This research was supported by grant from INSERM, University of Lille 1, University of Lille 2, Regional Hospital Center of Lille (CHR de Lille). MCCH acknowledges supports from the Fondation de France and wishes to thank IRCL, Pr. Sonenberg for the gift of the V5-plasmids, Dr. Dissous (Pasteur Institute, Lille) for the gift of anti-GFP antibodies, UMS 3387 (University of Rennes) where Xenopus oocytes are purchased and Dr Taymans (JPArc, Lille) for critical reading of the manuscript text.

Alle Xenopus Experimente wurden bei der Tierhaltung der Universität Lille 1 nach den Regeln des Gemeinschaftsrahmens des Europäischen (86/609 / EWG) für Labortierversuche durchgeführt. Das Tier-Protokoll wurde von der lokalen Ethikkommission genehmigt (Comité d&#39;Ethique en Experimentieren Animale Nord-Pas-de-Calais, CEEA 07/2010). 1. Oocyte Handhabung <ol><li> Bereiten Sie die Narkoselösung: 1 g Tricainmethansulphonat Pulver in einem 1 l sterilem Wasser. </li><li> Plunge weiblichen Xenopus laevis in diese Lösung, decken Sie den Becher, um das Entweichen zu vermeiden und warten Sie etwa 45 Minuten für das Tier vollständig sediert werden (ohne Reaktion an einem Bein Pinch). </li><li> Waschen Sie den Frosch mit Seife und spülen mit Leitungswasser legen Sie dann das Tier auf seinem Rücken auf saubere Aluminiumfolie. </li><li> Klemmen Sie die Haut des lateralen Teil des Bauches und an der Eierstöcke Ebene mit einer Pinzette.Einen Einschnitt von etwa 1 cm mit einer Schere vor dem Gebrauch mit Ethanol 70% gereinigt. Stellen Sie sicher, dass der Abschnitt ist tief genug, und die zugrunde liegenden Bauchwand zu Exzision des Eierstockgewebe, in dem mehrere Eizellen in verschiedenen Stadien der Entwicklung zu finden sind erlaubt zu erreichen. </li><li> Sezieren die Ovar Lappen, wäscht sie 4 mal in einer Petrischale (50 mm) mit ND96-Medium (96 mM NaCl, 2 mM KCl, 1 mM MgCl 2, 1,8 mM CaCl 2, 5 mM HEPES auf pH 7,4 mit NaOH, ergänzt mit 50 ug / ml Streptomycin / Penicillin, 225 ug / ml Natriumpyruvat, 30 ug / ml Sojabohnen-Trypsininhibitor, 1 &amp; mgr; l / ml Tetracyclin), um alle Spuren von Blut und Trümmer zu entfernen. Hinweis: Tetracycline ermöglicht eine optimale Konservierung und eine gute Erholung nach Mikroinjektion Behandlung. </li><li> Speichern sie in einer Petrischale abgedeckt im Medium bei 14 ° C eingetaucht, so dass ihre Erhaltung für eine Woche. </li><li> Nähen Sie die Bauchdecke und die Haut mit Tierarzt resorbierbaren tHread und eine Nähnadel (3 oder 4 Maschen notwendig). </li><li> Legen Sie das Tier in einem Becherglas ohne Wasser und feuchter die Haut mit Leitungswasser, bis der Frosch ist wieder in Bewegung. Das Becherglas, um eine Flucht zu verhindern. </li><li> Trennen Sie sorgfältig die Eierstöcke Keulen in dem Medium, in Gruppen von 5 bis 10 Oozyten unter Verwendung von 2 Pinzetten unter einem Stereomikroskop mit 10-facher Vergrößerung. Wählen Oozyten im Stadium VI. Sie können durch i mit einem braunen pigmentierten Tiermast und gelben vegetative Pol durch eine klare Band ii) ihrer Größe besser als 1,2 mm Durchmesser 10 getrennt erkannt werden) ihre Form und Farbe. </li><li> Während 45 Minuten die ausgewählten Oozyten in einer Collagenase-Lösung (1 mg / ml Collagenase A aus Clostridium histolyticum, in ND96 gelöst, ohne Tetracyclin) in einer Petrischale unter leichtem Schütteln inkubieren, um die Eizelle defolliculation erleichtern (Kollagenase verdaut Eizelle / follikulären Zellverbindungen). Spülung der Oozyten 3 oder 4 mal mit ND96-Medium bei 14 gehalten° C. Hinweis: die Oozyten weniger oder mehr als 45 min, da das Risiko von Oozyten Oberflächenproteine ​​zerstören und was eine schlechte Lebensfähigkeit inkubieren nicht. Collagenase-Behandlung kann spontane GVBD induzieren. </li><li> Oozyten Inkubieren im Medium für 3-4 Std. Entfernen Follikelzellen mit feinen Pinzette unter binokularen Lupe und halten sie bei 19 ° C in ND96 Medium. </li></ol> 2. Herstellung der mRNA-Synthese <ol><li> Linearisieren 5 ug der folgenden Plasmide durch enzymatischen Verdau mit Pme I-Enzym. HINWEIS: pcDNA6.2 / V5-DEST, die ein 1599 Aminosäuren eIF4G1 cDNA Wildtyp (eIF4G1-WT; NM_198241), pcDNA6.2 / V5-DEST, die eine eIF4G1 dominant negative cDNA (eIF4G1-DN) mit Mutationen c.2105T &gt; G c.2106A&gt; C, c.2120-&gt; G, c.2122T&gt; A, 2125T&gt; - und c.2126T&gt; G im Bereich der Wechselwirkung zwischen eIF4G1 und eIF4E an Position 612 bis 618 des entsprechenden Proteins störenden Interaktion between eIF4G1 und eIF4E 8, pcDNA6.2 / C-EmGFP enthält Chloramphenicolacetyltransferase (GFP). Vorzubereiten 2 Mischungen für jede der 3-Plasmiden: Die erste darunter Pme I-Enzym, und die zweite ohne Enzym als Kontrolle. </li><li> Ausfällung von Plasmid-DNA unter Verwendung eines klassischen Ethanol Verfahren und Resuspendieren in 20 ul Nuklease-freies H 2 O. </li><li> Bestimmen Sie die Konzentration mit einem Spektralphotometer. Die Konzentration sollte überlegen sein zu 150 ng / ul an cRNA zu transkribieren. </li><li> Versuch 1 &amp; mgr; l Proben und deren Steuerungen mit 5 ul Beladungspuffer auf einem 