Bu protokol açıklanan Çalışma Rejeneratif Tıp Kaliforniya Enstitüsü (CIRM) ile bir işbirliği ittifak parçası olarak Victoria Hükümeti tarafından finanse edilerek mümkün olmuştur.

Tüm işlemler steril bir laminer akış başlığı içinde yapılır. Aksi belirtilmediği sürece tüm ortam ve solüsyonlar 37 ° C&#39;de dengelenir. Transfaksiyon için (bu Protokolde kullanılan HESC ve hiPSCs, WA-09) İnsan ÖGŞ 1. Genişleme Not: Matrigel veya Geltrex üzerinde HESC genişletmek için gerekli değildir. fare embriyonik fibroblastlar (MEF&#39;ler) genişletilmiş HESC MEF giderme aşaması aşağıdaki elektroporasyon veya nucleofection için kullanılabilir (bakınız bölüm 2.8 bakınız). <ol><li> 1 x 100 mm tabak ve MEF medya cm2 başına 2.0 x 10 hücre 4 DR4 MEF&#39;lerin 1 x 75cm2 balon içinde Hazırlama / hac% 0.1 a jelatin ile ön-kaplı kaplar üzerinde (Tablo 1 e bakınız). Not: CF1, BLK6 veya MF1 MEF&#39;ler kullanılabilir, ancak, örneğin, DR410, antibiyotik dirençli MEF hatları kullanılır önerilir. </li><li> Ertesi gün, 100 mm tabak üzerine geçiş HESC bölüm 1.1 &#39;de hazırlanan MEF&#39;ler ile ön-kaplama. Bu ASPI&#39;yi yapmakkültür kaplarından oranı ESC medya, Ca2 + / Mg2 + içermeyen Hanks dengeli tuz çözeltisi (HBSS) ile HESC yıkama, 37 ° C /% 5 CO2 ile nemlendirilmiş inkübatörde dispaz (uygun miktarlar için bkz Tablo 2) ve yerde ekleyin. MEFS kaldırmak için HBSS ile 2 kez - 3-5 dk inkübasyonu takiben, yavaşça aspire Dispase ve 1 yıkayın. Yavaşça kültür çanak yüzeyinden koloniler kazımak, HESC medya (Tablo 3) ve bir hücre kazıyıcı kullanarak veya 5 ml pipet ekleyin. </li><li> 15 ml&#39;lik bir santrifüj tüpü içine kültürü çanak süspansiyon içinde koloni parçalarını toplamak. HESC medya ve 15 ml tüp transferi ile durulayın kültür çanak. Tek hücreler veya küçük parçalar halinde öbekler kırmak için dikkatli olun. </li><li> Koloni fragmanları pelet haline getirmek için 160 x g&#39;de 5 dakika boyunca santrifüj. </li><li> Aspire süpernatant. Koloni fragmanı pelet gevşetmek için parmak ile 15 ml tüp alt dokunun. Bölünmüş oranına göre HESC medyada yavaşça tekrar süspansiyon koloni fragmanları (normall4 ve 1: 8 uygun) ya 1 arasındaki oranı bölünmüş. Verimliliğini şarjı etkiler, bu gibi tek hücreler veya küçük parçalar halinde kümeleri işlemek için değil, son derece dikkatli olun. </li><li> MEF&#39;ler HBSS ile 1x yıkayın üzerine HESC fragmanlarını replating önce. Yavaş yavaş yemekleri MEF&#39;ler ile ön kaplama HESC ortam içinde HESC fragmanlarını ihtiva eden hücre süspansiyonunun uygun bir miktarı (bakınız Tablo 2) ekleyin. </li><li> Inkübatör rafa kültür yemekleri yerleştirin ve eşit koloni parçaları dağıtmak için iki ileri ve geri ve yan yavaş hareket. </li><li> Günlük HESC ortamı değiştirin. </li><li> MEF&#39;ler (MEF-CM) şartlandırılmış ortam hazırlamak için yıkamak 75 cm 2 şişe MEF&#39;ler HBSS 1 x ile ön kaplama. HESC ortam ekleyin. 24 saat sonra, ortamla ve taze hESC medya ile değiştirin toplamak. 12 gün en fazla günlük tekrarlayın. , Gerekli olana kadar, 4 ° C&#39;de, MEF-CM saklayın. </li></ol> Transfeksiyon İnsan EKH 2. Hazırlık <ol><li> HESC büyümesini dikkate, günde bir mikroskop altında. Koloniler% 40-50 konfluent, plaka cm 2 başına 2.0 x 10 5 MEF&#39;ler 3 x 100 mm yemekleri olunca. </li><li> Koloniler 60 olunca -% 70 birleşik transfekte hazırdır. Farklı koloniler veya koloni çekirdekleri çıkartarak &#39;damat kolonileri. Not: Biz daha yüksek transfeksiyonunu inanıyoruz ve hücreler log fazı büyüme olduğunda hedefleme verimleri meydana gelince, HESC ≥ 70% confluency ulaşmadan elektroporasyon yapılan önerilmektedir. </li><li> HBSS HESC koloniler yıkayın ve Accutase ekleyin. Not: Bu ROCK inhibitörü ile önceden tedavi HESC gerekli değildir Y-27632 adım 2.7 sırasında Y-27632 ile kuluçkaya olduğu gibi yeterli engelleme meydana gelecek </li><li> 37 ° C / 5, bir mikroskop altında bakıldığında, koloniler tek hücreler hale kadar% CO2 &#39;de 20 dakika için 10 - inkübe edin. 1 ml&#39;lik bir pipet ile öğütmek hücreleri. </li><li> 40 mikron hücre straine kullanarak 15 