This research was supported by grant from INSERM, University of Lille 1, University of Lille 2, Regional Hospital Center of Lille (CHR de Lille). MCCH acknowledges supports from the Fondation de France and wishes to thank IRCL, Pr. Sonenberg for the gift of the V5-plasmids, Dr. Dissous (Pasteur Institute, Lille) for the gift of anti-GFP antibodies, UMS 3387 (University of Rennes) where Xenopus oocytes are purchased and Dr Taymans (JPArc, Lille) for critical reading of the manuscript text.

Tüm Xenopus deneyleri laboratuvar hayvanları deney için Avrupa Topluluğu Konseyi yönergelerine (86/609 / EEC) kurallarına göre Lille 1 Üniversitesi&#39;nin hayvan tesisinde gerçekleştirildi. Hayvan protokolü (Comité d&#39;Ethique en Deneme Animale Nord-Pas-de-Calais CEEA 07/2010) yerel kurumsal inceleme kurulu tarafından onaylanmıştır. 1. Oosit İşleme <ol><li> Anestezik hazırlayın: steril su, bir 1 L tricaine metan sülfonat tozu 1 g çözülür. </li><li> Kadın Xenopus bu çözüm içine laevis Dalma, kaçış önlemek ve hayvan tamamen (bir bacak tutam herhangi bir tepki olmadan) sedasyon olmak için yaklaşık 45 dakika beklemek zorunda beher kapsamaktadır. </li><li> Daha sonra temiz bir alüminyum folyo üzerine sırtında hayvan koyun sabunla yıkayın kurbağayı ve musluk suyu ile durulayın. </li><li> Karın yan kısmında ve forseps ile yumurtalıklar düzeyinde cildi Kelepçe.Etanol% 70 ile kullanılmadan önce temizlenmelidir makasla yaklaşık 1 cm&#39;lik bir kesi olun. Bölüm yeterince derin olduğundan emin olun ve çeşitli gelişim aşamalarında çeşitli oosit bulundu edildiği yumurtalık dokusunun çıkarılmasını sağlamak için altta yatan karın duvarı ulaşmak için. </li><li> ND96 ortamı (96 mM NaCI, 2 mM KCI ile bir Petri kabı (50 mm) olanağına 4 kez yıkayın, yumurtalık loblar teşrih, 1 mM MgCl2, 1,8 mM CaCl2, 5 mM HEPES, NaOH ile pH 7.4&#39;e ayarlanmış takviye 50 ug / ml streptomisin / penisilin, 225 ug / ml sodyum piruvat, / ml soya fasulyesi tripsin inhibitörü, 30 ug, 1 ul / ml tetrasiklin) kan ve döküntü tüm izlerini silmek için. Not: Tetrasiklin optimal koruma ve mikroenjeksiyon tedavisi sonrası iyi bir iyileşme sağlar. </li><li> Bir hafta boyunca kendi koruma sağlayan, 14 ° C &#39;de ortam içine kapalı bir Petri tabağına saklayın. </li><li> Karın duvarı ve veteriner emilebilir t ile cildi Dikişhread ve dikiş iğnesi (3 ya da 4 dikiş gerekli olacaktır). </li><li> Su olmadan beher hayvan koyun ve kurbağa tekrar hareket kadar musluk suyu ile cildi nemli. Kaçmasını önlemek için beher örtün. </li><li> 10-kat büyütmeli bir stereomikroskop altında forseps 2 çiftleri kullanılarak dikkatli bir şekilde 5 ila 10 oosit gruplarda orta yumurtalık loblar ayırın. Sahne VI Seçin oositler. Bu, kahverengi bir pigmentli hayvan kutup çapında 10 1.2 mm ii) boyutları her türlü açık bir kayış ile ayrılan sarı bir bitki kutuplu i) kendi şekil ve renk tanınabilir. </li><li> (Kolajenaz oosit / folikül hücresi bağlantısına digests) oosit defolliculation kolaylaştırmak için 45 dakika boyunca hafif hafif çalkalamak suretiyle bir Petri kabındaki (tetrasiklin olmayan ND96 içinde çözülmüş Clostridium histolyticum&#39;dan, 1 mg / ml kollajenaz A) kolajenaz çözeltisi seçilen oositlerin inkübe edin. ND96 ortam ile 3 ya da 4 kez 14 tutulan oosit durulayın° C. Not: oosit az ya da oosit yüzey proteinleri tahrip ve yoksul canlılığı neden riski nedeniyle fazla 45 dakika inkübe etmeyin. Kollajenaz tedavisi kendiliğinden GVBD indükleyebilir. </li><li> 3-4 saat boyunca ortam içinde oosit inkübe edin. Binoküler büyüteç altında ince cımbız ile foliküler hücreleri çıkarın ve ND96 ortamında 19 ° C&#39;de saklayın. </li></ol> MRNA Synthesis 2. Hazırlık <ol><li> I enzim PME ile enzimatik sindirme ile aşağıdaki plazmidlerle 5 ug Linearize. NOT: pcDNA6.2 / a 1599 amino asitler eIF4G1 cDNA vahşi tip (eIF4G1-WT; NM_198241) içeren V5-DEST mutasyonları c.2105T ile, bir eIF4G1 dominant negatif cDNA (eIF4G1-DN) içeren pcDNA6.2 / V5-DEST &gt; G c.2106A&gt; C, c.2120-&gt; G, c.2122T&gt; A, 2125T&gt; - ve c.2126T&gt; G karşılık gelen protein içindeki 618 pozisyonuna 612 eIF4G1 ve eIF4E arasındaki etkileşim bölgesinde rahatsız etkileşim between eIF4G1 ve eIF4E 8 chloramphenicol acetyl transferase ihtiva eden pcDNA6.2 / C-EmGFP (GFP). 3 plazmidlerin her biri için 2 karışımları hazırlayın: I enzim de dahil olmak üzere, ilk ve ikinci PME kontrol olarak enzimsiz. </li><li> Klasik bir etanol prosedürü kullanılarak plazmid DNA çökelti ve nukleazsız H2O 20 ul içinde tekrar süspansiyon haline getirin </li><li> Bir spektrofotometre kullanılarak konsantrasyonunu belirleyin. Konsantrasyon cRNA yazıya ul 150 ng / üstün olmalıdır. </li><li> Plazmid doğrusallaştırma doğrulamak için 1 ul numune ve% 0.8 agaroz jeli üzerinde yükleme tamponu, 5 ul ile kontrol çalıştırın. </li><li> In vitro transkripsiyonu, üreticinin talimatlarına göre cRNA saflaştırılması için bir kit kullanın. Transkribe cRNA, nukleazsız H2O 20 ul içinde tekrar süspanse edilir Gerekirse Numuneler -80 ° C&#39;de saklanabilir. </li><li> 0.2 M MOPS (pH 7.0), 20 m ihtiva MOPS 10X geçiş tamponu hazırlayınM sodyum asetat ve 10 mM EDTA (pH 8.0). 0.45 um filtre ile çözelti sterilize edin. Çözelti oksidasyonu önlemek için oda sıcaklığında ışıktan korunur çözelti stok. </li><li> NaOH, HCl ile art arda elektroforez tankı temizleyin ve iyice bir O çift-filtrelenmiş su ile durulanır / N RNAaz ari önlemek ve RNA bozulmasını önlemek için. </li><li> MOPS ve formaldehit içeren% 1.5 agaroz jel Cast. Tam agaroz çözülünceye kadar sıcak ve 55 ° C&#39;ye kadar soğumasını bekleyin. Davlumbaz altında, MOPS 10X 0.1 hacim, formaldehit% 6.6 ve etidyum 4 mikrogram (10 mg / ml) ekleyin. Davlumbaz altında jel dökün ve jel sertleşmesine yaklaşık 1 saat bekleyin. Not: Formaldehit ve etidyum bromür toksiktir. </li><li> CRNA 1 ul, formaldehit% 8.8, formamit 60 ve% MOPS 10X 0,1 hacmi ile 0.2 ml tüp içinde göç örnekleri hazırlayın. 70 ° C &#39;de 3 dakika süre ile inkübe edilir ve 10 dakika süreyle buz üzerinde tüpler koydu. Santrifüj örnekleri Birkaç saniye at5000 x g. , Jel yükleme tampon maddesi, 2 ul ekle. Not: Formamid toksiktir. </li><li> 90V, 20 dakika boyunca numune çalıştırın. CRNA kalitesini kontrol etmek için analiz etmeden önce jel destain için nukleazsız H 2 OO / N jel bekletin. </li><li> Bir spektrofotometre kullanılarak cRNA konsantrasyonunu belirleyin ve -80 ° C&#39;de saklayın. </li></ol> Sentezlenen RNA ve Oosit Olgunlaşma Uyarım 3. Mikroenjeksiyon <ol><li> Oosit mikroenjeksiyon için gerekli ekipman hazırlayın. Küçük cam kapiller çekmek için bir mikropipet çektirmesi kullanın. Stereomicroscope altında, kör bir uç oluşturmak için cımbız ile kılcal ekstremite kesiyorum. Karşı ucunda, bir Millipore 0,45 mikron filtre ile 1 ml şırınga kullanarak, mineral yağ ile kılcal mikropipet doldurun. Mikroenjeksiyon pipet üzerine mikropipet monte edin. Uygun cam kapiller ile kullanıldığında iyi doğruluk vermek için üretici tarafından kalibre doğru mikropipet seçin. </li><li> Mikroenjeksiyon defolliculation sonra 1-2 saat