0,8% Agarose-Gel, um die Plasmid-Linearisierung zu verifizieren. </li><li> Verwenden ein Kit zur in vitro-Transkription und cRNA Reinigung gemß den Herstelleranweisungen. Die transkribierten cRNA werden in 20 &amp; mgr; l Nuklease-freies H 2 O resuspendiert Proben können bei -80 ° C, wenn erforderlich gespeichert. </li><li> Bereiten Sie die Migration MOPS 10X-Puffer, der 0,2 M MOPS (pH 7,0), 20 mM Natriumacetat und 10 mM EDTA (pH 8,0). Sterilisieren Lösung mit einem 0,45 um Filter. Aktien des von der Licht bei RT geschützt werden, um Oxidation zu vermeiden Lösung Lösung. </li><li> Reinigen Sie die Elektrophoresetank nacheinander mit NaOH, HCl und gründlich mit doppelt gefiltertes Wasser für einen O gespült / N, um RNase zu vermeiden und zu verhindern, RNA-Abbau. </li><li> Werfen ein 1,5% Agarose-Gel mit MOPS und Formaldehyd. Warm bis zur vollständigen Agarose-Auflösung und abkühlen lassen bis 55 ° C. Unter Abzug werden 0,1 Volumen MOPS 10X, 6,6% Formaldehyd und 4 ug Ethidiumbromid (10 mg / ml). Gießen Sie das Gel unter dem Abzug und warten Sie etwa 1 Stunde für das Gel zu härten. Hinweis: Formaldehyd und Ethidiumbromid sind giftig. </li><li> Vorbereitung der Proben für die Migration in einem 0,2-ml-Röhrchen mit 1 ul cRNA, 8,8% Formaldehyd, 60% Formamid und 0,1 Volumen MOPS 10X. Inkubation für 3 min bei 70 ° C und legte die Röhrchen auf Eis für 10 min. Centrifuge Proben paar Sekunden auf5.000 x g. In 2 ul Gelladepuffer. Hinweis: Formamid ist giftig. </li><li> Laufen Proben für 20 min bei 90V. Tränken Sie das Gel in Nuklease-freies H 2 OO / N, um das Gel vor der Analyse ist es, die Qualität zu überprüfen cRNA entfärben. </li><li> Bestimmen Sie cRNA-Konzentration mit einem Spektralphotometer und lagern Sie sie bei -80 ° C. </li></ol> 3. Mikroinjektion von synthetisierten RNA und Eizellen Reifung Stimulation <ol><li> Bereiten Sie die notwendige Ausrüstung für Eizellen Mikroinjektion. Verwenden Sie einen Mikropipette Abzieher für kleine Glaskapillare zu ziehen. Unter Stereomikroskop, brechen Sie das Ende der Kapillare mit der Pinzette, um ein stumpfes Ende zu schaffen. Füllen der Kapillare Mikropipette mit Mineralöl unter Verwendung einer 1 ml Spritze mit einem Millipore-Filter 0,45 um am gegenüberliegenden Ende. Montieren Sie die Mikropipette auf die Mikroinjektion Pipette. Wählen Sie eine genaue Mikropipette vom Hersteller kalibriert, um eine gute Genauigkeit, wenn sie mit entsprechenden Glaskapillare verwendet zu geben. </li><li> Führen Sie die Mikroinjektion 1-2 Stunden nach defolliculation, notwendige Verzögerung für Eizelle Erholung an Eizellen gehalten bei 14 ° C. Verwenden Petrischalen mit dem Boden kratzte mit einer Pinzette, um eine Klebefläche für Eizellen zu erstellen und füllen sie mit ND96 Medium. </li><li> Ordnen Oozyten entlang einem Kratzspur in einer Petrischale ermöglicht eine sukzessive Injektion von Oozyten mit der Kapillare Mikropipette in einem Winkel von 45 ° C. </li><li> Injizieren in die Oozyte Äquatorialzone unterhalb der pigmentierten Tierbereich für eine optimale Diffusion der Proben im Zytoplasma. Legen Sie nur den dünnsten Teil der Kapillarspitze auf etwa 150-200 &amp; mgr; m Tiefe. </li><li> Injizieren 30 ng cRNA von den verschiedenen Plasmiden in einem Volumen von 60 nl in einer ersten Oozyte jeweils erhalten. Nach der Injektion, warten Sie 5-10 Sekunden, bevor Sie die Kapillarspitze zu Proben escape (2A) zu vermeiden. Hinweis: Nehmen Sie 120 nl nicht überschreiten. Spritzen Sie so langsam, wie Sie können. Ein Steuer mit destilliertem Wasser wird empfohlen. </li><li> Verschieben Sie manuell die Petrischale, um die nächste Eizelle zu injizieren. Hinweis: Achten Sie darauf, dass die Spitze nicht durch die Erzeugung eines kleinen Impulses aus dem Bad-Lösung nach 2 bis 3 Mikroinjektionen verstopft. </li><li> Übertragungs injizierten Oozyten in 24 Vertiefungen-Kulturplatten (10 Oocyten / Vertiefung) werden mit 3 ml frischem ND96 Medium gefüllt und lassen sie auf 19 ° C. </li><li> Die Eizellen in ND96 inkubieren mit Progesteron (PG) (2 ug / ml) zu der meiotischen Reifung (GVBD) bei 19 ° C ausgelöst werden, 15 Stunden oder 4 Stunden nach der Mikroinjektion von polyadenylierter cRNAs jeweils von pcDNA6.2 / V5-DESTeIF4G1 und pcDNA6 erhalten .2 / C-EmGFP verwendet als Kontrolle (Abbildung 2A). Anmerkung: Co-Injektion von Fluoreszenzmarker mit der cRNA ist ein schönes Werkzeug, um sicherzustellen, dass die cRNA injiziert wurde und blieb in der Oocyte. Zuführen, Vorversuchen unter Verwendung eines cRNA von Interesse mit einem GFP-Tag. </li><li> Microinject wie in # 3.5 unterschiedlichen Verhältnissen (1: 3, 2: 2; 3: 1) von polyadenyliert eIF4G1-WT und eIF4G1-DN cRNAs um test die Übersetzung Wirkung eIF4G1-WT cRNAs auf dem mutierten Phänotyp (2D). </li></ol> 4. Keimbläschen Pannen Bestimmung <ol><li> Zählen Sie die Anzahl der reifen Eizellen nach der PG-Stimulation durch die Beobachtung der Gegenwart von einem weißen Fleck auf der schwarzen Tiermast mit einem Stereomikroskop. Wiederholen Sie das Zählen jede Stunde bis zum vierundzwanzigsten Stunde (2B, 