ml konik tüp içine HESC medya ve filtre eklehücre kümeleri kaldırmak için r. </li><li> 5 dakika boyunca 160 x g&#39;de santrifüjleyin. Taze hESC medya yeniden süspanse hücre pelet ve kalan Accutase kaldırmak için çözüm tekrarlayın. </li><li> 10 uM Y-27632 ve 100 mm tabak için toplam hücre süspansiyonu transfer jelatin ile kaplı önceden ihtiva eden HESC ortam içinde tekrar süspansiyon hücreleri. </li><li> 30 dakika içinde en az 37 ° C /% 5 CO2 ile inkübe edin. </li><li> Bu süre zarfında MEF&#39;ler jelatin kaplı çanak uyacaktır. Yeni bir 15 ml&#39;lik santrifüj tüpüne 1 mi pipet kullanılarak yapışmayan HESC toplamak ve bir hemositometre kullanılarak hücre yoğunluğu belirlemek. </li></ol> HESC 3. Elektroporasyon <ol><li> 0.22 um bir filtre ve ekleme 10 ng / ml yeniden birleştirici insana ait fibroblast büyüme faktörü 2 (rhFGF2) ile filtre CM-MEF ortam. </li><li> 5 dakika boyunca 160 xg&#39;de yeni bir 15 ml konik tüp ve santrifüj bölümünde 2,9 7,5 x 106 HESC aktarın. </li><li> Üstel Elektronik endüstri için programı seçiniz: elektrogözenekleme kurmak bu süre zarfında250 V, Sığa: ctroporation ve aşağıdaki parametreler, Gerilim set 500 uF ve Direnç: ∞-. </li><li> Süpernatan aspire ve buz soğukluğunda, 0.22 um&#39;den filtre edildi HBSS 0.8 ml hücre pelet yeniden askıya. Steril bir 0.4 cm elektroporasyon küvetine çözeltisini. </li><li> TV-hPITX3-ileri hedefleme yapı (30 mg DNA) ekleyin ve 200 ul pipet ile hafifçe karıştırın. 5 dakika boyunca buz üzerinde inkübe edin. Bu süre boyunca PITX3 ZFN mRNA&#39;nın tek numuneyi çıkarın ve buz üzerinde defrost. Elektroporasyon küvetine DNA / hücre karışımına aktarımı ZFN mRNA 7.5 ul buzu zaman. 200 ul pipet ile hafifçe karıştırın. Not: hedefleniyor odağı verimlilik hedefiyle katkıda ana faktör. Böyle PITX3 gibi sessiz genler, EKH ifade değil genler, zor loci kodlama geleneksel homolog rekombinasyon 6 kullanarak hedef. Böylece, bu protokol özel bir DNA çift iplik b uyarılması için insan PITX3 lokusu için tasarlanmış ZFNs kullanmaktadırreak. </li><li> Elektroporatörü üzerindeki ekrandaki talimatları izleyerek electroporate. </li><li> 200 ul pipet, 10 ml HESC ortamı içeren 15 ml tüp elektroporasyon küvetine içindekileri aktarmak kullanma. HESC ortam 200 ul bir 15 ml tüp her zaman ve transferi ile iki kez küvet yıkayın. Orada olacak &quot;mukoza gibi&quot; enkaz olumsuz hücre yaşamını etkileyecek lizlenmiş hücrelerden DNA ve protein içeren. Bu artığın ayrılması için 5 dakika boyunca 160 x g&#39;de santrifüjleyin. </li><li> Süpernatantı aspire ve yavaşça gevşetin hücre pelet dokunun. 10 uM Y-27632 içeren MEF-CM desteklenmiş 30 ml yeniden askıya ve MEF&#39;ler ile preplated 3 x 100 mm yemekleri üzerine Replate. </li><li> Günlük medya değiştirin. 2. günde,-Y-27632 çekilebilir ve hücreler HESC ortam sadece büyütülür. </li><li> 2-3 gün sonra,% 50-70 konfluent HESC olmalıdır. Bu noktada antibiyotik seçim (örneğin, 0.5 ug / ml puromisin) başlar. </li><li> Sel koruyungünlük taze HESC / puromycin medya ekleyerek ection. ~ 7 gün sonra küçük koloniler görünür olmalıdır. Antibiyotiğe dirençli MEF&#39;ler alışık değilseniz, MEF&#39;ler cm 2 başına ek 1.0 x 10 4 hücreler ekleyerek takviye edilebilir. </li></ol> 4. Toplama Transgenik HESC Klonlar <ol><li> Yaklaşık 14 - (koloniler ~ 1 mm çapa ulaşmış) seçimi 21 gün sonra genişleme ve tarama için plakaları hazırlamak. 5 saat arasında, en az 4 ° C&#39;de Matrigel veya Geltrex bir kısım buz çözme başlayın. Üreticinin talimatlarına uygun olarak seyreltilir ve 3 x 96-çukurlu levhaların her çukuruna 75 ul ekle. Cm2 başına 2.0 x 10 hücre 4 MEFS kaplama ile 3 x 48 oyuklu plakalar hazırlamak. 37 ° C /% 5 CO2 ile iki tabak göre O / N inkübe edin. </li><li> Ertesi gün, bir örgü kesilerek 2 ml&#39;lik bir pipet ucunda, bir 21 G iğne kullanılarak 16-25 parçaya kolonileri keser. </li><li> Aspire 96 oyuklu plakalar Matrigel ve supplem ile değiştirintasyonlu CM-MEF medya. 