gerçekleştirin, oosit üzerinde oosit kurtarma için gerekli gecikme 14 ° C&#39;de muhafaza. Alt Kullan Petri kapları oositler için bir yapıştırıcı yüzey oluşturmak ve ND96 ortamı onları doldurmak için forseps ile kazınır. </li><li> 45 ° C &#39;lik bir açıda kılcal mikropipet ile oosit ardışık enjekte etmeyi sağlamak bir Petri kabındaki kazınmış şerit boyunca oosit düzenlemek. </li><li> Sitoplazmada örneklerin optimal difüzyonu için pigmentli, hayvan alanının altında, oosit ekvatoryal mıntıkasında enjekte edilir. Derinliği yaklaşık 150-200 mikron üzerinde kılcal ucu sadece ince bir kısmını yerleştirin. </li><li> Bir birinci oosit içinde 60 nl bir hacimde farklı plazmid sırasıyla elde edilen cRNA 30 ng enjekte edilir. Enjeksiyon sonrası, numune kaçış (Şekil 2A) önlemek için kılcal ucu çıkarmadan önce 5-10 saniye bekleyin. Not: 120 nl aşmayın. Yavaş olabildiğince enjekte edilir. Damıtılmış su olan bir kontrol yapılması tavsiye edilir. </li><li> Bir sonraki oositi enjekte elle Petri kabı taşıyın. Not: İpucu 2 ila 3 microinjections sonra banyo solüsyonu dışarı küçük bir darbe oluşturarak tıkanmış olmadığından emin olun. </li><li> 24 kuyu kültür plakaları içinde Aktarım enjekte edilmiş oositler (10 oosit / oyuk), taze ND96 ortamının 3 ml ile doldurulur ve 19 ° C&#39;de bırakın. </li><li> , 19 ° C de mayoz olgunlaşmasını (GVBD) tetiklemek için progesteron (PG) (2 ug / ml) ile ND96 içinde oosit inkübe 15 saat veya pcDNA6.2 / V5-DESTeIF4G1 ve pcDNA6 sırasıyla elde edilen poliadenile edilmiş cRNAs mikroenjeksiyon 4 saat sonra 0,2 / C-EmGFP bir kontrol (Şekil 2A) olarak kullanılır. Not: cRNA ile floresan markör ortak enjeksiyonu cRNA enjekte edilmiş ve oosit kalmıştır sağlamak için iyi bir araçtır. GFP etiketi ile ilgi bir cRNA kullanarak bu tür ön deneyler yapın. </li><li> Microinject olarak içerisinde 3,5 farklı oranları (1: 3; 2: 2: 3: 1) te üzere eIF4G1-WT ve eIF4G1-DN cRNAs poliadenile arasındast mutant fenotipinin (Şekil 2B) üzerindeki eIF4G1-WT cRNAs translasyon etkisi. </li></ol> 4. Germinal Vesikül Arıza Tespiti <ol><li> Bir stereomikroskopta siyah hayvan kutup beyaz bir nokta varlığını gözlemleyerek PG uyarıldıktan sonra olgun oosit sayısını. 20-4 saat (Şekil 2B, 2C) kadar saymaya her saat tekrarlayın. </li></ol> 5. Western Blot (WB) analizi <ol><li> 50 mM Hepes, pH 7.4, 500 mM NaCl,% 0.05 SDS, 5 mM MgCI2, 1 mg aşağıdaki tampon maddesi içinde 200 ul 4 ° C &#39;de, 10 arka oositler ve bir mikro pipet ile ortaya hareketlerin grubu homojenize / ml büyükbaş hayvan serum albümini, 10 mg / ml löpeptin, 10 mg / ml aprotinin, 10 mg / ml soya fasulyesi tripsin inhibitörü, 10 mg / ml benzamidin, 1 mM PMSF, 1 mM sodyum vanadat. </li><li> 10,000 x g&#39;de 15 dakika boyunca santrifüj örnekleri lipid (üst faz) ve zar (alt faz) f çıkarmak içinkasılma konsantrasyona. Protein konsantrasyonu belirlemek ve Laemmli veya Bis-Tris numune tamponu ile geri kalan tamamlamak için bir alikot depolamak, sitoplazmik bölümünü kazan (1: 1). Not: Bis-Tris jelleri ve yükleme tamponu hidrolizinden proteinleri koruyan daha nötr pH değerine sahip </li><li> 10 dakika boyunca 95 ° C&#39;de örneğin 20 ug ısıtın. Akrilamid jel kuyu içine her bir örnek yükleyin. Uygun tampon maddesi ile bir tankta jel yerleştirin. </li><li> 200 V&#39;de 1 saat boyunca bir elektroforez gerçekleştirme </li><li> TBS pH bir WB 8,0 Gerçekleştirmek (Tris-HCl 15 mM, NaCl 150 mM Tween% 0.1;% 10 bovin serum albümini), bir keçi anti-Aurora A / eg2 (1: 3000, 2 saat) ile birlikte ya da bir tavşan anti-ile -Aurora A / eg2-P (1: 4 ° C &#39;de 1000, O / N), fare anti-ERK2 (1: 3000, 2 saat), keçi anti-ERK2-P (Tyr204) (1: 3000, 2 saat 10.000, 2 saat) ve tavşan anti-Rsk (1:), tavşan anti-ay (1: 5000, 4 saat), tavşan anti-GFP (1: 3000, 2 saat) antibodies.Use fare anti-V5 antikorları (1 : yükleme kontrolleri gibi 1000, 2 saat) (). </li><li> YıkamaMembran 3 kez 10 dakika için TBS-Tween ile 1 saat inkübe edilir, 1 seyreltilerde bir anti-fare ya da anti-tavşan veya anti-keçi (IgM) bayır turpu peroksidazı etiketli ikincil antikor ya: 5000, 1: 7500 ve 1 : sırasıyla 5.000. </li><li> TBS-Tween 10 dakika süren 3 yıkama yapın ve Advanced ECL Detection sistemi ile antijen antikorlarının kompleksleri tespit. </li></ol> 6. Poliadenilasyon Deneyi <ol><li> Örnek 1.5 ml koşulu başına 5 oosit. Nukleazsız PBS 1X (pH 7.4), 1 ml ile yıkanır. Aşağıdaki adımlar davlumbaz altında yapılacaktır. </li><li> (Üretici talimatlarına bakın) klasik organik prosedür kullanılarak RNA ayıklayın. </li><li> 4 ° C&#39;de 5 dakika boyunca santrifüje (10000 x g) RNA kurtarmak. 10 dakika boyunca supernatant ve hava kuru RNA çıkarın. </li><li> Nukleazsız H2O 30 ul içinde süspanse RNA topağı </li><li> Yeni bir tüp içinde numunelerin 15 ul alın ve nukleazsız H 2 O 85 ul ekleyin Temizlemekse örnekleri, üreticinin talimatlarına uygun olarak silisyum dioksidin kolonu üzerinde kalitesini artırmak için. Nukleazsız H2O 30 ul kullanarak, RNA yı Zehir </li><li> RNA bütünlüğü kontrol etmek için bir% 0.8 agaroz jeli üzerinde yükleme tamponu 5 ul numune 1 ul çalıştırın. </li><li> Bir spektrofotometre kullanılarak RNA konsantrasyonu belirleyin. </li><li> Koşul başına 2 ligasyon karışımları hazırlanması (örneğin, eIF4G1-WT, eIF4G1-DN ve H2O kontrol), aşağıdaki reaktifleri ile: RNA ligaz 10 U, 10X tampon maddesi 0.1 hacim, 1 mM ATP, 50 PEG8000,%% 10 , primer P1 (5&#39;-P-GGTCACCTTGATCTGAAGC-NH2-3 &#39;) 11 ve nukleazsız H2O ile 10 ul son hacim getirmek 0.1 ug PG uyarılma olmaksızın oosit elde edilen ilk karışım RNA ekleyin ve PG elde edilen ikinci karışım RNA oosit uyarılmış. </li><li> Enzimler inaktive edildi, 65 ° C de 20 dakika ve sonra 37 ° C&#39;de 1 saat süreyle inkübe edin. </li><li> Bizeea cDNA Ters Transkripsiyon (RT) kiti. Tüp başına, RT karışım hazırlayın: 10X RT tamponu 0,1 hacim nukleazsız H primer P2 (5&#39;-GCTTCAGATCAAGGTGACCTTTTT) 10, 4 mM dNTP karışımı, ters transkriptazın 50 U ve 0.1 ug tam bir nihai hacme 2 O 10 ul. Yukarıda elde edilen ligasyon reaksiyonunun 10 ul ekle. Üretici tarafından tarif edilen koşullar altında RT gerçekleştirin. </li><li> (PCR) karışımı, tüp başına Polimeraz Zincir Reaksiyonu hazırlayın: tampon 10X 0.1 hacim, 1.5 mM MgCI2, 133 uM dNTP karışımı, 0.2 uM spesifik primer, 0.2 uM primer P2, 0.025 U Taq polimerazı, cDNA 1 ul ile komple nukleazsız 50 ul nihai hacme kadar H2O. Aşağıdaki koşullar altında PCR yapın: 50 ° C, 2 dakika, 10 dakika boyunca 95 ° C, [30 saniye için 1 dk için 95 ° C, 56 ° C, 30 sn için 72 ° C] için 40 döngü, 72 ° C 10 dakika 9. Şöyle spesifik primerler şunlardır: mos GTTGCATTGCTGTTTAAGTGGTAA Histon benzeri B4 AGTGACAAACTAGGCTGATATACT; Siklin A1, CATTGAACTGCTTCATTTTCCCAG; Siklin B1: GTGGCATTCCAATTGTGTATTGTT 9. </li><li> % 3 agaroz jel hazırlayın. Her bir PCR ürünlerinin yükleme tamponu 10 ul ekle. Optimal göç 110 V numunelerin 10 ul jel çalıştırın. Tercümelerine için bir ön koşuldur kuyruk poli (A) ve böylece RNA olgunlaşma süresini yansıtan boyutta bir değişikliği gözlemek için 10 ve 20 dakika sonra jel analiz eder. </li></ol>