2C). </li></ol> 5. Western Blot (WB) Analyse <ol><li> Homogenisierung der Gruppe von 10 Oozyten von Hin- und Herbewegungen mit einer Mikropipettenspitze, bei 4 ° C in 200 &amp; mgr; l in dem folgenden Puffer: 50 mM Hepes, pH 7,4, 500 mM NaCl, 0,05% SDS, 5 mM MgCl 2, 1 mg / ml Rinderserumalbumin, 10 mg / ml Leupeptin, 10 mg / ml Aprotinin, 10 mg / ml Sojabohnen-Trypsininhibitor, 10 mg / ml Benzamidin, 1 mM PMSF, 1 mM Natriumvanadat. </li><li> Zentrifuge Proben für 15 min bei 10.000 × g, um das Lipid (obere Phase) und der Membran (untere Phase) f entfernenractions. Sammeln Sie die cytoplasmatische Fraktion, speichern eines Aliquots auf Proteinkonzentration zu bestimmen, und die restlichen mit Laemmli oder ein Bis-Tris-Probenpuffer (1: 1). Anmerkung: Bis-Tris Gelen und Ladepuffer einen neutraleren pH die Proteine ​​durch Hydrolyse schützt </li><li> Wärme 20 ug Probe bei 95 ° C für 10 min. Laden jeder Probe in die Vertiefungen der Acrylamidgel. Legen Sie das Gel in einem Behälter mit geeigneten Puffer. </li><li> Führen eine Elektrophorese für 1 h bei 200 V. </li><li> Realisieren WB in TBS pH 8,0 (Tris HCl 15 mM, NaCl 150 mM, Tween 0,1%, das 10% Rinderserumalbumin) mit einem Ziege-Anti-Aurora-A / Eg2 (1: 3000, 2 h) oder mit Kaninchen-Anti -Aurora A / Eg2-P (1: 1000, O / N bei 4 ° C), Maus-anti-ERK2 (1: 3000, 2 h), Ziege-anti-ERK2-P (Tyr204) (1: 3000, 2 h ), Kaninchen-Anti-mos (1: 5000, 4 h), Kaninchen-Anti-GFP (1: 3000, 2 h) antibodies.Use Antikörper Maus-anti-V5 (1: 10.000, 2 h) und Kaninchen-Anti-Rsk (1 : 1000, 2 h) (als Lade Kontrollen). </li><li> Washdie Membran 3 x 10 min in TBS-Tween und inkubiere 1 h entweder mit einem Anti-Maus oder Anti-Kaninchen oder Anti-Ziege (IgM) Meerrettichperoxidase-markierter sekundärer Antikörper in Verdünnungen von 1: 5.000, 1: 7.500 bis 1 : 5,000 auf. </li><li> Führen Sie 3 Waschungen von 10 min in TBS-Tween und erfassen die Antigen-Antikörper-Komplexe mit dem Advanced ECL-Nachweissystem. </li></ol> 6. Polyadenylierung Assay <ol><li> Probe 5 Oozyten pro Bedingung in einem 1,5 ml. Mit 1 ml Nuklease-freies PBS 1X (pH 7,4) waschen. Die folgenden Schritte werden unter Abzug durchgeführt werden. </li><li> Auszug RNA unter Verwendung eines klassischen organischen Verfahren (siehe Anweisungen des Herstellers). </li><li> Erholen RNA durch Zentrifugation (10.000 × g) für 5 min bei 4 ° C. Überstand entfernen und an der Luft trocknen RNA für 10 min. </li><li> Resuspendieren RNA-Pellet in 30 &amp; mgr; l Nuklease-freies H 2 O. </li><li> Nehmen Sie 15 ul der Proben in ein neues Röhrchen und fügen Sie 85 ul Nuklease-freies H 2 O. Bereinigen Sie diese Proben, um ihre Qualität zu Spalte Kieselsäure ist nach den Anweisungen des Herstellers zu verbessern. Elution der RNA unter Verwendung von 30 ul Nuklease-freies H 2 O </li><li> Versuch 1 ul-Proben mit 5 ul Beladungspuffer auf einem 0,8% Agarose-Gel, um die RNA-Integrität zu überprüfen. </li><li> Bestimmen Sie die RNA-Konzentration mit einem Spektralphotometer. </li><li> Vorzubereiten 2 Ligierungsgemische pro Bedingung (dh eIF4G1-WT, eIF4G1-DN und die H 2 O-Kontrolle) mit den folgenden Reagenzien: 10 U RNA-Ligase, 0,1 Volumen 10x-Puffer, 1 mM ATP, 10% PEG8000 50% 0,1 ug Primer P1 (5&#39;-P-GGTCACCTTGATCTGAAGC-NH2-3 &#39;) 11 und bringen das Endvolumen auf 10 ul mit Nuklease-freiem H 2 O. Hinzufügen in dem ersten Gemisch aus RNA Oozyten ohne PG-Stimulation erhalten und in der zweiten Mischung RNA aus PG erhalten stimuliert Oozyten. </li><li> Inkubation für 1 h bei 37 ° C dann 20 min bei 65 ° C, um das Enzym zu inaktivieren. </li><li> Unsea cDNA Reverse Transkription (RT) Kit. Bereiten Sie die RT-Mischung, je Rohr: 0,1 Volumen 10X RT-Puffer, 0,1 ug Primer P2 (5&#39;-GCTTCAGATCAAGGTGACCTTTTT) 10, 4 mM dNTP-Mischung, 50 U der reversen Transkriptase und komplett mit Nuklease-freies H 2 O auf ein Endvolumen von 10 &amp; mgr; l. Zugabe von 10 ul Ligationsreaktions zuvor erhaltenen. Führen Sie die RT unter dem vom Hersteller beschriebenen Bedingungen. </li><li> Vorbereitung Polymerase Chain Reaction (PCR), die aus je Röhrchen: 0,1 Volumen Puffer 10X, 1,5 mM MgCl 2, 133 &amp; mgr; M dNTP-Gemisch, 0,2 uM spezifischen Primer, 0,2 &amp; mgr; M Primer P2, 0,025 U Taq-Polymerase, 1 &amp; mgr; l cDNA und komplett mit Nuklease-freies H2 O auf ein Endvolumen von 50 ul. Führen Sie die PCR unter den folgenden Bedingungen: 50 ° C für 2 min, 95 ° C für 10 min, [95 ° C für 1 min, 56 ° C für 30 sec, 72 ° C für 30 s] * 40 Zyklen, 72 ° C für 10 min 9. Die spezifischen Primer sind wie folgt: mos, GTTGCATTGCTGTTTAAGTGGTAA Histon-ähnlichen B4, AGTGACAAACTAGGCTGATATACT; Cyclin A1, CATTGAACTGCTTCATTTTCCCAG; Cyclin B1: GTGGCATTCCAATTGTGTATTGTT 9. </li><li> Bereiten Sie einen 3% igen Agarosegel. Fügen Sie in jeder PCR-Produkte 10 ul Auftragspuffer. Führen Sie das Gel mit 10 ul der Proben bei 110 V für eine optimale Migration. Analyse des Gels nach 10 und 20 Minuten, um eine Änderung der Größe des Reflexions Länge des Schwanzes poly (A) und somit der RNA-Reifung, die eine Voraussetzung für die Übersetzung ist zu beobachten. </li></ol>

