

RNA Isolation of Pseudomonas aeruginosa Colonizing the Murine Gastrointestinal Tract

Pseudomonas aeruginosa (PA) infections result in significant morbidity and mortality in hosts with compromised immune systems, such as patients with leukemia, severe burn wounds, or organ transplants1. In patients at high-risk for developing PA bloodstream infections, the gastrointestinal (GI) tract is the main reservoir for colonization2, but the mechanisms by which PA transitions from an asymptomatic colonizing microbe to an invasive, and often deadly, pathogen are unclear. Previously, we performed in vivo transcription profiling experiments by recovering PA mRNA from bacterial cells residing in the cecums of colonized mice 3 in order to identify changes in bacterial gene expression during alterations to the host&#x2019;s immune status.
As with any transcription profiling experiment, the rate-limiting step is in the isolation of sufficient amounts of high quality mRNA. Given the abundance of enzymes, debris, food residues, and particulate matter in the GI tract, the challenge of RNA isolation is daunting. Here, we present a method for reliable and reproducible isolation of bacterial RNA recovered from the murine GI tract. This method utilizes a well-established murine model of PA GI colonization and neutropenia-induced dissemination4. Once GI colonization with PA is confirmed, mice are euthanized and cecal contents are recovered and flash frozen. RNA is then extracted using a combination of mechanical disruption, boiling, phenol/chloroform extractions, DNase treatment, and affinity chromatography. Quantity and purity are confirmed by spectrophotometry (Nanodrop Technologies) and bioanalyzer (Agilent Technologies) (Fig 1). This method of GI microbial RNA isolation can easily be adapted to other bacteria and fungi as well.

RNA Isolation of Pseudomonas aeruginosa Colonizing the Murine Gastrointestinal Tract

A reliable method for the RNA isolation of Pseudomonas aeruginosa recovered from murine cecums is described. The RNA recovered is of sufficient quantity and quality for subsequent qPCR, transcription profiling, and RNA Seq experiments. This technique can be adapted for RNA isolation of other intestinal microbes.

RNA İzolasyonu Pseudomonas aeruginosa Murin Gastrointestinal Yolu koloniler

Pseudomonas aeruginosa (PA) infections result in significant morbidity and mortality in hosts with compromised immune systems, such as patients with ...

Use of Artificial Sputum Medium to Test Antibiotic Efficacy Against Pseudomonas aeruginosa in Conditions More Relevant to the Cystic Fibrosis Lung

There is growing concern about the relevance of in vitro antimicrobial susceptibility tests when applied to isolates of P. aeruginosa from cystic fibrosis (CF) patients. Existing methods rely on single or a few isolates grown aerobically and planktonically. Predetermined cut-offs are used to define whether the bacteria are sensitive or resistant to any given antibiotic1. However, during chronic lung infections in CF, P. aeruginosa populations exist in biofilms and there is evidence that the environment is largely microaerophilic2. The stark difference in conditions between bacteria in the lung and those during diagnostic testing has called into question the reliability and even relevance of these tests3.
 Artificial sputum medium (ASM) is a culture medium containing the components of CF patient sputum, including amino acids, mucin and free DNA. P. aeruginosa growth in ASM mimics growth during CF infections, with the formation of self-aggregating biofilm structures and population divergence4,5,6. The aim of this study was to develop a microtitre-plate assay to study antimicrobial susceptibility of P. aeruginosa based on growth in ASM, which is applicable to both microaerophilic and aerobic conditions.
 An ASM assay was developed in a microtitre plate format. P. aeruginosa biofilms were allowed to develop for 3 days prior to incubation with antimicrobial agents at different concentrations for 24 hours. After biofilm disruption, cell viability was measured by staining with resazurin. This assay was used to ascertain the sessile cell minimum inhibitory concentration (SMIC) of tobramycin for 15 different P. aeruginosa isolates under aerobic and microaerophilic conditions and SMIC values were compared to those obtained with standard broth growth. Whilst there was some evidence for increased MIC values for isolates grown in ASM when compared to their planktonic counterparts, the biggest differences were found with bacteria tested in microaerophilic conditions, which showed a much increased resistance up to a &gt;128 fold, towards tobramycin in the ASM system when compared to assays carried out in aerobic conditions.
 The lack of association between current susceptibility testing methods and clinical outcome has questioned the validity of current methods3. Several in vitro models have been used previously to study P. aeruginosa biofilms7, 8. However, these methods rely on surface attached biofilms, whereas the ASM biofilms resemble those observed in the CF lung9 . In addition, reduced oxygen concentration in the mucus has been shown to alter the behavior of P. aeruginosa2 and affect antibiotic susceptibility10. Therefore using ASM under microaerophilic conditions may provide a more realistic environment in which to study antimicrobial susceptibility.