<ol>
	<li>Jackson, R. J., Hellen, C. U., Pestova, T. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+eukaryotic+translation+initiation+and+principles+of+its+regulation.">The mechanism of eukaryotic translation initiation and principles of its regulation.</a> Nat Rev Mol Cell Biol. 11 (2), 113-127 (2010).</li><li>Holcik, M., Sonenberg, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+stress+and+apoptosis.">Translational control in stress and apoptosis.</a> Nat Rev Mol Cell Bio. 6 (4), 318-327 (2005).</li><li>Lopez-Lastra, M., Rivas, A., Barria, M. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+synthesis+in+eukaryotes:+the+growing+biological+relevance+of+cap-independent+translation+initiation.">Protein synthesis in eukaryotes: the growing biological relevance of cap-independent translation initiation.</a> Biol Res. 38 (2-3), 121-146 (2005).</li><li>Terenin, I. M., Andreev, D. E., Dmitriev, S. E., Shatsky, I. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+mechanism+of+eukaryotic+translation+initiation+that+is+neither+m7G-cap-,+nor+IRES-dependent.">A novel mechanism of eukaryotic translation initiation that is neither m7G-cap-, nor IRES-dependent.</a> Nucleic Acids Res. 41 (3), 1807-1816 (2013).</li><li>Sonenberg, N., Hinnebusch, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+translation+initiation+in+eukaryotes:+mechanisms+and+biological+targets.">Regulation of translation initiation in eukaryotes: mechanisms and biological targets.</a> Cell. 136 (4), 731-745 (2009).</li><li>Van der Knaap, M. S., Leegwater, P. A., K&#246;nst, A. A., Visser, A., Naidu, S., Oudejans, C. B., Schutgens, R. B., Pronk, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+each+of+the+five+subunits+of+translation+initiation+factor+eIF2B+can+cause+leukoencephalopathy+with+vanishing+white+matter.">Mutations in each of the five subunits of translation initiation factor eIF2B can cause leukoencephalopathy with vanishing white matter.</a> Ann Neurol. 51 (2), 264-270 (2002).</li><li>Sen&#233;e, V., Vattem, K. M., Del&#233;pine, M., Rainbow, L. A., Haton, C., Lecoq, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolcott-Rallison+Syndrome:+clinical,+genetic,+and+functional+study+of+EIF2AK3+mutations+and+suggestion+of+genetic+heterogeneity.">Wolcott-Rallison Syndrome: clinical, genetic, and functional study of EIF2AK3 mutations and suggestion of genetic heterogeneity.</a> Diabetes. 53 (7), 1876-1883 (2004).</li><li>Chartier-Harlin, M. C., Dachsel, J. C., Vilari&#241;o-G&#252;ell, C., Lincoln, S. J., Lepr&#234;tre, F., Hulihan, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translation+initiator+EIF4G1+mutations+in+familial+Parkinson+disease.">Translation initiator EIF4G1 mutations in familial Parkinson disease.</a> Am J Hum Genet. 89 (3), 398-406 (2011).</li><li>Charlesworth, A., Cox, L. L., MacNicol, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+polyadenylation+Element+(CPE)-+and+CPE-binding+Protein+(CPEB)-independent+mechanisms+regulate+early+class+maternal+mRNA+translational+activation+in+Xenopus+oocytes.">Cytoplasmic polyadenylation Element (CPE)- and CPE-binding Protein (CPEB)-independent mechanisms regulate early class maternal mRNA translational activation in Xenopus oocytes.</a> J Biol Chem. 279 (17), 17650-17659 (2004).</li><li>Dumont, J. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oogenesis+in+Xenopus+laevis.">Oogenesis in Xenopus laevis.</a> J Morphol. 136, 153-180 (1972).</li><li>Rassa, J. C., Wilson, G. M., Brewer, G. A., Parks, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spacing+constraints+on+reinitiation+of+paramyxovirus+transcription:+the+gene+end+U+tract+acts+as+a+spacer+to+separate+gene+end+from+gene+start+sites.">Spacing constraints on reinitiation of paramyxovirus transcription: the gene end U tract acts as a spacer to separate gene end from gene start sites.</a> Virology. 274, 438-449 (2000).</li><li>Lin, W., Wadlington, N. L., Chen, L., Zhuang, X., Brorson, J. R., Kang, U. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loss+of+PINK1+attenuates+HIF-1&#945;+induction+by+preventing+4E-BP1-dependent+switch+in+protein+translation+under+hypoxia.">Loss of PINK1 attenuates HIF-1&#945; induction by preventing 4E-BP1-dependent switch in protein translation under hypoxia.</a> J Neurosci. 34 (8), 3079-3089 (2014).</li><li>Martin, I., Kim, J. W., Lee, B. D., Kang, H. C., Xu, J. C., Jia, H. 2., Stankowski, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribosomal+protein+s15+phosphorylation+mediates+LRRK2+neurodegeneration+in+Parkinson's+disease.">Ribosomal protein s15 phosphorylation mediates LRRK2 neurodegeneration in Parkinson's disease.</a> Cell. 57 (2), 472-485 (2014).</li><li>Cohen, S., Au, S., Pant&#233;, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microinjection+of+Xenopus+laevis+oocytes.">Microinjection of Xenopus laevis oocytes.</a> J Vis Exp. (24), (2009).</li><li>Willis, J., DeStephanis, D., Patel, Y., Gowda, V., Yan, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Study+of+the+DNA+damage+checkpoint+using+Xenopus+egg+extracts.">Study of the DNA damage checkpoint using Xenopus egg extracts.</a> J Vis Exp. (69), e4449 (2012).</li><li>Keiper, B. D., Rhoads, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+recruitment+of+Xenopus+maternal+mRNAs+in+response+to+poly(A)+elongation+requires+initiation+factor+eIF4G-1.">Translational recruitment of Xenopus maternal mRNAs in response to poly(A) elongation requires initiation factor eIF4G-1.</a> Dev Biol. 206 (1), 1-14 (1999).</li><li>Wakiyama, M., Imataka, H., Sonenberg, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interaction+of+eIF4G+with+poly(A)-binding+protein+stimulates+translation+and+is+critical+for+Xenopus.oocyte+maturation.">Interaction of eIF4G with poly(A)-binding protein stimulates translation and is critical for Xenopus.oocyte maturation.</a> Curr Biol. 10 (18), 1147-1150 (2000).</li><li>Sheets, M. D., Wu, M., Wickens, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyadenylation+of+c-mos+mRNA+as+a+control+point+in+Xenopus+meiotic+maturation.">Polyadenylation of c-mos mRNA as a control point in Xenopus meiotic maturation.</a> Nature. 374 (6522), 511-516 (1995).</li><li>Gebauer, F., Richter, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+and+function+of+Mos:+the+control+switch+of+vertebrate+oocyte+meiosis.">Synthesis and function of Mos: the control switch of vertebrate oocyte meiosis.</a> Bioessays. 19 (1), 23-28 (1997).</li><li>Le Sommer, C., Lerivray, H., Lesimple, M., Hardy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xenopus+as+a+model+to+study+alternative+splicing+in+vivo.">Xenopus as a model to study alternative splicing in vivo.</a> Biol Cell. 99 (1), 55-65 (2007).</li><li>Au, S., Cohen, S., Pant&#233;, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microinjection+of+Xenopus+laevis.oocytes+as+a+system+for+studying+nuclear+transport+of+viruses.">Microinjection of Xenopus laevis.oocytes as a system for studying nuclear transport of viruses.</a> Methods. 51 (1), 114-120 (2010).</li><li>Gotoh, T., Villa, L. M., Capelluto, D. G., Finkielstein, C. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulatory+pathways+coordinating+cell+cycle+progression+in+early+Xenopus+development.">Regulatory pathways coordinating cell cycle progression in early Xenopus development.</a> Results Probl Cell Differ. 53, 171-199 (2011).</li><li>Schmidt, E. K., Clavarino, G., Ceppi, M., Pierre, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SUnSET,+a+nonradioactive+method+to+monitor+protein+synthesis.">SUnSET, a nonradioactive method to monitor protein synthesis.</a> Nat Methods. 6 (4), 275-277 (2009).</li><li>Moreno, J. A., Halliday, M., Molloy, C., Radford, H., Verity, N., Axten, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+treatment+targeting+the+unfolded+protein+response+prevents+neurodegeneration+and+clinical+disease+in+prion-infected+mice.">Oral treatment targeting the unfolded protein response prevents neurodegeneration and clinical disease in prion-infected mice.</a> Sci Transl Med. 5 (206), 206ra138 (2013).</li><li>Doyle, K. M., Kennedy, D., Gorman, A. M., Gupta, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unfolded+proteins+and+endoplasmic+reticulum+stress+in+neurodegenerative+disorders.">Unfolded proteins and endoplasmic reticulum stress in neurodegenerative disorders.</a> J Cell Mol Med. 15 (10), 2025-2039 (2011).</li><li>Gandin, V., Sikstr&#246;m, K., Alain, T., Morita, M., McLaughlan, S., Larsson, O., Topisirovic, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+fractionation+and+analysis+of+mammalian+translatomes+on+a+genome-wide+scale.">Polysome fractionation and analysis of mammalian translatomes on a genome-wide scale.</a> J Vis Exp. (87), e51455 (2014).</li></ol>