<ol>
	<li>Jackson, R. J., Hellen, C. U., Pestova, T. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+eukaryotic+translation+initiation+and+principles+of+its+regulation.">The mechanism of eukaryotic translation initiation and principles of its regulation.</a> Nat Rev Mol Cell Biol. 11 (2), 113-127 (2010).</li><li>Holcik, M., Sonenberg, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+stress+and+apoptosis.">Translational control in stress and apoptosis.</a> Nat Rev Mol Cell Bio. 6 (4), 318-327 (2005).</li><li>Lopez-Lastra, M., Rivas, A., Barria, M. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+synthesis+in+eukaryotes:+the+growing+biological+relevance+of+cap-independent+translation+initiation.">Protein synthesis in eukaryotes: the growing biological relevance of cap-independent translation initiation.</a> Biol Res. 38 (2-3), 121-146 (2005).</li><li>Terenin, I. M., Andreev, D. E., Dmitriev, S. E., Shatsky, I. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+mechanism+of+eukaryotic+translation+initiation+that+is+neither+m7G-cap-,+nor+IRES-dependent.">A novel mechanism of eukaryotic translation initiation that is neither m7G-cap-, nor IRES-dependent.</a> Nucleic Acids Res. 41 (3), 1807-1816 (2013).</li><li>Sonenberg, N., Hinnebusch, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+translation+initiation+in+eukaryotes:+mechanisms+and+biological+targets.">Regulation of translation initiation in eukaryotes: mechanisms and biological targets.</a> Cell. 136 (4), 731-745 (2009).</li><li>Van der Knaap, M. S., Leegwater, P. A., K&#246;nst, A. A., Visser, A., Naidu, S., Oudejans, C. B., Schutgens, R. B., Pronk, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+each+of+the+five+subunits+of+translation+initiation+factor+eIF2B+can+cause+leukoencephalopathy+with+vanishing+white+matter.">Mutations in each of the five subunits of translation initiation factor eIF2B can cause leukoencephalopathy with vanishing white matter.</a> Ann Neurol. 51 (2), 264-270 (2002).</li><li>Sen&#233;e, V., Vattem, K. M., Del&#233;pine, M., Rainbow, L. A., Haton, C., Lecoq, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolcott-Rallison+Syndrome:+clinical,+genetic,+and+functional+study+of+EIF2AK3+mutations+and+suggestion+of+genetic+heterogeneity.">Wolcott-Rallison Syndrome: clinical, genetic, and functional study of EIF2AK3 mutations and suggestion of genetic heterogeneity.</a> Diabetes. 53 (7), 1876-1883 (2004).</li><li>Chartier-Harlin, M. C., Dachsel, J. C., Vilari&#241;o-G&#252;ell, C., Lincoln, S. J., Lepr&#234;tre, F., Hulihan, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translation+initiator+EIF4G1+mutations+in+familial+Parkinson+disease.">Translation initiator EIF4G1 mutations in familial Parkinson disease.</a> Am J Hum Genet. 89 (3), 398-406 (2011).</li><li>Charlesworth, A., Cox, L. L., MacNicol, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+polyadenylation+Element+(CPE)-+and+CPE-binding+Protein+(CPEB)-independent+mechanisms+regulate+early+class+maternal+mRNA+translational+activation+in+Xenopus+oocytes.">Cytoplasmic polyadenylation Element (CPE)- and CPE-binding Protein (CPEB)-independent mechanisms regulate early class maternal mRNA translational activation in Xenopus oocytes.</a> J Biol Chem. 279 (17), 17650-17659 (2004).</li><li>Dumont, J. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oogenesis+in+Xenopus+laevis.">Oogenesis in Xenopus laevis.</a> J Morphol. 136, 153-180 (1972).</li><li>Rassa, J. C., Wilson, G. M., Brewer, G. A., Parks, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spacing+constraints+on+reinitiation+of+paramyxovirus+transcription:+the+gene+end+U+tract+acts+as+a+spacer+to+separate+gene+end+from+gene+start+sites.">Spacing constraints on reinitiation of paramyxovirus transcription: the gene end U tract acts as a spacer to separate gene end from gene start sites.</a> Virology. 274, 438-449 (2000).</li><li>Lin, W., Wadlington, N. L., Chen, L., Zhuang, X., Brorson, J. R., Kang, U. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loss+of+PINK1+attenuates+HIF-1&#945;+induction+by+preventing+4E-BP1-dependent+switch+in+protein+translation+under+hypoxia.">Loss of PINK1 attenuates HIF-1&#945; induction by preventing 4E-BP1-dependent switch in protein translation under hypoxia.</a> J Neurosci. 34 (8), 3079-3089 (2014).</li><li>Martin, I., Kim, J. W., Lee, B. D., Kang, H. C., Xu, J. C., Jia, H. 2., Stankowski, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribosomal+protein+s15+phosphorylation+mediates+LRRK2+neurodegeneration+in+Parkinson's+disease.">Ribosomal protein s15 phosphorylation mediates LRRK2 neurodegeneration in Parkinson's disease.</a> Cell. 57 (2), 472-485 (2014).</li><li>Cohen, S., Au, S., Pant&#233;, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microinjection+of+Xenopus+laevis+oocytes.">Microinjection of Xenopus laevis oocytes.</a> J Vis Exp. (24), (2009).</li><li>Willis, J., DeStephanis, D., Patel, Y., Gowda, V., Yan, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Study+of+the+DNA+damage+checkpoint+using+Xenopus+egg+extracts.">Study of the DNA damage checkpoint using Xenopus egg extracts.</a> J Vis Exp. (69), e4449 (2012).</li><li>Keiper, B. D., Rhoads, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+recruitment+of+Xenopus+maternal+mRNAs+in+response+to+poly(A)+elongation+requires+initiation+factor+eIF4G-1.">Translational recruitment of Xenopus maternal mRNAs in response to poly(A) elongation requires initiation factor eIF4G-1.</a> Dev Biol. 206 (1), 1-14 (1999).</li><li>Wakiyama, M., Imataka, H., Sonenberg, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interaction+of+eIF4G+with+poly(A)-binding+protein+stimulates+translation+and+is+critical+for+Xenopus.oocyte+maturation.">Interaction of eIF4G with poly(A)-binding protein stimulates translation and is critical for Xenopus.oocyte maturation.</a> Curr Biol. 10 (18), 1147-1150 (2000).</li><li>Sheets, M. D., Wu, M., Wickens, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyadenylation+of+c-mos+mRNA+as+a+control+point+in+Xenopus+meiotic+maturation.">Polyadenylation of c-mos mRNA as a control point in Xenopus meiotic maturation.</a> Nature. 374 (6522), 511-516 (1995).</li><li>Gebauer, F., Richter, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+and+function+of+Mos:+the+control+switch+of+vertebrate+oocyte+meiosis.">Synthesis and function of Mos: the control switch of vertebrate oocyte meiosis.</a> Bioessays. 19 (1), 23-28 (1997).</li><li>Le Sommer, C., Lerivray, H., Lesimple, M., Hardy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xenopus+as+a+model+to+study+alternative+splicing+in+vivo.">Xenopus as a model to study alternative splicing in vivo.</a> Biol Cell. 99 (1), 55-65 (2007).</li><li>Au, S., Cohen, S., Pant&#233;, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microinjection+of+Xenopus+laevis.oocytes+as+a+system+for+studying+nuclear+transport+of+viruses.">Microinjection of Xenopus laevis.oocytes as a system for studying nuclear transport of viruses.</a> Methods. 51 (1), 114-120 (2010).</li><li>Gotoh, T., Villa, L. M., Capelluto, D. G., Finkielstein, C. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulatory+pathways+coordinating+cell+cycle+progression+in+early+Xenopus+development.">Regulatory pathways coordinating cell cycle progression in early Xenopus development.</a> Results Probl Cell Differ. 53, 171-199 (2011).</li><li>Schmidt, E. K., Clavarino, G., Ceppi, M., Pierre, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SUnSET,+a+nonradioactive+method+to+monitor+protein+synthesis.">SUnSET, a nonradioactive method to monitor protein synthesis.</a> Nat Methods. 6 (4), 275-277 (2009).</li><li>Moreno, J. A., Halliday, M., Molloy, C., Radford, H., Verity, N., Axten, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+treatment+targeting+the+unfolded+protein+response+prevents+neurodegeneration+and+clinical+disease+in+prion-infected+mice.">Oral treatment targeting the unfolded protein response prevents neurodegeneration and clinical disease in prion-infected mice.</a> Sci Transl Med. 5 (206), 206ra138 (2013).</li><li>Doyle, K. M., Kennedy, D., Gorman, A. M., Gupta, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unfolded+proteins+and+endoplasmic+reticulum+stress+in+neurodegenerative+disorders.">Unfolded proteins and endoplasmic reticulum stress in neurodegenerative disorders.</a> J Cell Mol Med. 15 (10), 2025-2039 (2011).</li><li>Gandin, V., Sikstr&#246;m, K., Alain, T., Morita, M., McLaughlan, S., Larsson, O., Topisirovic, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+fractionation+and+analysis+of+mammalian+translatomes+on+a+genome-wide+scale.">Polysome fractionation and analysis of mammalian translatomes on a genome-wide scale.</a> J Vis Exp. (87), e51455 (2014).</li></ol>