48 oyuklu plakalar 1 HBSS x ve HESC ortam eklemek yıkayın MEF&#39;ler. </li><li> 200 ul bir pipet kullanarak yavaşça yayılması için bir 48 oyuklu bir plakaya kesilmiştir koloninin 1/3 aktarın. Takviye edilmiş CM-MEF ortamı ihtiva eden ilgili bir 96-yuvalı plaka içine kesilmiş koloninin diğer 2/3 aktarın. </li><li> Her gün ortam değiştirilerek iki tabak muhafaza (MEFS ihtiva eden 48 oyuklu plakalar boyunca 96 oyuklu Matrigel kaplı plakalar ve HESC ortam CM-MEF ortamı eklenmiş ve her ikisi de 0.5 ug / ml puromisin ile desteklenmiş). </li><li> 96 oyuklu plakalar,% 100 konfluent ve daha sonra ilk olarak PCR yoluyla taranması kadar aç. </li></ol> 5. Tarama ve pozitif klonların Genişletilmesi <ol><li> Genomik DNA (11 dayanan bir yöntem) hazırlamak tersini plakalar tüm ortamları kaldırmak için, sonra kağıt havlu üzerine kurulayın. </li><li> RT, PBS (100 ul / oyuk her bir yıkama) Aşama 5.1 olarak invert ve blot, her oyuk iki kez yıkayın. -80 ° C f Yeri plakalarya da 1-2 saat hücre lizizi yardımcı olmak için (levhalar böyle süresiz olarak saklanabilir). </li><li> Hücreler sarkosil Lizis Tampon olmak C -80 ° C&#39;de iken (bakınız Tablo 4) (50 ul / kuyucuk). Her kuyuya 5 sonra oda sıcaklığında dakika pipet lizis tamponu için hücreleri, sıcak tabaklar lyse. Nem oluşturmak için, nemli kağıt havlu içeren kapatılabilir bir kap içinde bant, yer her plakanın kenarlarını kapatırlar ve 60 ° C sıcaklıkta O / N inkübe edin. </li><li> İnkübasyondan sonra, -20 ° C mutlak etanol içinde, 10 ml 5M NaCl, 150 ul, iyice karıştırılmakta ve her bir göze 100 ul (Not: NaCI ilave edildiğinde etanol bulutlanmayarak mi?). Dokunun levhalar hafifçe karıştırın (Pipeti yapmak) ve oda sıcaklığında 30 dakika en az bırakmak. Bu süre zarfında çözelti, temiz bir sayfa ve DNA neden olacaktır. </li><li> Daha sonra her bir göze% 70 etanol içinde 150 ul 5.1 adım olarak çözeltisini çıkarın. Yavaşça plaka ters çevirin ve daha önce olduğu gibi kurulayın. Bu adımı bir başka 2x tekrarlayın. Not: Çökelen DNA, doğal Adhedoku kültürü plastik çözünürlük bu yıkama adımları sırasında yerinden olmaz.) </li><li> Son yıkamadan sonra, en yüksek hızda kısa bir süre için santrifüj plakalar en az 30 dakika boyunca, oda sıcaklığında her bir göze daha sonra kurumaya tabanı (veya 37 ° C), DNA&#39;nın konsantre edilmesi için. </li><li> Ekle 40 - 50 ul T0.1E (pH 8.0) ile 1 saat boyunca 65 ° C &#39;de ve her bir göze bir yer plakalarına ya da TE (pH 8.0) (Tablo 5) ya da 4 ° de CO / K PCR kullanılarak yapılmıştır. Yavaşça, plakanın kenarlarına hafifçe vurarak DNA yeniden süspanse edin. Yeniden süspansiyon haline getirildi, DNA / 10 | il PCR reaksiyonu, 1-2 ul kullanın. </li><li> HPITX3 L kol gen Uzun Şablon PCR Sistemi genişletin kullanma. F ve hPITX3 L kol GFP R astarlar 58 ° C tavlama, 45 saniye uzatma, 35 döngü klonların ilk taramasını gerçekleştirmek. </li><li> Bir% 1 agaroz jeli içinde Hyperladder 1kb ile Electrophorese numuneler, 45 dakika boyunca 100 V&#39;ta GelRed ve UV ışıması suretiyle, pozitif klonları tespit içeren. </li><li> Expa genomik DNA&#39;sını sindirerek PCR pozitif klonların doğrulamaSouthern lekeleme için, bir vektör homoloji kollarının Hindlll ve hibritleşen sondalar 5 &#39;ve 3&#39; ile birlikte nded klon (aşağıya bakınız) (daha önce tarif edildiği gibi, 1). Problar primer çiftleri hPITX3 5 &#39;prob F, ve Rı ve hPITX3 3&#39; probu F ve R, EcoRI ile sindirilmiş ve genel bir klonlama vektörüne lige kullanılarak PCR ile üretilmiştir. </li><li> Pozitif klonların sayısına bağlı olarak, MEF&#39;ler (cm2 başına 2.0 x 10 hücre 4) ile ön kaplama ile, 6 gözlü bir plakanın 2 kuyu hazırlar. </li><li> Ertesi gün, 1 saat arasında, en az 10 uM-Y-27632 ile, 48 oyuklu bir plaka içerisinde, pozitif klonları ön muamele. </li><li> HBSS pozitif klonlar yıkayın ve Accutase 300 ul ekleyin. </li><li> Koloniler tek hücreler işlendiğinde HESC ortam 1 ml ilave edilir ve 15 ml&#39;lik bir tüp içine toplar. </li><li> Günlük medya değiştirin. 2. günde,-Y-27632 çekilebilir ve hücreler HESC ortamında yetiştirildi. </li><li> % 80 birleşmiş, alt kültür ve Colo kalanını dondurmak - koloniler 70 olduğundaNY fragmanları. </li></ol>