The authors have nothing to disclose.

Tercüme birkaç nörodejeneratif hastalıklar dahil olmak üzere sayısız insan bozukluklarının patofizyolojisinde rol bir mekanizmadır. Parkinson hastalığında Örneğin çeşitli raporlar kalıtsal mutasyonlara 8,12,13 ile bağlantılı tercüme edilen değer göstermiştir. Çeşitli hücresel modeller çeviri incelemek için kullanılabilir. Burada, eIF4G1 ve eIF4E mümkün 8 arasındaki etkileşimi azaltmak gibi baskın negatif mutasyonu hareket eIF4G1 bir m...

Proteinler organizmanın daha büyük ölçekte temel hücresel yaşam elemanları ve bu nedenle bulunmaktadır. Onlar yapısı, ulaşım, reaksiyon kataliz, yönetmelik, gen ifadesi vb Onların ifade protein içine bir mRNA&#39;nın dönüşümünü sağlayan çeviri karmaşık bir mekanizmanın sonucudur içeren hücresel fonksiyonlarının çoğunu sağlamaktadır. Için uyarlamak ve gelişme ve farklılaşma, yaşlanma, fizyolojik baskılara ya da patolojik seyri sırasında, hücre ihtiyaçlarına göre gen ifadesini düzenlemek için çeşitli kontroller tabi tutulur. Kap-bağımlı, kap-bağımsız İç Ribozom Giriş Segment (IRES) yapıları ve kap-Bağımsız Çeviri arttırıcılar (via: Çeviri 3 başlatma çeviri sistemleri bu ihtiyaçlara cevap vermek amacıyla, 3 aşamadan (başlatma, uzama ve sonlandırma) ve hediyeler ayrılmıştır ) CITE. Çoğu eukaryotik mRNA bir kap-Depe çevrilirProtein sentezi sırasında bir tanıma özelliği olarak hizmet vermektedir 7-methylguanosine 5&#39;-trifosfat kapağı aracılığıyla ndent şekilde. Bu kapak eIF4E, eIF4G1 ve eIF4A ile eIF4F kompleksi bileşenine bağlanır. Poli (A) bağlayıcı protein (PABP) gibi diğer ortaklarla ilişkili elF2-GTP-Met-tRNA Met, bu çeviri başlatma faktörleri mRNA sirküler ve tanınması 1 kodon Ağustos başlatılması kadar formlara 43S kompleksi olan erişilebilirliği iyileştirmek için izin verir. Bu olay, translasyon başlatma yani, çeviri birinci etabının sonuna karşılık gelmektedir. Cap bağımsız için, örneğin hücre çoğalmasının ve apoptozun için neden stresli koşullar altında esas proteinler için kodlayan mRNA tarafından kullanılır. Bu mekanizma, mRNA ikincil yapısını içerir 5&#39;-çevrilmemiş bölümü (UTR) IRES adlandırılan eIF4A ve 43S kompleksi ile ilişkili eIF4G1 karboksi-terminal ucu. Bu 43S, ön başlatma c bağlanmasınınIRES için omplex eIF4E faktörü 2,3 gerek kalmadan kapak bağımsız çeviri başlatır. MRNA UTR 4 içinde yer alan yapıların CITE aracılığıyla Nihayet, yine iyi anlaşılmış değildir başka bir çeviri mekanizması vurguladı şartlar altında bu kap-bağımsız çeviri etkinliğini destekler. Kendi başlatma aşamalarının göre farklı tercüme bu çeşitli modları ile, çeviri, hücresel homeostazında kritik bir rol ve böylece büyük ölçekli etkileri küçük organizmaya etkisi olur, bu işlemlerin biri herhangi bir değişiklik oynar. Nitekim, başlatma proteinlere mRNA doğru çeviri süreçlerini yöneten bir oran sınırlayıcı bir adımdır ve bu nedenle çok sayıda kontrol ve düzenleme noktalarının 5 hedefidir. Ikincisi için ya da bu işlemlerin bileşenleri için olsun biri arızalı olduğu ortaya çıkarsa, bu hücrede kurulan dengeyi bozacak ve böylece patolojik Condi yol açabilirleri. Bu bağlamda, çeviri faktörlerinin mutasyonlar, potansiyel olarak, beyaz matter&#39; (eIF2B1-5 alt-birimi) 6, Walcott-Rallison sendromunda (Perk için EIF2AK3 kodlayan gen) 7, ufuk ile lökoensefalopati `gibi nörodejeneratif bozukluklar dahil olmak üzere çeşitli hastalıklarda yer almışlardır Parkinson hastalığı (eIF4G1 p.R1205H) 8. Bu hastalık gelişimi üzerine ve çeviri inisiyasyon genel sürecine bilgimizi artırmak için bu mutant proteinlerin hücresel ve moleküler çalışmalar yapmak için bu nedenle önemlidir. Bu çalışmaları yürütmek için, bu mutasyonların sonuçlarını gözlemlemek için en uygun modelleri seçmek için esastır Xenopus oositler, özellikle de onların fizyolojik ve biyokimyasal özellikleri nedeniyle uyarlanmış laevis. Fizyolojik eşzamanlılık (hücre döngüsünün faz G2 bloke) , protein sentezinin yüksek kapasiteli (200-400 ng / gün / oosit), ekstre solüsyonu ° yüksek sayıdaaynı hayvandan ytes (800-1.000 oosit / kadın) ve manipülasyonunu daha da kolaylaştırır hücre boyutu (çapı 1.2-1.4 mm). Sentezlenen mRNA ile Xenopus oosit Mikroenjeksiyon kolayca tercüme adımları incelemek için yapılabilir. Bu görüşe göre, diğer avantajlar sağlar. Mayoz ilerleme hızı ve çevirinin mRNA mikroenjeksiyon (~ 24 saat) sonra göz önüne alındığında, Xenopus oosit yeniden hücresel (E.coli çıkarılan, buğday mikroplar veya tavşan retikülosit ...) sistemleri bir mRNA olduğu karşılaştırıldığında hızlı bir sistemi temsil azaltılmış tercüme oranıyla ve düşük bir hızda çevrilmiştir. Yani, bir mRNA tanıtılan bir mutasyonun etkisi hızla gözlemlenebilir ve kolayca birkaç oositlerinde okudu olacaktır. Xenopus oositleri diğer bir avantajı, maternal mRNA&#39;lar latent ve protein için projesteron uyarması önce engellenmiş olmasıdır. Progesteron eklenmesi dolayısıyla çeviri indüksiyon kontrol için iyi bir araçtır. Sitoplazmik polyadenylation oogenez sırasında meydana gelmez. Bu zamansal sırayla progesteron uyarılmış oosit oosit olgunlaşması sırasında başlar ve erken gelişme boyunca devam eder ve çevirinin farklı adımları incelemek için kullanılabilir. Mos mRNA poliadenilasyon meydana ilk arasındadır ve Charlesworth ark tanımlanan &quot;erken olgunlaşma&quot; genlerin sınıfına Aurora A / EG2, Histone Benzeri B4 mRNA ile aittir. (2004) 9. Böyle Cyclin A1 ve B1 Siklin olarak &quot;geç&quot; mRNA öteleme indüksiyon germinal vezikül arıza (GVBD) zamanında etrafında oluşur. Mos mRNA, bir serin / treonin protein kinazın-kodlar. Dolaylı oosit olgunlaşmasını aktive MAP kinaz kaskad indükler beri çeviri önemlidir. Gerçekten de, progesteron tepki olarak, mos mRNA poliadenilasyon eg2 düzenleyici proteinleri ve inci başka RNA bağlanma proteinleri Aurora A / kapsayan bir işlem ile arttırılırmos mRNA&#39;nın e 3&#39;UTR içerir. Mos mRNA bu artan poliadenilasyon da MEK1 aktive mos proteini seviyesinin bir artışa yol açar. Bu işlem, hücre dışı bir sinyal ayarlı kinaz 2-(ERK2) (Şekil 1) ait aktivasyon aracılık eder. Bu sinyal yolunun daha sonra faktör teşvik olgunlaşma M-fazı, Siklin B, Cdc2 kinaz tarafından oluşturulan bir kompleks tetikler ve sonunda öz değişmesine ait yeniden başlamasını sonuçlanır olabilir. Xenopus oosit laevis nedenle, bu tür mos gibi anne mRNA çalışma kolayca birkaç mos, bileşenler sinyal de GVBD oranının belirlenmesi de dahil olmak üzere çeviri onların verimli poliadenilasyonu birkaç uç noktaları ile çevirilebilirlik test etmek için kullanılabilir. Bu sistem, yeni transkripsiyonu mRNA veya transfeksiyon verimlilik müdahalesi olmadan çeviri başlatma faktörleri mutasyonların ilk sonuçlarını değerlendirmek, bu nedenle ilginç sorunlar sıklıkla eukary ile meydana gelenotik hücre çalışmaları. Burada, bir protokol Xenopus oosit laevis ve anne mRNA çeviri test edilir mutant eIF4G1 mRNAlar microinjected nerede kurulmuştur. Oosit mayoz hücre döngüsü boyunca ve erken ve geç sınıf mRNA&#39;larının sonraki çeviri için ilerlemesi için gerekli olan bir GVBD ilerlemesinde defekt, mos mRNA polidenilasyondan huzurunda tespit edilmiştir. Fosforilasyonu Aurora A / EG2 ve ERK de mos deregulation.Thus sonucunu doğrulamak için çalışılmıştır, Xenopus oositler mRNA çeviri farklı adımlar analiz için basit bir yol gösterir.