Use of Artificial Sputum Medium to Test Antibiotic Efficacy Against Pseudomonas aeruginosa in Conditions More Relevant to the Cystic Fibrosis Lung

Current diagnostic antimicrobial susceptibility testing relies on the planktonic growth of isolates in nutrient rich, aerobic conditions. Here, we employ an alternative artificial sputum medium to study antimicrobial susceptibility of Pseudomonas aeruginosa biofilms under both aerobic and microaerophilic conditions more representative of the cystic fibrosis lung.

Karşı Antibiyotik Etkinlik Test Yapay Balgam Orta Kullanımı<em&gt; Pseudomonas aeruginosa</em&gt; Kistik Fibrozis Akciğer Daha İlgili Koşullar

There  is growing concern about the relevance of in vitro antimicrobial  susceptibility tests when applied to isolates of P. aeruginosa from  cystic ...

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model itself. Early phases of inflammation and infection have been widely studied by using the Pseudomonas aeruginosa agar-beads mouse model, while only few reports have focused on the long-term chronic infection in vivo. The main challenge for long term chronic infection remains the low bacterial burden by P. aeruginosa and the low percentage of infected mice weeks after challenge, indicating that bacterial cells are progressively cleared by the host.
This paper presents a method for obtaining efficient long-term chronic infection in mice. This method is based on the embedding of the P. aeruginosa clinical strains in the agar-beads in vitro, followed by intratracheal instillation in C57Bl/6NCrl mice. Bilateral lung infection is associated with several measurable read-outs including weight loss, mortality, chronic infection, and inflammatory response. The P. aeruginosa RP73 clinical strain was preferred over the PAO1 reference laboratory strain since it resulted in a comparatively lower mortality, more severe lesions, and higher chronic infection. P. aeruginosa colonization may persist in the lung for over three months. Murine lung pathology resembles that of CF patients with advanced chronic pulmonary disease.
This murine model most closely mimics the course of the human disease and can be used both for studies on the pathogenesis and for the evaluation of novel therapies.

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

We describe the agar-beads method to establish persistent long-term chronic Pseudomonas aeruginosa airway infection in the mouse model.

Uzun Vadeli Kronik<em&gt; Pseudomonas aeruginosa</emFarelerde&gt; Havayolu Enfeksiyon

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model ...

Pseudomonas aeruginosa Induced Lung Injury Model

In order to study human acute lung injury and pneumonia, it is important to develop animal models to mimic various pathological features of this disease. Here we have developed a mouse lung injury model by intra-tracheal injection of bacteria Pseudomonas aeruginosa (P. aeruginosa or PA). Using this model, we were able to show lung inflammation at the early phase of injury. In addition, alveolar epithelial barrier leakiness was observed by analyzing bronchoalveolar lavage (BAL); and alveolar cell death was observed by Tunel assay using tissue prepared from injured lungs. At a later phase following injury, we observed cell proliferation required for the repair process. The injury was resolved 7 days from the initiation of P. aeruginosa injection. This model mimics the sequential course of lung inflammation, injury and repair during pneumonia. This clinically relevant animal model is suitable for studying pathology, mechanism of repair, following acute lung injury, and also can be used to test potential therapeutic agents for this disease.

Pseudomonas aeruginosa Induced Lung Injury Model

We have developed a mouse lung injury model by intra-tracheal injection of bacteria Pseudomonas aeruginosa. This model mimics lung injury during pneumonia and is clinically relevant.

Pseudomonas aeruginosa Kaynaklı Akciğer Hasarı Modeli

In order to study human acute lung injury and pneumonia, it is important to develop animal models to mimic various pathological features of this disease. ...