<ol>
	<li>Nefzger, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lmx1a+Allows+Context-Specific+Isolation+of+Progenitors+of+GABAergic+or+Dopaminergic+Neurons+During+Neural+Differentiation+of+Embryonic+Stem+Cells.">Lmx1a Allows Context-Specific Isolation of Progenitors of GABAergic or Dopaminergic Neurons During Neural Differentiation of Embryonic Stem Cells.</a> Stem Cells. 30 (7), 1349-1361 (2012).</li><li>Zeng, W. R., Fabb, S. R. A., Haynes, J. M., Pouton, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extended+periods+of+neural+induction+and+propagation+of+embryonic+stem+cell-derived+neural+progenitors+with+EGF+and+FGF2+enhances+Lmx1a+expression+and+neurogenic+potential.">Extended periods of neural induction and propagation of embryonic stem cell-derived neural progenitors with EGF and FGF2 enhances Lmx1a expression and neurogenic potential.</a> Neurochemistry International. 59 (3), 394-403 (2011).</li><li>Collin, J., Lako, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concise+review:+putting+a+finger+on+stem+cell+biology:+zinc+finger+nuclease-driven+targeted+genetic+editing+in+human+embryonic+stem+cells.">Concise review: putting a finger on stem cell biology: zinc finger nuclease-driven targeted genetic editing in human embryonic stem cells.</a> Stem Cells. 29 (7), 1021-1033 (2011).</li><li>Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+and+prospects:+zinc-finger+nucleases+as+gene+therapy+agents.">Progress and prospects: zinc-finger nucleases as gene therapy agents.</a> Gene Therapy. 15 (22), 1463-1468 (2008).</li><li>Urnov, F. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+endogenous+human+gene+correction+using+designed+zinc-finger+nucleases.">Highly efficient endogenous human gene correction using designed zinc-finger nucleases.</a> Nature. 435 (7042), 646-651 (2005).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+targeting+of+expressed+and+silent+genes+in+human+ESCs+and+iESCs+using+zinc-finger+nucleases.">Efficient targeting of expressed and silent genes in human ESCs and iESCs using zinc-finger nucleases.</a> Nature Biotechnology. 27 (9), 851-857 (2009).</li><li>Lombardo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+editing+in+human+stem+cells+using+zinc+finger+nucleases+and+integrase-defective+lentiviral+vector+delivery.">Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery.</a> Nature Biotechnology. 25 (11), (2007).</li><li>Boch, J., Bonas, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xanthomonas+AvrBs3+family-type+III+effectors:+discovery+and+function.">Xanthomonas AvrBs3 family-type III effectors: discovery and function.</a> Annual Review of Phytopathology. 48, 419-436 (2010).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+engineering+of+human+embryonic+cells+using+TALE+nucleases.">Genetic engineering of human embryonic cells using TALE nucleases.</a> Nature Biotechnology. 29 (8), 731-734 (2011).</li><li>Tucker, K. L., Wang, Y., Dausman, J., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transgenic+mouse+strain+expressing+four+drug-selectable+marker+genes.">A transgenic mouse strain expressing four drug-selectable marker genes.</a> Nucleic Acids Research. 25 (18), 3745-3746 (1997).</li><li>Ram&#237;rez-Solis, R., Rivera-P&#233;rez, J., Wallace, J. D., Wims, M., Zheng, H., Bradley, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+DNA+microextraction:+a+method+to+screen+numerous+samples.">Genomic DNA microextraction: a method to screen numerous samples.</a> Analytical Biochemistry. 201 (2), 331-335 (1992).</li><li>Kawasaki, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+midbrain+dopaminergic+neurons+from+ES+cells+by+stromal+cell-derived+inducing+activity.">Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity.</a> Neuron. 28 (1), 31-40 (2000).</li><li>Denham, M., Thompson, L. H., Leung, J., P&#233;bay, A., Bj&#246;rklund, A., Dottori, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gli1+is+an+inducing+factor+in+generating+floor+plate+progenitor+cells+from+human+embryonic+stem+cells.">Gli1 is an inducing factor in generating floor plate progenitor cells from human embryonic stem cells.</a> Stem Cells. 28 (10), 1805-1815 (2010).</li><li>Smidt, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+homeodomain+gene+Ptx3+has+highly+restricted+brain+expression+in+mesencephalic+dopaminergic+neurons.">A homeodomain gene Ptx3 has highly restricted brain expression in mesencephalic dopaminergic neurons.</a> Proceedings of the National Academy of Sciences U.S.A. 94, 13305-13310 (1997).</li></ol>