<table><tbody><tr><td>Tricaine methane sulphonate</td><td>Sandoz</td><td>MS-222</td><td>oocytes handling</td></tr><tr><td>Forceps</td><td>Moria</td><td>Dumont MC40</td><td></td></tr><tr><td>Streptomycin/penicillin</td><td>Sigma</td><td>781</td><td></td></tr><tr><td>Sodium pyruvate</td><td>Sigma</td><td>P2256</td><td></td></tr><tr><td>Soybean trypsin inhibitor</td><td>Sigma</td><td>T9128</td><td></td></tr><tr><td>Tetracyclin</td><td>Sigma</td><td>T7660</td><td></td></tr><tr><td>Veterinarian absorbable Vicryl thread</td><td>Johnson&amp;amp;Johson Intl</td><td>JV1205</td><td></td></tr><tr><td>Collagenase A</td><td>Roche diagnostics</td><td>10103586001</td><td></td></tr><tr><td>PmeI</td><td>New England Biolabs</td><td>R0560S</td><td>Preparation of synthetic mRNA</td></tr><tr><td>DNAse/RNAse free H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Life Technologies</td><td>10977</td><td></td></tr><tr><td>Sodium Acetate</td><td>Merck</td><td>6268</td><td></td></tr><tr><td>Absolute ethanol</td><td>Sigma</td><td>02854</td><td></td></tr><tr><td>Nano Drop</td><td>Thermo Scientific</td><td></td><td></td></tr><tr><td>TBE 10X</td><td>Eppendorf</td><td>0032006.507</td><td></td></tr><tr><td>Ethidium bromide 10 mg/ml</td><td>Life Technologies</td><td>15585-011</td><td></td></tr><tr><td>mMESSAGE mMACHINE Kit</td><td>Ambion by Life Technologies</td><td>AM1344</td><td></td></tr><tr><td>MOPS</td><td>Sigma</td><td>M1254</td><td></td></tr><tr><td>EDTA</td><td>Fluka</td><td>03609</td><td></td></tr><tr><td>Agarose</td><td>Life Technologies</td><td>16500-500</td><td></td></tr><tr><td>Formaldehyde 37%</td><td>Merck</td><td>1.04003.1000</td><td></td></tr><tr><td>Formamide</td><td>Fluka</td><td>47671</td><td></td></tr><tr><td>Gel Doc Imager</td><td>Biorad</td><td></td><td></td></tr><tr><td>Oocyte Pipet with 100 8&quot; Glass Capillaries</td><td>Drummond Scientific Company</td><td>3-000-510-X</td><td>microinjection</td></tr><tr><td>Replacement Glass 8&quot;</td><td>Drummond Scientific Company</td><td>3-000-210-G8</td><td></td></tr><tr><td>0.45 &amp;micro;m filter</td><td>Millipore</td><td>SLHA025NB</td><td></td></tr><tr><td>Progesterone</td><td>Sigma</td><td>P0130</td><td></td></tr><tr><td>Hepes</td><td>Sigma</td><td>H3375</td><td>Western Blot</td></tr><tr><td>NaCl</td><td>Sigma</td><td>S5886</td><td></td></tr><tr><td>SDS</td><td>Biorad</td><td>161-0301</td><td></td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma</td><td>A3294</td><td></td></tr><tr><td>Bovine serum albumin</td><td>Sigma</td><td>A4612</td><td></td></tr><tr><td>leupeptin</td><td>Sigma</td><td>L8511</td><td></td></tr><tr><td>aprotinin</td><td>Sigma</td><td>A1153</td><td></td></tr><tr><td>benzamidine</td><td>Sigma</td><td>B6506</td><td></td></tr><tr><td>PMSF</td><td>Sigma</td><td>P7626</td><td></td></tr><tr><td>sodium vanadate</td><td>Sigma</td><td>S6508</td><td></td></tr><tr><td>Laemmli buffer</td><td>Biorad</td><td>161-0737</td><td></td></tr><tr><td>NuPAGE Novex 4-12% Bis-Tris Protein Gels, 1.0 mm, 15 well</td><td>Life Technologies</td><td>NP0323BOX</td><td></td></tr><tr><td>SDS-PAGE electrophoresis, mini-Protean TGX</td><td>Biorad</td><td>456-1036 and -1096</td><td></td></tr><tr><td>horizontal semi-dry blotting system</td><td>W.E.P. Compagny</td><td></td><td></td></tr><tr><td>Glycine</td><td>Biorad</td><td>161-0718</td><td></td></tr><tr><td>Tris-HCl</td><td>Biorad</td><td>161-0719</td><td></td></tr><tr><td>Hybond ECL Membrane</td><td>Amersham Life Science</td><td>10401180</td><td></td></tr><tr><td>Methanol</td><td>VWR</td><td>20846-292</td><td></td></tr><tr><td>Ponceau Red (0.5%)</td><td>Sigma</td><td>P3504</td><td></td></tr><tr><td>Tween 20</td><td>Sigma</td><td>P2287</td><td></td></tr><tr><td>anti-GFP</td><td>Life Technologies</td><td>A11122</td><td></td></tr><tr><td>anti-V5</td><td>Santa Cruz Biotechnology</td><td>sc-58052</td><td></td></tr><tr><td>anti-Eg2</td><td>Santa Cruz Biotechnology</td><td>sc-27884</td><td></td></tr><tr><td>anti-Eg2-P</td><td>Cell Signaling</td><td>C39D8</td><td></td></tr><tr><td>anti-ERK2</td><td>Santa Cruz Biotechnology</td><td>sc-1647</td><td></td></tr><tr><td>anti-ERK2-P (Tyr204)</td><td>Santa Cruz Biotechnology</td><td>sc-7976</td><td></td></tr><tr><td>anti-Rsk</td><td>Santa Cruz Biotechnology</td><td>sc-231</td><td></td></tr><tr><td>anti-mos</td><td>Santa Cruz Biotechnology</td><td>sc-86</td><td></td></tr><tr><td>anti-mouse horseradish peroxidase labeled secondary antibody</td><td>Santa Cruz Biotechnology</td><td>sc-2005</td><td></td></tr><tr><td>anti-rabbit horseradish peroxidase labeled secondary antibody</td><td>Santa Cruz Biotechnology</td><td>sc-2812</td><td></td></tr><tr><td>anti-goat horseradish peroxidase labeled secondary