The authors have nothing to disclose.

Translation ist ein Mechanismus in der Pathophysiologie von zahlreichen menschlichen Erkrankungen einschließlich mehreren neurodegenerativen Erkrankungen beteiligt. Zum Beispiel in der Parkinson-Krankheit mehrere Berichte vorgeschlagen, die Wertminderung in der Übersetzung mit erblichen Mutationen 8,12,13 verbunden. Mehrere zelluläre Modelle stehen zur Verfügung, um die Translation zu studieren. Hier wird, um die translatorische Folgen einer Mutation in eIF4G1, die als dominan...

Proteine ​​sind wesentliche Elemente des zellulären Lebens und damit zu größeren Maßstab des Organismus. Sie sorgen für die Mehrzahl von Zellfunktionen einschließlich der Struktur, Transport, Reaktionskatalyse, Regulierung der Genexpression usw. Ihre Expression ist das Ergebnis eines komplexen Mechanismus der Übersetzung für die Konvertierung einer mRNA in Protein. Die Übersetzung wird auf verschiedene Kontrollen unterzogen, sich anzupassen und die Genexpression nach den Zell Anforderungen während der Entwicklung und Differenzierung, Alterung, physiologischen Spannungen oder pathologischen Erscheinungen regulieren. Über Internal Ribosome Entry Segment (IRES) Strukturen und CAP-unabhängige Translation Enhancers (cap-abhängige, cap-unabhängig: Die Übersetzung wird in 3 Phasen (Initiation, Elongation und Termination) und präsentiert 3 Einleitung Übersetzungssysteme, um auf diese Bedürfnisse zu reagieren unterteilt CITE). Meisten eukaryotischen mRNA in einer cap-depe setztenndent Weise über die 7-Methylguanosin 5&#39;-Triphosphat Kappe, die als Erkennungsfunktion während der Proteinsynthese dient. Diese Kappe bindet an eIF4E, einer Komponente von eIF4F Komplex mit eIF4G1 und eIF4A. Mit anderen Partnern wie Poly (A) Binding Protein (PABP) verbunden sind, eIF2-GTP-Met-tRNA Met, damit diese Translationsinitiationsfaktoren, um mRNA zirkularisieren und 43S-Komplex zur Verbesserung seiner Zugänglichkeit zu Formen bis zum August Initiationscodon Anerkennung 1. Dieses Ereignis entspricht dem Ende der Translationsinitiations dh dem ersten Schritt der Übersetzung. CAP-unabhängige Translation von mRNA-Codierung für essentiellen Proteine ​​unter Stressbedingungen, die beispielsweise Zellproliferation und Apoptose induzieren. Dieser Mechanismus beinhaltet Sekundärstrukturen der mRNA-5&#39;-untranslatierten Region (UTR) bezeichnet IRES, dem Carboxy-terminalen Ende mit eIF4G1 eIF4A und dem 43S-Komplex assoziiert. Die Bindung dieser 43S vorge Einleitung complexe IRES leitet die Kappe unabhängige Translation ohne eIF4E Faktor 2,3. Schließlich ist ein weiterer Übersetzungsmechanismus noch nicht gut verstanden unterstützt diese CAP-unabhängige Translation Aktivität unter Stressbedingungen über CITE Strukturen innerhalb mRNA UTR 4 entfernt. Durch diese verschiedenen Formen der Übersetzung, die sich um ihre Initiationsschritte spielt Übersetzung eine entscheidende Rolle bei der zellulären Homöostase und jede Änderung in einer dieser Prozesse würde somit beeinflussen den Organismus mit kleinen bis großen Skaleneffekten. In der Tat ist die Einleitung einer geschwindigkeitsbestimmenden Schritt über die richtigen Übersetzungsprozesse von mRNA in Proteine ​​und damit das Ziel von zahlreichen Kontrollen und Regulierungspunkte 5. Ob es sich für die letztere oder für Komponenten dieser Prozesse, wenn man stellt sich heraus, um defekt zu sein, wird es das vorgegebene Gleichgewicht in der Zelle zu stören und so konnten pathologische bedingungen führengen. In diesem Zusammenhang haben Mutationen in Translationsfaktoren in mehreren Erkrankungen einschließlich neurodegenerativer Störungen wie `Leukoenzephalopathie mit verschwindender weißen Materie&#39; (eIF2B1-5 Untereinheit) 6, in Walcott-Rallison Syndrom (EIF2AK3 kodierenden Gen PERK) 7, potentiell in involviert Parkinson-Krankheit (eIF4G1 p.R1205H) 8. Es ist daher wichtig, um zelluläre und molekulare Studien dieser mutierten Proteine ​​durchzuführen, um das Wissen über die Entwicklung der Krankheit und dem allgemeinen Verfahren der Translationsinitiation zu erhöhen. Zur Durchführung