Yazarlar ifşa hiçbir şey yok.

Raportör hücre çizgilerinin üretimi, etiket görselleştirmek ve hESC türetilmiş bir heterojen popülasyonda ilgi konusu hücrelerin izole edilmesi için güçlü bir araç sunar. Bununla birlikte, geleneksel homolog rekombinasyon yoluyla hedef geni insan EKH 3 için son derece randımansız olduğu kanıtlanmıştır. Bu protokolde ZFNs ile birlikte yaygın olarak kullanılan hedefleme vektörü kullanılarak hESC, ekson PITX3 lokusunun bir RP içine verilmesi için nispeten basit bir tekniği...

Mevcut embriyonik kök hücre (ESC) diferansiyasyon protokolleri, özellikle spesifik sinir hücresi fenotipleri türetme ile ilgili olarak, heterojen hücre popülasyonlarının neden olur. Kültürler, arzu edilen hücresel fenotipi, diğer nöronal içeren rağmen bunlar, nöronal olmayan ve BM-farklılaşmış hücre türleri genellikle 1 bulunmaktadır. Bu özellikler ESC uygulama hücre replasman tedavisinde kullanım için ve in vitro hastalık modelleme hücre kaynaklardan elde edilen sınırlar. Genetik raportör hücre çizgileri, görselleştirmek izlemek ve ilgili hücreleri izole etmek için bir araç sunar, raportör protein (RP) ifadesi, endojen ekspresyonu üretir şartıyla. Bir gen kodlama bölgesinin hemen üst promoterlerin kullanımı ham genetik muhabir elde etmek için kullanılabilir, ancak bu gibi yapılar, endojen gen ekspresyonunu kontrol hassas düzenleyici elemanları yoksundur. Bunun aksine, homolog rekombinasyon sunarfırsat RP yüksek sadakat ifade sağlamak. Geçmişte, ilgi konusu özel konumlara homolog yeniden birleştirme için tasarlanmış hedefleme vektörleri DNA aktarımından 1,2 için bir araç olarak, elektroporasyon kullanılarak fare ESCs (mESCs) olarak RPs hedeflemek üzere kullanılmıştır. Bununla birlikte, homolog rekombinasyon yoluyla, geleneksel raportör hücre çizgilerinin nesil insan EKH (HESC) son derece yetersiz olduğu ve bu nedenle (3 gözden geçirilmiştir) durumlarda bir avuç belgelenmiştir. Çinko-parmak nükleazlar (ZFNs) gibi yaygın olarak bilinen siteye spesifik çinko-parmak motifleri, bir Fok I nükleaz füzyonunu ihtiva eden bir yapılandırılmış, kimerik proteini kullanarak, DNA çift iplikli sonları önceden belirlenmiş genomik lokusları sokulabilir. DNA çift iplik arası her iki taraf için homolojisi olan bir DNA vektörü eklendiğinde, genomik DNA sitesi, donör sekansının bir girişe izin verir, homolog rekombinasyon ile tamir edilebilir. Bu teknik kullanışlı f kanıtlanmıştırveya insan primer hücre 4,5 ve 6,7 HESC hem de genomik düzenleme. Son çalışmalar kullanmıştır transkripsiyon faaliyete geçirme gibi efektör nükleazlar (TALENS), bitki kopyalama faktörleri ile ikinci site-spesifik nükleazlara 9 tasarımında yardımcı olmak için, 8 patojenleri. Aşağıdaki protokolde, insan hipofiz homeoboks 3 (PITX3) lokusu için ZFNs birlikte homolog hedefleme vektörü ihtiva eden bir 6 EGFP elektroporasyon ile HESC raportör hücre hattının üretilmesini göstermektedir. 2-3 hafta boyunca antibiyotik seçimi takiben, doğru entegre DNA ile HESC elle aldı genişletilmiş ve PCR ile başlangıçta ekranlı ve daha sonra Southern lekeleme tarafından onaylanmış olabilir.

<table border="0" cellpadding="0" cellspacing="0" width="883">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Mouse Embryonic Fibroblasts (DR4)</td>
			<td style="width:207px;">GlobalStem</td>
			<td style="width:119px;">GSC-6004G</td>
			<td style="width:67px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gelatin</td>
			<td style="width:207px;">Sigma</td>
			<td style="width:119px;">G1393-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">HBSS, no Calcium, no Magnesium, no Phenol Red (HBSS)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">14175-095</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dispase</td>
			<td style="width:207px;">StemCell Technologies</td>
			<td style="width:119px;">7923</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Cell Scraper</td>
			<td style="width:207px;">Corning</td>
			<td style="width:119px;">3008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Accutase</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">A11105-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Y27632</td>
			<td style="width:207px;">Axon Medchem</td>
			<td style="width:119px;">Axon 1683</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer - 40um</td>
			<td>BD Biosciences</td>
			<td>352340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">33mm - 0.22 um filter</td>
			<td style="width:207px;">Millipore</td>
			<td style="width:119px;">SLGP033RS</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">rhFGF2</td>
			<td style="width:207px;">R&#38;D Systems</td>
			<td>233-FB-025/CF</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Electroporator</td>
			<td style="width:207px;">BioRad</td>
			<td style="width:119px;">165-2661</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">0.4cm electroporation cuvette</td>
			<td style="width:207px;">BioRad</td>
			<td style="width:119px;">165-2088</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Human TV-hPITX3-forward targeting construct</td>
			<td style="width:207px;">Addgene</td>
			<td style="width:119px;">31942</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:491px;">ZFN Kit; Human PITX3</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td style="width:119px;">CKOZFN1050-1KT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Puromycin</td>
			<td style="width:207px;">Invivogen</td>
			<td style="width:119px;">ant-pr-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Matrigel</td>
			<td style="width:207px;">BD Biosciences</td>
			<td>354277</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Geltrex</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">A1569601</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">NaCl</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td>S3014</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td style="width:207px;">Life Technologies</td>
			<td>10566-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Fetal Bovine Serum, Qualified, Heat Inactivated, US Origin (FBS)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">16140-071</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Pen/Strep</td>
			<td style="width:207px;">Life Technologies</td>
			<td>15070-063</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dulbecco&#39;s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">11320-033</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">KnockOut Serum Replacement (KSR)</td>
			<td style="width:207px;">Life Technologies</td>
			<td>10828-028</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">MEM Non-Essential Amino Acids&#160; (NEAA)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">11140-050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">GlutaMAX</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">35050-061</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">&#223;-mercaptoethanol</td>
			<td style="width:207px;">Life Technologies</td>
			<td>21985-023</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">N-Lauroylsarcosine sodium salt solution (Sarcosyl) (30%)</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td style="width:119px;">61747</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">EDTA</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td><a href="http://www.sigmaaldrich.com/catalog/product/sial/e9884?lang=en&amp;region=US">E9884</a></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Trizma Hydrochloride</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td>T3253</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Proteinase K solution (20mg/ml)</td>
			<td style="width:207px;">Bioline Australia</td>
			<td>BIO-37084</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Expand Long Template PCR System</td>
			<td style="width:207px;">Roche Australia</td>
			<td style="width:119px;">11681834001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">hPITX3 L arm gen. F (primer): 5&#8217; TGTCCTAAGGAGAATGGGTAACAGACA 3&#8217;</td>
			<td style="width:207px;">GeneWorks, Australia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:491px;">hPITX3 L arm GFP R (primer): 5&#8217; ACACGCTGAACTTGTGGCCGTTTA 3&#8217;</td>
			<td style="width:207px;">GeneWorks, Australia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">HyperLadder 1kb&#160;</td>
			<td style="width:207px;">Bioline Australia</td>
			<td>BIO-33025</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:491px;">GelRed</td>
			<td style="width:207px;">Jomar Bioscience, Australia</td>
			<td style="width:119px;">41003</td>
			<td></td>
		</tr>
	</tbody>
</table>