antibody</td><td>Santa Cruz Biotechnology</td><td>sc-2378</td><td></td></tr><tr><td>Advanced ECL Detection System</td><td>Amershan Life Science</td><td>RPN2135</td><td></td></tr><tr><td>PBS 1x</td><td>Sigma</td><td>P4417</td><td>polyadenylation assay</td></tr><tr><td>TRIZOL (Qiazol Lysis Reagent)</td><td>Qiagen</td><td>79306</td><td></td></tr><tr><td>Chloroform</td><td>Sigma</td><td>31998-8</td><td></td></tr><tr><td>Isopropanol</td><td>Sigma</td><td>278475-1L</td><td></td></tr><tr><td>RNeasy mini kit</td><td>Qiagen</td><td>74106</td><td></td></tr><tr><td>RTL buffer&amp;nbsp;</td><td>Qiagen</td><td>79216</td><td></td></tr><tr><td>RNAse free DNAse set</td><td>Qiagen</td><td>79254</td><td></td></tr><tr><td>Primers</td><td>Eurogentec</td><td></td><td></td></tr><tr><td>T4 RNA ligase 1&amp;nbsp;</td><td>New England Biolabs</td><td>M0204S</td><td></td></tr><tr><td>High capacity c-DNA Reverse Transcription kit</td><td>Applied Biosystems, Life Technologies</td><td>4368813</td><td></td></tr><tr><td>Taq polymerase</td><td>Life Technologies</td><td>10342020</td><td></td></tr></tbody></table>

xenopus laevis as a model to identify translation impairment

Protein sentezi, çeşitli biyolojik süreçleri çevresel koşullara özellikle adaptasyon etkileyen gen ifadesi temel bir süreçtir. MRNA başlangıç ​​kodonu da dahil olmak üzere ilgili eIF4G1 başlatma faktörü ribozomal alt birimlerinin düzenlenmesine içeren başlangıç ​​aşaması. Çevirinin bu oran sınırlayıcı bir aşama kusurlar, çeşitli bozuklukları ile bağlantılıdır. Bu tür özerkleştirmeler olası sonuçlarını incelemek için, Xenopus oositler insanla temel hücresel ve moleküler mekanizmaları korunması yüksek derecede çekici bir model teşkil laevis. Buna ek olarak, mayoz olgunlaşma sırasında, oosit transkripsiyonel bastırılmış ve gerekli tüm proteinleri önceden var, maternal mRNA&#39;lardan çevrilir. Bu ucuz modeli etkin bir çeviri ile mükemmel entegre olmak için eksojen mRNA sağlar. Burada (eIF4G1 here) ilgi konusu bir faktör ile çeviri değerlendirmek stor kullanmak için bir protokol açıklananİlk olduklarını anne mRNA ed poliadenile ve fizyolojik okuma olarak oosit olgunlaşması sırasında tercüme edilecek. İlk başta, mRNA ilgi plazmidler (buradan eIF4G1) in vitro transkripsiyonu ile sentezlenmiş oluşum safhası torbacığı yarılmasının tespiti ile oosit ve oosit olgunlaşma kinetiği enjekte edilir belirlenir. Çalışılan anne mRNA hedef, serin / treonin protein kinaz mos olup. Bu poliadenilasyon ve daha sonraki için oosit olgunlaşmasında yer alan sinyalleme kaskadında mos proteinlerinin ekspresyonu ve fosforilasyon ile birlikte incelenmiştir. Geçerli protokol Varyasyonları ortaya koymak için öteleme kusurları da genel uygulanabilirliğini vurgulamak için önerilmiştir. Anormal protein sentezinin nörolojik bozuklukların patogenezinde olabilir dair kanıtlar ortaya ışığında, böyle bir model kolayca bu bozukluğunu değerlendirmek ve yeni hedefler belirlemek için bir fırsat sunuyor.

PG stimülasyon 24 saat (Şekil 2B, 2C) sonra, Xenopus oositlerde ve yüzde oosit GVBD belirlenmesi kinetik olgunlaşma EIF4G1-DN mutasyon translasyon sonuçlarını incelemek için, Xenopus PG&#39;ye yanıtı (2 H, O, GFP) eIF4G1-WT ve diğer kontrol koşulları mukayese edilir cRNA eIF4G1-DN microinjected oosit laevis. Kontroller bakılmaksızın enjekte cRNA veya eIF4G1 aşın doğanın oosit mikroenjeksiyon insidansını değerlendir...

Watch this Scientific Journal Video about Xenopus laevis as a Model to Identify Translation Impairment at JoVE.com

Xenopus laevis as a Model to Identify Translation Impairment

Protein synthesis control occurs mainly at the translation initiation step, deficiencies in which are linked to diverse disorders. To better understand their etiology, we described here a protocol using Xenopus laevis oocytes assessing the translation of mos transcript in the presence of a mutant of translation initiation factor eIF4G1.

Ksenopus Translation Düşüklüğü Belirlemek için Bir Model Olarak laevis

Protein synthesis is a fundamental process to gene expression impacting diverse biological processes notably adaptation to environmental conditions. The ...

xenopus-laevis-as-a-model-to-identify-translation-impairment

Research

JoVE Journal

Biology

Xenopus laevis as a Model to Identify Translation Impairment

10.7K Görüntüleme.  INSERM UMR-S1172, CHRU Lille, University of Lille 1 and Lille 2. Protein synthesis control occurs mainly at the translation initiation step, deficiencies in which are linked to diverse disorders. To better understand their etiology, we described here a protocol using Xenopus laevis oocytes assessing the translation of mos transcript in the presence of a mutant of translation initiation factor eIF4G1.