dieser Studien ist es wichtig, um die am besten geeigneten Modellen wählen, die Konsequenzen dieser Mutationen beobachten Xenopus laevis Oozyten sind besonders gut aufgrund ihrer physiologischen und biochemischen Eigenschaften angepasst:. Physiologische Synchronizität (in der Phase G2 des Zellzyklus blockiert) , hohe Kapazität der Proteinsynthese (200-400 ng / Tag / Eizelle), hohe Anzahl von extrahierten oocytes aus demselben Tier (800-1.000 Oozyten / weiblich) und der Zellgröße (1,2-1,4 mm Durchmesser), die ihre Handhabung vereinfacht. Mikroinjektion von Xenopus-Oozyten synthetisierte mRNA leicht durchgeführt werden, um die Translation Schritte zu zerlegen. In dieser Ansicht zeigt es andere Vorteile. Angesichts der Geschwindigkeit der Meiose Progression und der Übersetzung nach der mRNA Mikroinjektion (~ 24 Stunden), Xenopus-Oozyten eine schnelle System im Vergleich zu rekonstituierten Zellsystemen (aus E. coli extrahiert, Weizenkeime oder Kaninchen-Retikulozyten ...), in der eine mRNA ist setzten mit einer reduzierten Translationsrate und mit einer niedrigeren Geschwindigkeit. So werden die Auswirkungen einer Mutation in einer mRNA eingeführt schnell beobachtbar und einfach in verschiedenen Oozyten untersucht werden. Ein weiterer Vorteil des Xenopus-Oozyten, dass mütterliche mRNAs sind latent und Proteintranslation vor Progesteron Stimulation blockiert. Zugabe von Progesteron ist ein geeignetes Mittel zur Steuerung des Übersetzungs Induktion. Cytoplasmic polyadenylation nicht während der Oogenese auftreten. Es beginnt bei der Eizellreifung in Progesteron-stimulierten Eizellen in einer zeitlichen Reihenfolge und setzt sich während der frühen Entwicklung und könnte verwendet werden, um die verschiedenen Schritte der Übersetzung zu untersuchen. Die Polyadenylierung mos mRNA ist unter den ersten, auftreten, und es gehört mit Aurora A / Eg2, histonähnlichen B4 mRNA zur Klasse der &quot;frühen Reifung&quot; Gene als in Charlesworth et al definiert. (2004) 9. Die Translations Induktion der &quot;späten&quot; mRNA wie Cyclin A1 und Cyclin B1 tritt um die Zeit der Keimbläschen Aufteilung (GVBD). MOS-mRNA kodiert für ein Serin / Threonin-Proteinkinase. Die Übersetzung ist von entscheidender Bedeutung, da sie die MAP-Kinase-Kaskade, die indirekt aktiviert die Eizellreifung induziert. Zwar in Reaktion auf Progesteron, Polyadenylierung mos-mRNA wird durch ein Verfahren mit Aurora A / Eg2 regulatorische Proteine ​​und andere RNA-Bindungsproteine ​​mit verbesserten the 3&#39;UTR mos-mRNA. Diese erhöhte Polyadenylierung mos-mRNA führt zu einer Erhöhung des MOS Proteinebene, die wiederum aktiviert MEK1. Dieser Vorgang vermittelt die Aktivierung von extrazellulären signalregulierten Kinase 2 (ERK2) (Abbildung 1). Diese Signalkaskade kann dann lösen die Reifung M-Phasen-fördernde Faktoren, einen Komplex von Cyclin B und Cdc2 Kinase gebildet und schließlich zu meiotische Wiederaufnahme. Daher in Xenopus laevis Oozyten, könnte die Untersuchung der mütterlichen mRNA wie MOS leicht verwendet werden, um ihre Translatierbarkeit mit mehreren Endpunkten ihrer effiziente Polyadenylierung der Übersetzung mehrerer MOS-Signalkomponenten, darunter auch die Bestimmung des GVBD Geschwindigkeit testen. Dieses System ist daher interessant, die ersten Folgen von Mutationen in Translationsinitiationsfaktoren ohne Einmischung von neu transkribierten mRNA oder der Transfektionseffizienz zu bewerten, Probleme oft mit eukary vorkommendeOhrzellstudien. Hier wird ein Protokoll eingesetzt, wo eine Mutante eIF4G1 mRNAs mikroinjiziert in Xenopus laevis Oozyten und die Übersetzung der mütterlichen mRNA getestet. In Gegenwart von einem Defekt in GVBD Progression, mos mRNA Polyadenylierung, die durch die Eizelle meiotischen Zellzyklus und für die nachfolgende Übersetzung der frühen und späten Klasse mRNAs essentiell für Progression ermittelt. Die Phosphorylierung Aurora A / Eg2 und ERK wird auch untersucht, um die Folge der mos deregulation.Thus bestätigen Xenopus-Oozyten, sind ein einfacher Weg, um verschiedene Schritte der mRNA-Translation zu analysieren.