zinc-finger nuclease enhanced gene targeting in human embryonic stem cells

Mevcut insan embriyonik kök hücre (ESC) farklılaşma protokolleri ile bir büyük sınırlama heterojen hücre popülasyonlarının nesil. Bu kültürler, ilgi hücreleri içerir, fakat aynı zamanda farklılaşmamış EKH, nöral olmayan türevleri ve diğer alt-tipler ile nöronal kirlenir. Bu, in vitro olarak ve bu ilaç keşfi ya da hücre replasman tedavisi için, in vitro modelleme gibi in vivo uygulamalarda, kullanımlarını kısıtlar. Bu aşabilmesi için, görselleştirmek parça ve ilgi hücreleri izole etmek için bir araç sunuyoruz muhabiri hücre hatları, mühendislik olabilir. Geleneksel homolog rekombinasyon son derece verimsiz cihaz aracılığıyla Ancak, insan embriyonik kök hücreleri bunu başarmak için. Bu protokol ile birlikte, Hipofiz homeobox insan embriyonik kök hücreleri 3 (PITX3) lokus site-spesifik çift iplikli DNA kopmalarını tanıtmak özel olarak tasarlanmış, çinko-parmak nükleazlar kullanılarak hedeflenmesi tarifPITX3 - EGFP -spesifik DNA donör vektörü. PITX3 raportör hücre çizgisinin üretilmesi sonrasında, daha sonra, in vitro olarak, Parkinson hastalığı, modelleme ya da hücre tedavisi gibi değiştirme çalışmalarında kullanılmak için yayınlanmış protokoller kullanılarak ayırt edilebilir.

PITX3 birlikte özel olarak tasarlanmış PITX3 çinko-parmak çiftinin eş elektroporasyon izlenerek - EGFP özgü bir DNA vektörü verici ve sonraki puromisin seçimi, pozitif HESC genomik klonları başlangıçta PCR taraması (Şekil 1) ile tespit edilmiştir. Bu PCR ile pozitif klonların 5 &#39;ve 3&#39; özgü problar Güney benek hibridizasyonu,% 19 oranında bir verim ile, PITX3 konumunda (Şekil 2) 1. ekson doğru hedeflemeyi doğruladı. <...

Watch this Scientific Journal Video about Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells at JoVE.com

Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

Muhabir hücre çizgileri, görselleştirmek etiket ve heterojen popülasyonlar ilgi hücreleri izole etmek için bir araç sunmaktadır. Bununla birlikte, hedef gen, insan embriyonik kök hücreleri alışılmış homolog rekombinasyon kullanılarak son derece verimsizdir. Bu yazıda, çinko-parmak nukleaz gelişmiş homolog rekombinasyon kullanarak EGFP ile CNS Ortabeyin özel transkripsiyon faktörü PITX3 odağı hedefleme açıklar.

İnsan Embriyonik Kök Hücreleri Hedefleme Çinko parmak Nükleazlar Geliştirilmiş Gen

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell ...

zinc-finger-nuclease-enhanced-gene-targeting-human-embryonic-stem

Research

JoVE Journal

Biology

10.7K Görüntüleme.  Monash University.  Muhabir hücre çizgileri, görselleştirmek etiket ve heterojen popülasyonlar ilgi hücreleri izole etmek için bir araç sunmaktadır. Bununla birlikte, hedef gen, insan embriyonik kök hücreleri alışılmış homolog rekombinasyon kullanılarak son derece verimsizdir. Bu yazıda, çinko-parmak nukleaz gelişmiş homolog rekombinasyon kullanarak EGFP ile CNS Ortabeyin özel transkripsiyon faktörü PITX3 odağı hedefleme açıklar. 

Video: Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

Propagation of Human Embryonic Stem (ES) Cells

Propagation of Human Embryonic Stem ES Cells

İnsan Embriyonik Kök Hücre (ES) yayılması

Biyoloji

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

Immunosurgery İnsan Embriyonik Kök Hücreleri türetilmesi

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Probing for Mitochondrial Complex Activity in Human Embryonic Stem Cells

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and programmed cell death. Mitochondria produce ATP, regulate the cytoplasmic redox state and Ca2+ balance, catabolize fatty acids, synthesize heme, nucleotides, steroid hormones, amino acids, and help assemble iron-sulfur clusters in proteins. Mitochondria also have an essential role in heat production. Mutations of the mitochondrial genome cause several types of human disorder. The accumulation of mtDNA mutations correlates with aging and is suspected to have an important role in the development of cancer. Due to their vitally important role in all cell types, the function of mitochondria must also be critical for stem cells. Key advances have been made in our understanding of stem cell viability, proliferation, and differentiation capacity. But the functional activity of stem cells, in particular their energy status, was not yet been studied in detail. Almost nothing is known about the mitochondrial properties of human embryonic stem cells (hESCs) and their differentiated precursor progeny. One way to understand and evaluate the role of mitochondria in hESC function and developmental potential is to directly measure the activity of mitochondrial respiratory complexes. Here, we describe high resolution clear native gel electrophoresis and subsequent in gel activity visualization as a method for analyzing the five respiratory chain complexes of hESCs.