Video: Xenopus laevis as a Model to Identify Translation Impairment

Quantitative Immunofluorescence to Measure Global Localized Translation

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and organogenesis, as well as in multiple diseases. Numerous publications have convincingly shown that specific mechanisms tightly regulate mRNA translation. Increased interest in the translation-induced regulation of protein expression has led to the development of novel methods to study and follow de novo protein synthesis in cellulo. However, most of these methods are complex, making them costly and often limiting the number of mRNA targets that can be studied. This manuscript proposes a method that requires only basic reagents and a confocal fluorescence imaging system to measure and visualize the changes in mRNA translation that occur in any cell line under various conditions. This method was recently used to show localized translation in the subcellular structures of adherent cells over a short period of time, thus offering the possibility of visualizing de novo translation for a short period during a variety of biological processes or of validating changes in translational activity in response to specific stimuli.

This manuscript describes a method to visualize and quantify localized translation events in subcellular compartments. The approach proposed in this manuscript requires a basic confocal imaging system and reagents and is rapid and cost-effective.

Nicel ayirt ölçmek küresel çeviri lokalize

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and ...

Biyokimya

Polysome Profiling in Leishmania, Human Cells and Mouse Testis

Proper protein expression at the right time and in the right amounts is the basis of normal cell function and survival in a fast-changing environment. For a long time, the gene expression studies were dominated by research on the transcriptional level. However, the steady-state levels of mRNAs do not correlate well with protein production, and the translatability of mRNAs varies greatly depending on the conditions. In some organisms, like the parasite Leishmania, the protein expression is regulated mostly at the translational level. Recent studies demonstrated that protein translation dysregulation is associated with cancer, metabolic, neurodegenerative and other human diseases. Polysome profiling is a powerful method to study protein translation regulation. It allows to measure the translational status of individual mRNAs or examine translation on a genome-wide scale. The basis of this technique is the separation of polysomes, ribosomes, their subunits and free mRNAs during centrifugation of a cytoplasmic lysate through a sucrose gradient. Here, we present a universal polysome profiling protocol used on three different models - parasite Leishmania major, cultured human cells and animal tissues. Leishmania cells freely grow in suspension and cultured human cells grow in adherent monolayer, while mouse testis represents an animal tissue sample. Thus, the technique is adapted to all of these sources. The protocol for the analysis of polysomal fractions includes detection of individual mRNA levels by RT-qPCR, proteins by Western blot and analysis of ribosomal RNAs by electrophoresis. The method can be further extended by examination of mRNAs association with the ribosome on a transcriptome level by deep RNA-seq and analysis of ribosome-associated proteins by mass spectroscopy of the fractions. The method can be easily adjusted to other biological models.

Polysome Profiling in Leishmania, Human Cells and Mouse Testis

The overall goal of polysome profiling technique is analysis of translational activity of individual mRNAs or transcriptome mRNAs during protein synthesis. The method is important for studies of protein synthesis regulation, translation activation and repression in health and multiple human diseases.

Polysome LEISHMANIA, insan hücreleri ve fare Testis profil oluşturma

Proper protein expression at the right time and in the right amounts is the basis of normal cell function and survival in a fast-changing environment. For ...

Defining the Program of Maternal mRNA Translation during In vitro Maturation using a Single Oocyte Reporter Assay

Events associated with oocyte nuclear maturation have been well described. However, much less is known about the molecular pathways and processes that take place in the cytoplasm in preparation for fertilization and acquisition of totipotency. During oocyte maturation, changes in gene expression depend exclusively on the translation and degradation of maternal messenger RNAs (mRNAs) rather than on transcription. Execution of the translational program, therefore, plays a key role in establishing oocyte developmental competence to sustain embryo development. This paper is part of a focus on defining the program of maternal mRNA translation that takes place during meiotic maturation and at the oocyte-to-zygote transition. In this method paper, a strategy is presented to study the regulation of translation of target mRNAs during in vitro oocyte maturation. Here, a Ypet reporter is fused to the 3&#39; untranslated region (UTR) of the gene of interest and then micro-injected into oocytes together with polyadenylated mRNA encoding for mCherry to control for injected volume. By using time-lapse microscopy to measure reporter accumulation, translation rates are calculated at different transitions during oocyte meiotic maturation. Here, the protocols for oocyte isolation and injection, time-lapse recording, and data analysis have been described, using the Ypet/interleukin-7 (IL-7)-3&#39; UTR reporter as an example.

This protocol describes a reporter assay to study the regulation of mRNA translation in single oocytes during in vitro maturation.

Tek Bir Oocyte Reporter Tahlil Kullanarak In vitro Olgunlaşma Sırasında Maternal mRNA Çeviri Programını Tanımlama

Events associated with oocyte nuclear maturation have been well described. However, much less is known about the molecular pathways and processes that ...

Gelişim Biyolojisi

An Efficient Protocol to Assess ERK Activity Modulation in Early Zebrafish Noonan Syndrome Models via Live FRET Microscopy and Immunofluorescence

RASopathies are genetic syndromes caused by ERK hyperactivation and resulting in multisystemic diseases that can also lead to cancer predisposition. Despite a broad genetic heterogeneity, germline gain-of-function mutations in key regulators of the RAS-MAPK pathway underlie the majority of the cases, and, thanks to advanced sequencing techniques, potentially pathogenic variants affecting the RAS-MAPK pathway continue to be identified. Functional validation of the pathogenicity of these variants, essential for accurate diagnosis, requires fast and reliable protocols, preferably in vivo. Given the scarcity of effective treatments in early childhood, such protocols, especially if scalable in cost-effective animal models, can be instrumental in offering a preclinical ground for drug repositioning/repurposing. 
Here we describe step-by-step the protocol for rapid generation of transient RASopathy models in zebrafish embryos and direct inspection of live disease-associated ERK activity changes occurring already during gastrulation through real-time multispectral F&#246;rster resonance energy transfer (FRET) imaging. The protocol uses a transgenic ERK reporter recently established and integrated with the hardware of commercial microscopes. We provide an example application for Noonan syndrome (NS) zebrafish models obtained by expression of the Shp2D61G. We describe a straightforward method that enables registration of ERK signal change in the NS fish model before and after pharmacological signal modulation by available low-dose MEK inhibitors. We detail how to generate, retrieve, and assess ratiometric FRET signals from multispectral acquisitions before and after treatment and how to cross-validate the results via classical immunofluorescence on whole embryos at early stages. We then describe how, via examining standard morphometric parameters, to query late changes in embryo shape, indicative of a resulting impairment of gastrulation, in the same embryos whose ERK activity is assessed by live FRET at 6 h post fertilization.

RASopathies are multisystem genetic syndromes caused by RAS-MAPK pathway hyperactivation. Potentially pathogenic variants awaiting validation emerge continuously while poor preclinical evidence limits therapy. Here, we describe our in vivo protocol to test and cross-validate RASopathy-associated ERK activation levels and its pharmacological modulation during embryogenesis by live FRET imaging in Teen-reporter zebrafish.

RASopathies are genetic syndromes caused by ERK hyperactivation and resulting in multisystemic diseases that can also lead to cancer predisposition. ...

Measurement of Specific Mycobacterial Mistranslation Rates with Gain-of-function Reporter Systems

The translation of genes into proteins is prone to errors. Although the average rate of translational error in model systems is estimated to be 1/10,000 per codon, the actual error rates vary widely, depending on the species, environment, and codons being studied. We have previously shown that mycobacteria use a two-step pathway for the generation of aminoacylated glutamine and asparagine tRNAs and that this is specifically associated with relatively high error rates due to the modulation of mistranslation rates by an essential component of the pathway, the amidotransferase GatCAB. We modified a previously employed Renilla-Firefly dual-luciferase system that had been used to measure mistranslation rates in Escherichia coli for use in mycobacteria to measure specific mistranslation rates of glutamate at glutamine codons and aspartate for asparagine codons. Although this reporter system was suitable for the accurate estimation of specific error rates, lack of sensitivity and requirements for excessive manipulation steps made it unsuitable for high-throughput applications. Therefore, we developed a second gain-of-function reporter system, using Nluc luciferase and green fluorescent protein (GFP), which is more amenable to medium/high-throughput settings. We used this system to identify kasugamycin as a small molecule that can decrease mycobacterial mistranslation. Although the reporters that we describe here have been used to measure specific types of mycobacterial mistranslation, they may be modified to measure other types of mistranslation in a number of model systems.