<table><tbody><tr><td>Tricaine methane sulphonate</td><td>Sandoz</td><td>MS-222</td><td>oocytes handling</td></tr><tr><td>Forceps</td><td>Moria</td><td>Dumont MC40</td><td></td></tr><tr><td>Streptomycin/penicillin</td><td>Sigma</td><td>781</td><td></td></tr><tr><td>Sodium pyruvate</td><td>Sigma</td><td>P2256</td><td></td></tr><tr><td>Soybean trypsin inhibitor</td><td>Sigma</td><td>T9128</td><td></td></tr><tr><td>Tetracyclin</td><td>Sigma</td><td>T7660</td><td></td></tr><tr><td>Veterinarian absorbable Vicryl thread</td><td>Johnson&amp;amp;Johson Intl</td><td>JV1205</td><td></td></tr><tr><td>Collagenase A</td><td>Roche diagnostics</td><td>10103586001</td><td></td></tr><tr><td>PmeI</td><td>New England Biolabs</td><td>R0560S</td><td>Preparation of synthetic mRNA</td></tr><tr><td>DNAse/RNAse free H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Life Technologies</td><td>10977</td><td></td></tr><tr><td>Sodium Acetate</td><td>Merck</td><td>6268</td><td></td></tr><tr><td>Absolute ethanol</td><td>Sigma</td><td>02854</td><td></td></tr><tr><td>Nano Drop</td><td>Thermo Scientific</td><td></td><td></td></tr><tr><td>TBE 10X</td><td>Eppendorf</td><td>0032006.507</td><td></td></tr><tr><td>Ethidium bromide 10 mg/ml</td><td>Life Technologies</td><td>15585-011</td><td></td></tr><tr><td>mMESSAGE mMACHINE Kit</td><td>Ambion by Life Technologies</td><td>AM1344</td><td></td></tr><tr><td>MOPS</td><td>Sigma</td><td>M1254</td><td></td></tr><tr><td>EDTA</td><td>Fluka</td><td>03609</td><td></td></tr><tr><td>Agarose</td><td>Life Technologies</td><td>16500-500</td><td></td></tr><tr><td>Formaldehyde 37%</td><td>Merck</td><td>1.04003.1000</td><td></td></tr><tr><td>Formamide</td><td>Fluka</td><td>47671</td><td></td></tr><tr><td>Gel Doc Imager</td><td>Biorad</td><td></td><td></td></tr><tr><td>Oocyte Pipet with 100 8&quot; Glass Capillaries</td><td>Drummond Scientific Company</td><td>3-000-510-X</td><td>microinjection</td></tr><tr><td>Replacement Glass 8&quot;</td><td>Drummond Scientific Company</td><td>3-000-210-G8</td><td></td></tr><tr><td>0.45 &amp;micro;m filter</td><td>Millipore</td><td>SLHA025NB</td><td></td></tr><tr><td>Progesterone</td><td>Sigma</td><td>P0130</td><td></td></tr><tr><td>Hepes</td><td>Sigma</td><td>H3375</td><td>Western Blot</td></tr><tr><td>NaCl</td><td>Sigma</td><td>S5886</td><td></td></tr><tr><td>SDS</td><td>Biorad</td><td>161-0301</td><td></td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma</td><td>A3294</td><td></td></tr><tr><td>Bovine serum albumin</td><td>Sigma</td><td>A4612</td><td></td></tr><tr><td>leupeptin</td><td>Sigma</td><td>L8511</td><td></td></tr><tr><td>aprotinin</td><td>Sigma</td><td>A1153</td><td></td></tr><tr><td>benzamidine</td><td>Sigma</td><td>B6506</td><td></td></tr><tr><td>PMSF</td><td>Sigma</td><td>P7626</td><td></td></tr><tr><td>sodium vanadate</td><td>Sigma</td><td>S6508</td><td></td></tr><tr><td>Laemmli buffer</td><td>Biorad</td><td>161-0737</td><td></td></tr><tr><td>NuPAGE Novex 4-12% Bis-Tris Protein Gels, 1.0 mm, 15 well</td><td>Life Technologies</td><td>NP0323BOX</td><td></td></tr><tr><td>SDS-PAGE electrophoresis, mini-Protean TGX</td><td>Biorad</td><td>456-1036 and -1096</td><td></td></tr><tr><td>horizontal semi-dry blotting system</td><td>W.E.P. Compagny</td><td></td><td></td></tr><tr><td>Glycine</td><td>Biorad</td><td>161-0718</td><td></td></tr><tr><td>Tris-HCl</td><td>Biorad</td><td>161-0719</td><td></td></tr><tr><td>Hybond ECL Membrane</td><td>Amersham Life Science</td><td>10401180</td><td></td></tr><tr><td>Methanol</td><td>VWR</td><td>20846-292</td><td></td></tr><tr><td>Ponceau Red (0.5%)</td><td>Sigma</td><td>P3504</td><td></td></tr><tr><td>Tween 20</td><td>Sigma</td><td>P2287</td><td></td></tr><tr><td>anti-GFP</td><td>Life Technologies</td><td>A11122</td><td></td></tr><tr><td>anti-V5</td><td>Santa Cruz Biotechnology</td><td>sc-58052</td><td></td></tr><tr><td>anti-Eg2</td><td>Santa Cruz Biotechnology</td><td>sc-27884</td><td></td></tr><tr><td>anti-Eg2-P</td><td>Cell Signaling</td><td>C39D8</td><td></td></tr><tr><td>anti-ERK2</td><td>Santa Cruz Biotechnology</td><td>sc-1647</td><td></td></tr><tr><td>anti-ERK2-P (Tyr204)</td><td>Santa Cruz Biotechnology</td><td>sc-7976</td><td></td></tr><tr><td>anti-Rsk</td><td>Santa Cruz Biotechnology</td><td>sc-231</td><td></td></tr><tr><td>anti-mos</td><td>Santa Cruz Biotechnology</td><td>sc-86</td><td></td></tr><tr><td>anti-mouse horseradish peroxidase labeled secondary antibody</td><td>Santa Cruz Biotechnology</td><td>sc-2005</td><td></td></tr><tr><td>anti-rabbit horseradish peroxidase labeled secondary antibody</td><td>Santa Cruz Biotechnology</td><td>sc-2812</td><td></td></tr><tr><td>anti-goat horseradish peroxidase labeled secondary antibody</td><td>Santa Cruz Biotechnology</td><td>sc-2378</td><td></td></tr><tr><td>Advanced ECL Detection System</td><td>Amershan Life Science</td><td>RPN2135</td><td></td></tr><tr><td>PBS 1x</td><td>Sigma</td><td>P4417</td><td>polyadenylation assay</td></tr><tr><td>TRIZOL (Qiazol Lysis Reagent)</td><td>Qiagen</td><td>79306</td><td></td></tr><tr><td>Chloroform</td><td>Sigma</td><td>31998-8</td><td></td></tr><tr><td>Isopropanol</td><td>Sigma</td><td>278475-1L</td><td></td></tr><tr><td>RNeasy mini kit</td><td>Qiagen</td><td>74106</td><td></td></tr><tr><td>RTL buffer&amp;nbsp;</td><td>Qiagen</td><td>79216</td><td></td></tr><tr><td>RNAse free DNAse set</td><td>Qiagen</td><td>79254</td><td></td></tr><tr><td>Primers</td><td>Eurogentec</td><td></td><td></td></tr><tr><td>T4 RNA ligase 1&amp;nbsp;</td><td>New England Biolabs</td><td>M0204S</td><td></td></tr><tr><td>High capacity c-DNA Reverse Transcription kit</td><td>Applied Biosystems, Life Technologies</td><td>4368813</td><td></td></tr><tr><td>Taq polymerase</td><td>Life Technologies</td><td>10342020</td><td></td></tr></tbody></table>