In this video, we will show you how the mitochondrial respiratory chain complexes of human embryonic stem cells can be analyzed using in gel activity assays.

İnsan Embriyonik Kök Hücreleri Mitokondrial Kompleksi Aktivite araştırmayı

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and ...

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative medicine. However, direct injection of hESCs, and cells differentiated from hESCs, into living organisms has thus far been hampered by significant cell death, teratoma formation, and host immune rejection. Understanding the in vivo hESC behavior after transplantation requires novel imaging techniques to longitudinally monitor hESC localization, proliferation, and viability. Molecular imaging has given investigators a high-throughput, inexpensive, and sensitive means for tracking in vivo cell proliferation over days, weeks, and even months. This advancement has significantly increased the understanding of the spatio-temporal kinetics of hESC engraftment, proliferation, and teratoma-formation in living subjects.

A major advance in molecular imaging has been the extension of noninvasive reporter gene assays from molecular and cellular biology into in vivo multi-modality imaging platforms. These reporter genes, under control of engineered promoters and enhancers that take advantage of the host cell s transcriptional machinery, are introduced into cells using a variety of vector and non-vector methods. Once in the cell, reporter genes can be transcribed either constitutively or only under specific biological or cellular conditions, depending on the type of promoter used. Transcription and translation of reporter genes into bioactive proteins is then detected with sensitive, noninvasive instrumentation (e.g., CCD cameras) using signal-generating probes such as D-luciferin.

To avoid the need for excitatory light to track stem cells in vivo as is required for fluorescence imaging, bioluminescence reporter gene imaging systems require only an exogenously administered probe to induce light emission. Firefly luciferase, derived from the firefly Photinus pyralis, encodes an enzyme that catalyzes D-luciferin to the optically active metabolite, oxyluciferin. Optical activity can then be monitored with an external CCD camera. Stably transduced cells that carry the reporter construct within their chromosomal DNA will pass the reporter construct DNA to daughter cells, allowing for longitudinal monitoring of hESC survival and proliferation in vivo. Furthermore, because expression of the reporter gene product is required for signal generation, only viable parent and daughter cells will create bioluminescence signal; apoptotic or dead cells will not. 

In this video, the specific materials and methods needed for tracking stem cell proliferation and teratoma formation with bioluminescence imaging will be described.

With the growing interest in stem cell therapies, molecular imaging techniques are ideal for monitoring stem cell behavior after transplantation. Luciferase reporter genes have enabled non-invasive, repetitive assessment of cell survival, location, and proliferation in vivo. This video will demonstrate how to track hESC proliferation in a living mouse.

In vitro ve in vivo Biyoparlaklık Reporter Gen Görüntüleme İnsan Embriyonik Kök Hücreleri

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

Chromatin Immunoprecipitation from Human Embryonic Stem Cells

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are characterized by two fundamental properties: self-renewal and multipotency that allows a stem cell to differentiate into virtually any cell type 1. The progression stem cell to differentiated cell is characterized by loss of multipotency, structural and morphological changes and the hierarchic activity of transcription factors and signaling molecules, whose activities establish and maintain cell-type specific gene expression patterns. At the molecular level, cell differentiation involves dynamic changes of the structure and composition of chromatin and the detection of those dynamic changes can provide valuable insights into the functional features of stem cells and the cell differentiation process 2,3. Chromatin is a highly compacted DNA-protein complex that forms when cells package chromosomal DNA with proteins, mainly histones 4. Stemcellness and cell differentiation has been correlated with the presence of specific arrays of regulatory proteins such as epigenetic factors, histone variants, and transcription factors 2,3,5.
 Chromatin immunoprecipitation (ChIP) provides a valuable method to monitor the presence of RNA, proteins, and protein modifications in chromatin 6,7. The comparison of chromatin from different cell types can elucidate dynamic changes in protein-chromatin associations that occur during cell differentiation.
Chromatin immunoprecipitation involves the purification of in vivo cross-linked chromatin. The isolated chromatin is reduced to smaller fragments by enzymatic digestion or mechanical force. Chromatin fragments are precipitated using specific antibodies to target proteins or protein and DNA modifications. The precipitated DNA or RNA is purified and used as a template for PCR or DNA microarray based assays. Prerequisites for a successful ChIP are high quality antibodies to the desired antigen and the availability of chromatin from control cells that do not express the target molecule. ChIP can correlate the presence of proteins, protein and RNA modifications, and RNA with specific target DNA, and depending on the choice of outread tool, detects the association of target molecules at specific target genes or in the context of an entire genome. The comparison of the distribution of proteins in the chromatin of differentiating cells can elucidate the dynamic changes of chromatin composition that coincide with the progression of cells along a cell lineage.

The differentiation of ESC coincides with cell-type specific changes in the structure and composition of chromatin. The detection of those changes provides valuable insights into the mechanisms that define stemcellness and cell differentiation. Chromatin immunoprecipitation (ChIP) represents a valuable method to dissect the molecular mechanisms underlying stem cell differentiation.

İnsan Embriyonik Kök Hücre Kromatin Immunoprecipitation

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are ...