In this article, we present two complementary methods to measure specific rates of translational error and mistranslation in the model mycobacterium, Mycobacterium smegmatis, using gain-of-function reporter systems. The methods can be employed to measure accurate error rates in low throughput or relative error rates in a more high-throughput setting.

Fonksiyon kazancı Reporter sistemleri ile spesifik Mikobakteriyel güvenirlik oranlarının ölçülmesi

The translation of genes into proteins is prone to errors. Although the average rate of translational error in model systems is estimated to be 1/10,000 ...

İmmünoloji ve Enfeksiyon

Functional Evaluation of Olfactory Pathways in Living Xenopus Tadpoles

Xenopus tadpoles offer a unique platform to investigate the function of the nervous system. They provide multiple experimental advantages, such as accessibility to numerous imaging approaches, electrophysiological techniques and behavioral assays. The Xenopus tadpole olfactory system is particularly well suited to investigate the function of synapses established during normal development or reformed after injury. Here, we describe methodologies to evaluate the processing of olfactory information in living Xenopus larvae. We outline a combination of in vivo measurements of presynaptic calcium responses in glomeruli of the olfactory bulb with olfactory-guided behavior assays. Methods can be combined with the transection of olfactory nerves to study the rewiring of synaptic connectivity. Experiments are presented using both wild-type and genetically modified animals expressing GFP reporters in central nervous system cells. Application of the approaches described to genetically modified tadpoles can be useful for unraveling the molecular bases that define vertebrate behavior.

Functional Evaluation of Olfactory Pathways in Living Xenopus Tadpoles

Xenopus tadpoles offer a unique platform to investigate the function of the nervous system in vivo. We describe methodologies to evaluate the processing of olfactory information in living Xenopus larvae in normal rearing conditions or after injury.

Fonksiyonel yaşam Xenopus kurbağa yavrularını koku yollar değerlendirilmesi

Xenopus tadpoles offer a unique platform to investigate the function of the nervous system. They provide multiple experimental advantages, such as ...

Nörobilim

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present methods for the development of assays to query potentially clinically significant nonsynonymous changes using in vivo complementation in zebrafish. Zebrafish (Danio rerio) are a useful animal system due to their experimental tractability; embryos are transparent to enable facile viewing, undergo rapid development ex vivo, and can be genetically manipulated.1 These aspects have allowed for significant advances in the analysis of embryogenesis, molecular processes, and morphogenetic signaling. Taken together, the advantages of this vertebrate model make zebrafish highly amenable to modeling the developmental defects in pediatric disease, and in some cases, adult-onset disorders. Because the zebrafish genome is highly conserved with that of humans (~70% orthologous), it is possible to recapitulate human disease states in zebrafish. This is accomplished either through the injection of mutant human mRNA to induce dominant negative or gain of function alleles, or utilization of morpholino (MO) antisense oligonucleotides to suppress genes to mimic loss of function variants. Through complementation of MO-induced phenotypes with capped human mRNA, our approach enables the interpretation of the deleterious effect of mutations on human protein sequence based on the ability of mutant mRNA to rescue a measurable, physiologically relevant phenotype. Modeling of the human disease alleles occurs through microinjection of zebrafish embryos with MO and/or human mRNA at the 1-4 cell stage, and phenotyping up to seven days post fertilization (dpf). This general strategy can be extended to a wide range of disease phenotypes, as demonstrated in the following protocol. We present our established models for morphogenetic signaling, craniofacial, cardiac, vascular integrity, renal function, and skeletal muscle disorder phenotypes, as well as others.

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present a systematic approach for developing physiologically relevant, sensitive and specific in vivo assays for interpreting variation in human pathology. Transient genetic manipulation via microinjection of WT and mutant human mRNA and morpholino (MO) antisense oligonucleotides harness the tractability of the developing zebrafish embryo to rapidly assay pathogenic mutations, especially, but not exclusively, in the context of human developmental disorders.

Br.rerio kullanarak Morbid İnsan Genomu İn Vivo Modelleme

Here,  we present methods for the development of assays to query potentially clinically  significant nonsynonymous changes using in  vivo complementation ...

Biyoloji

Production of Xenopus tropicalis Egg Extracts to Identify Microtubule-associated RNAs

Many organisms localize mRNAs to specific subcellular destinations to spatially and temporally control gene expression. Recent studies have demonstrated that the majority of the transcriptome is localized to a nonrandom position in cells and embryos. One approach to identify localized mRNAs is to biochemically purify a cellular structure of interest and to identify all associated transcripts. Using recently developed high-throughput sequencing technologies it is now straightforward to identify all RNAs associated with a subcellular structure. To facilitate transcript identification it is necessary to work with an organism with a fully sequenced genome. One attractive system for the biochemical purification of subcellular structures are egg extracts produced from the frog Xenopus laevis. However, X. laevis currently does not have a fully sequenced genome, which hampers transcript identification. In this article we describe a method to produce egg extracts from a related frog, X. tropicalis, that has a fully sequenced genome. We provide details for microtubule polymerization, purification and transcript isolation. While this article describes a specific method for identification of microtubule-associated transcripts, we believe that it will be easily applied to other subcellular structures and will provide a powerful method for identification of localized RNAs.

Production of Xenopus tropicalis Egg Extracts to Identify Microtubule-associated RNAs

We describe the collection of unfertilized Xenopus tropicalis eggs and production of a meiosis II-arrested egg extract. This egg extract can be used to purify microtubules and microtubule-associated RNAs.

Üretimi<em&gt; Xenopus tropicalis</em&gt; Yumurta Mikrotubul ilişkili RNA&#39;lar tanımak ayıklar

Many  organisms localize mRNAs to specific subcellular destinations to spatially and  temporally control gene expression. Recent studies have demonstrated ...

Analysis of Translation in the Developing Mouse Brain using Polysome Profiling

The proper development of the mammalian brain relies on a fine balance of neural stem cell proliferation and differentiation into different neural cell types. This balance is tightly controlled by gene expression that is fine-tuned at multiple levels, including transcription, post-transcription and translation. In this regard, a growing body of evidence highlights a critical role of translational regulation in coordinating neural stem cell fate decisions. Polysome fractionation is a powerful tool for the assessment of mRNA translational status at both global and individual gene levels. Here, we present an in-house polysome profiling pipeline to assess translational efficiency in cells from the developing mouse cerebral cortex. We describe the protocols for sucrose gradient preparation, tissue lysis, ultracentrifugation and fractionation-based analysis of mRNA translational status.

The development of the mammalian brain requires proper control of gene expression at the level of translation. Here, we describe a polysome profiling system with an easy-to-assemble sucrose gradient-making and fractionation platform to assess the translational status of mRNAs in the developing brain.

Polisome Profilleme Kullanarak Gelişen Fare Beyninde Çeviri Analizi

The proper development of the mammalian brain relies on a fine balance of neural stem cell proliferation and differentiation into different neural cell ...

Assessment of Selective mRNA Translation in Mammalian Cells by Polysome Profiling

Regulation of protein synthesis represents a key control point in cellular response to stress. In particular, discreet RNA regulatory elements were shown to allow to selective translation of specific mRNAs, which typically encode for proteins required for a particular stress response. Identification of these mRNAs, as well as the characterization of regulatory mechanisms responsible for selective translation has been at the forefront of molecular biology for some time. Polysome profiling is a cornerstone method in these studies. The goal of polysome profiling is to capture mRNA translation by immobilizing actively translating ribosomes on different transcripts and separate the resulting polyribosomes by ultracentrifugation on a sucrose gradient, thus allowing for a distinction between highly translated transcripts and poorly translated ones. These can then be further characterized by traditional biochemical and molecular biology methods. Importantly, combining polysome profiling with high throughput genomic approaches allows for a large scale analysis of translational regulation.

The ability of cells to adapt to stress is crucial for their survival. Regulation of mRNA translation is one such adaptation strategy, providing for rapid regulation of the proteome. Here, we provide a standardized polysome profiling protocol to identify specific mRNAs that are selectively translated under stress conditions.

Polizom Profil Yöntemi ile memeli hücrelerine selektif mRNA dönüşümüyle Değerlendirilmesi

Regulation of protein synthesis represents a key control point in cellular response to stress. In particular, discreet RNA regulatory elements were shown ...