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa is able to form biofilms, develop antibiotic resistance, produce virulence factors, and rapidly evolve in the course of a chronic infection. Thus P. aeruginosa can cause both acute and chronic, difficult to treat infections, resulting in significant morbidity in certain patient populations. P. aeruginosa strain PA14 is a human clinical isolate with a conserved genome structure that infects a variety of mammalian and nonvertebrate hosts making PA14 an attractive strain for studying this pathogen. In 2006, a nonredundant transposon insertion mutant library containing 5,459 mutants corresponding to 4,596 predicted PA14 genes was generated. Since then, distribution of the PA14 library has allowed the research community to better understand the function of individual genes and complex pathways of P. aeruginosa. Maintenance of library integrity through the replication process requires proper handling and precise techniques. To that end, this manuscript presents protocols that describe in detail the steps involved in library replication, library quality control and proper storage of individual mutants.

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa infection causes significant morbidity in vulnerable hosts. The nonredundant transposon insertion mutant library of P. aeruginosa strain PA14, designated as PA14NR Set, facilitates analysis of gene functionality in numerous processes. Presented here is a protocol to generate high-quality copies of the PA14NR Set mutant library.

Sipariş edilmiş, Pseudomonas aeruginosa baskı PA14 Transposon ekleme mutantlar Nonredundant Kütüphane çoğaltılması

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...

Methods for Detecting Cytotoxic Amyloids Following Infection of Pulmonary Endothelial Cells by Pseudomonas aeruginosa

Patients who survive pneumonia have elevated death rates in the months following hospital discharge. It has been hypothesized that infection of pulmonary tissue during pneumonia results in the production of long-lived cytotoxins that can lead to subsequent end organ failure. We have developed in vitro assays to test the hypothesis that cytotoxins are produced during pulmonary infection. Isolated rat pulmonary endothelial cells and the bacterium Pseudomonas aeruginosa are used as model systems, and the production of cytoxins following infection of the endothelial cells by the bacteria is demonstrated using cell culture followed by direct quantitation using lactate dehydrogenase assays and a novel microscopic method utilizing ImageJ technology. The amyloid nature of these cytotoxins was demonstrated by thioflavin T binding assays and by immunoblotting and immunodepletion using A11 anti-amyloid antibody. Further analyses using immunoblotting demonstrated that oligomeric tau and A&#946; were produced and released by endothelial cells following infection by P. aeruginosa. These methods should be readily adaptable to analyses of human clinical samples.

Methods for Detecting Cytotoxic Amyloids Following Infection of Pulmonary Endothelial Cells by Pseudomonas aeruginosa

Simple methods are described for demonstrating the production of cytotoxic amyloids following infection of pulmonary endothelium by Pseudomonas aeruginosa.

Yöntemleri için algılama sitotoksik Amyloids aşağıdaki enfeksiyon pulmoner endotel hücre Pseudomonas aeruginosa tarafından

Patients who survive pneumonia have elevated death rates in the months following hospital discharge. It has been hypothesized that infection of pulmonary ...

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of these products are naturally produced by the organisms, other products require genetic engineering of the organism to increase the yields of production. Avirulent strains of Escherichia coli have traditionally been the preferred bacterial species for producing biopharmaceuticals; however, some products are difficult for E. coli to produce. Thus, avirulent strains of other bacterial species could provide useful alternatives for production of some commercial products. Pseudomonas aeruginosa is a common and well-studied Gram-negative bacterium that could provide a suitable alternative to E. coli. However, P. aeruginosa is an opportunistic human pathogen. Here, we detail a procedure that can be used to generate nonpathogenic strains of P. aeruginosa through sequential genomic deletions using the pEX100T-NotI plasmid. The main advantage of this method is to produce a marker-free strain. This method may be used to generate highly attenuated P. aeruginosa strains for the production of commercial products, or to design strains for other specific uses. We also describe a simple and reproducible mouse model of bacterial systemic infection via intraperitoneal injection of validated test strains to test the attenuation of the genetically engineered strain in comparison to the FDA-approved BL21 strain of E. coli.

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Here, we describe a simple and reproducible protocol of mouse model of infection to evaluate the attenuation of the genetically modified strains of Pseudomonas aeruginosa in comparison to the United States Food and Drug Administration (FDA)-approved Escherichia coli for commercial applications.

Pseudomonas aeruginosa In-Frame Gen Silme Mutantlar Üretimi ve Enfeksiyon Basit Bir Fare Modelinde Virülans Zayıflama sıiçin Test

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of ...