In vitro Labeling of Human Embryonic Stem Cells for Magnetic Resonance Imaging

Human embryonic stem cells (hESC) have demonstrated the ability to restore the injured myocardium. Magnetic resonance imaging (MRI) has emerged as one of the predominant imaging modalities to assess the restoration of the injured myocardium. Furthermore, ex-vivo labeling agents, such as iron-oxide nanoparticles, have been employed to track and localize the transplanted stem cells. However, this method does not monitor a fundamental cellular biology property regarding the viability of transplanted cells. It has been known that manganese chloride (MnCl2) enters the cells via voltage-gated calcium (Ca2+) channels when the cells are biologically active, and accumulates intracellularly to generate T1 shortening effect. Therefore, we suggest that manganese-guided MRI can be useful to monitor cell viability after the transplantation of hESC into the myocardium.
In this video, we will show how to label hESC with MnCl2 and how those cells can be clearly seen by using MRI in vitro. At the same time, biological activity of Ca2+-channels will be modulated utilizing both Ca2+-channel agonist and antagonist to evaluate concomitant signal changes.

In this video, we are showing how to label human embryonic stem cells (hESC) with manganese chloride (MnCl2) which can enter cells via voltage-gated calcium channels when the cells are biologically active. Additionally, we show the use of MnCl2 as cellular MRI contrast agent to determine the in vitro viability of hESC.

İnsan Embriyonik Kök Hücreleri Manyetik Rezonans Görüntüleme için in vitro Etiketleme

Human embryonic stem cells (hESC) have demonstrated the ability to restore the injured myocardium. Magnetic resonance imaging (MRI) has emerged as one of ...

Culture and Maintenance of Human Embryonic Stem Cells  

Human embryonic stem (hES) cells must be monitored and cared for in order to maintain healthy, undifferentiated cultures. At minimum, the cultures must be  fed  every day by performing a complete medium change to replenish lost nutrients and to keep the cultures free of unwanted differentiation factors. Although a small amount of differentiation is normal and expected in stem cell cultures, the culture should be routinely cleaned up by manually removing, or "picking" differentiated areas. Identifying and removing excess differentiation from hES cell cultures are essential techniques in the maintenance of a healthy population of cells.

Culture and Maintenance of Human Embryonic Stem Cells

This protocol demonstrates how to maintain healthy, undifferentiated human embryonic stem (ES) cells.

İnsan Embriyonik Kök Hücre Kültürü ve Bakım

Human embryonic stem (hES) cells must be monitored and cared for in order to maintain healthy, undifferentiated cultures. At minimum, the cultures must be ...

Freezing and Thawing Human Embryonic Stem Cells

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells from a frozen stock have become important procedures performed in routine hES cell culture. Since hES cells are very sensitive to the stresses of freezing and thawing, special care must taken. Here we demonstrate the proper technique for rapidly thawing hES cells from liquid nitrogen stocks, plating them on mouse embryonic feeder cells, and slowly freezing them for long-term storage.

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells from a frozen stock have become important procedures performed in routine hES cell culture. Since hES cells are very sensitive to the stresses of freezing and thawing, special care must taken. Here we demonstrate the proper technique for rapidly thawing hES cells from liquid nitrogen stocks, plating them on mouse embryonic feeder cells, and slowly freezing them for long-term storage.

İnsan Embriyonik Kök Hücreler Donma ve Çözülme

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant interest in deriving a pure population of lineage-committed oligodendrocyte precursor cells (OPCs) for transplantation. OPCs are characterized by the activity of the transcription factor Olig2 and surface expression of a proteoglycan NG2. Using the GFP-Olig2 (G-Olig2) mouse embryonic stem cell (mESC) reporter line, we optimized conditions for the differentiation of mESCs into GFP+Olig2+NG2+ OPCs. In our protocol, we first describe the generation of embryoid bodies (EBs) from mESCs. Second, we describe treatment of mESC-derived EBs with small molecules: (1) retinoic acid (RA) and (2) a sonic hedgehog (Shh) agonist purmorphamine (Pur) under defined culture conditions to direct EB differentiation into the oligodendroglial lineage. By this approach, OPCs can be obtained with high efficiency (&gt;80%) in a time period of 30 days. Cells derived from mESCs in this protocol are phenotypically similar to OPCs derived from primary tissue culture. The mESC-derived OPCs do not show the spiking property described for a subpopulation of brain OPCs in situ. To study this electrophysiological property, we describe the generation of spiking mESC-derived OPCs by ectopically expressing NaV1.2 subunit. The spiking and nonspiking cells obtained from this protocol will help advance functional studies on the two subpopulations of OPCs.

We describe a small molecule-based protocol for differentiation of mouse embryonic stem cells into oligodendrocyte precursor cells (OPCs). This protocol generates Olig2+NG2+ OPCs with high efficiency by 30 days of differentiation. We also describe a method to generate "spiking" OPCs that can fire action potentials.

Embriyonik Kök Hücreler farklılaşma oligodendrosit Öncüleri

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three embryonic germ layers (1). Directed differentiation of hESCs into specific cell types has generated much interest in the field of regenerative medicine (e.g., (2-5)), and methods for determining the in vivo fate of selected or manipulated hESCs are essential to this endeavor. We have adapted a highly efficient teratoma formation assay for this purpose. A small number of specifically selected hESCs is mixed with undifferentiated wild type hESCs and Phaseolus vulgaris lectin to form a cell pellet. This is grafted beneath the kidney capsule in an immunodeficient mouse. As few as 2.5 x 105 hESCs are needed to form a 16 cm3 teratoma within 8-12 weeks. The fate of the originally selected hESCs can then be determined by immunohistochemistry. This method provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Directed differentiation of hESCs into specific cells has generated much interest in regenerative medicine. We provide a concise, step-by-step protocol for determining the in vivo fate of selected hESCs that provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.