xenopus laevis as a model to identify translation impairment

Die Proteinsynthese ist ein fundamentaler Prozess, um die Genexpression beeinflussen vielfältigen biologischen Prozesse, insbesondere die Anpassung an Umweltbedingungen. Die Initiierungsschritt, der den Zusammenbau der ribosomalen Untereinheiten auf der mRNA-Initiationscodon beteiligten Initiationsfaktor einschließlich eIF4G1 beinhaltet. Defekte in diesem geschwindigkeitsbestimmende Schritt der Translation an verschiedenen Erkrankungen verbunden. Um die möglichen Folgen eines solchen Deregulierungen studieren, Oozyten von Xenopus laevis bilden ein attraktives Modell mit hohem Grad von der Erhaltung der wesentlichen zellulären und molekularen Mechanismen mit menschlichen. Darüber hinaus soll während meiotischen Reifung Oozyten transkriptionell unterdrückt und alle notwendigen Proteine ​​aus bereits vorhandenen, maternalen mRNAs umgerechnet. Dieses preisgünstige Modell ermöglicht exogene mRNA, um perfekt mit einem effektiven Übersetzungs integriert werden. Hier ist ein Protokoll für die Bewertung der Übersetzung mit einem Faktor von Interesse (hier eIF4G1) mit stor beschriebened mütterlichen mRNA, die die ersten sind, um polyadenylierte und während Oocytenreifung als physiologischer Auslese übersetzt werden. Zuerst mRNA durch in vitro-Transkription von Plasmiden von Interesse (hier eIF4G1) synthetisiert werden in Oozyten und die Kinetik der Oocytenreifung von Keimbläschen Schlagerkennung injiziert wird bestimmt. Die untersuchten mütterlichen mRNA Ziel ist die Serin / Threonin-Proteinkinase mos. Seine Polyadenylierung und die anschließende Übersetzung zusammen mit der Expression und Phosphorylierung von Proteinen des MOS-Signalkaskade in Eizellreifung Beteiligten untersucht. Variationen des derzeitigen Protokolls zu unterbreiten Translationsfehlern werden ebenfalls vorgeschlagen, um der Allgemeinheit zu betonen. Angesichts der zunehmend Hinweise, dass aberrante Proteinsynthese kann in der Pathogenese von neurologischen Erkrankungen beteiligt sein, bietet ein solches Modell die Möglichkeit, leicht zu beurteilen diese Beeinträchtigung zu erkennen und neue Ziele.

Kinetic Reifung des Xenopus-Oozyten und die Bestimmung des Prozent Eizelle GVBD nach 24 Stunden von PG-Stimulation (2B, 2C): Um die translatorische Folgen der eIF4G1-DN Genmutationsversuch die Reaktion auf PG in Xenopus laevis Oozyten mit cRNA eIF4G1-DN mikroinjiziert wird eIF4G1-WT und auf andere Steuerbedingungen (H 2 O, GFP) verglichen. Die Kontrollen zu ermöglichen, das Auftreten von Oozyten Mikroinjektion unabhängig von der Art des eingesp...

Watch this Scientific Journal Video about Xenopus laevis as a Model to Identify Translation Impairment at JoVE.com

Xenopus laevis as a Model to Identify Translation Impairment

Protein synthesis control occurs mainly at the translation initiation step, deficiencies in which are linked to diverse disorders. To better understand their etiology, we described here a protocol using Xenopus laevis oocytes assessing the translation of mos transcript in the presence of a mutant of translation initiation factor eIF4G1.

Xenopus laevis als Modell zur Übersetzung Impairment Identifizieren

Protein synthesis is a fundamental process to gene expression impacting diverse biological processes notably adaptation to environmental conditions. The ...

xenopus-laevis-as-a-model-to-identify-translation-impairment

Research

JoVE Journal

Biology

Xenopus laevis as a Model to Identify Translation Impairment

10.7K Aufrufe.  INSERM UMR-S1172, CHRU Lille, University of Lille 1 and Lille 2. Protein synthesis control occurs mainly at the translation initiation step, deficiencies in which are linked to diverse disorders. To better understand their etiology, we described here a protocol using Xenopus laevis oocytes assessing the translation of mos transcript in the presence of a mutant of translation initiation factor eIF4G1.

Serie: Xenopus laevis as a Model to Identify Translation Impairment

Quantitative Immunofluorescence to Measure Global Localized Translation

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and organogenesis, as well as in multiple diseases. Numerous publications have convincingly shown that specific mechanisms tightly regulate mRNA translation. Increased interest in the translation-induced regulation of protein expression has led to the development of novel methods to study and follow de novo protein synthesis in cellulo. However, most of these methods are complex, making them costly and often limiting the number of mRNA targets that can be studied. This manuscript proposes a method that requires only basic reagents and a confocal fluorescence imaging system to measure and visualize the changes in mRNA translation that occur in any cell line under various conditions. This method was recently used to show localized translation in the subcellular structures of adherent cells over a short period of time, thus offering the possibility of visualizing de novo translation for a short period during a variety of biological processes or of validating changes in translational activity in response to specific stimuli.

This manuscript describes a method to visualize and quantify localized translation events in subcellular compartments. The approach proposed in this manuscript requires a basic confocal imaging system and reagents and is rapid and cost-effective.

Quantitative Immunfluoreszenz Maßnahme Global lokalisierte Übersetzung

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and ...

Forschung

Biochemie

Polysome Profiling in Leishmania, Human Cells and Mouse Testis

Proper protein expression at the right time and in the right amounts is the basis of normal cell function and survival in a fast-changing environment. For a long time, the gene expression studies were dominated by research on the transcriptional level. However, the steady-state levels of mRNAs do not correlate well with protein production, and the translatability of mRNAs varies greatly depending on the conditions. In some organisms, like the parasite Leishmania, the protein expression is regulated mostly at the translational level. Recent studies demonstrated that protein translation dysregulation is associated with cancer, metabolic, neurodegenerative and other human diseases. Polysome profiling is a powerful method to study protein translation regulation. It allows to measure the translational status of individual mRNAs or examine translation on a genome-wide scale. The basis of this technique is the separation of polysomes, ribosomes, their subunits and free mRNAs during centrifugation of a cytoplasmic lysate through a sucrose gradient. Here, we present a universal polysome profiling protocol used on three different models - parasite Leishmania major, cultured human cells and animal tissues. Leishmania cells freely grow in suspension and cultured human cells grow in adherent monolayer, while mouse testis represents an animal tissue sample. Thus, the technique is adapted to all of these sources. The protocol for the analysis of polysomal fractions includes detection of individual mRNA levels by RT-qPCR, proteins by Western blot and analysis of ribosomal RNAs by electrophoresis. The method can be further extended by examination of mRNAs association with the ribosome on a transcriptome level by deep RNA-seq and analysis of ribosome-associated proteins by mass spectroscopy of the fractions. The method can be easily adjusted to other biological models.

Polysome Profiling in Leishmania, Human Cells and Mouse Testis

The overall goal of polysome profiling technique is analysis of translational activity of individual mRNAs or transcriptome mRNAs during protein synthesis. The method is important for studies of protein synthesis regulation, translation activation and repression in health and multiple human diseases.

Polysome Profilerstellung in Leishmaniose, menschliche Zellen und Maus Hoden

Proper protein expression at the right time and in the right amounts is the basis of normal cell function and survival in a fast-changing environment. For ...

Defining the Program of Maternal mRNA Translation during In vitro Maturation using a Single Oocyte Reporter Assay

Events associated with oocyte nuclear maturation have been well described. However, much less is known about the molecular pathways and processes that take place in the cytoplasm in preparation for fertilization and acquisition of totipotency. During oocyte maturation, changes in gene expression depend exclusively on the translation and degradation of maternal messenger RNAs (mRNAs) rather than on transcription. Execution of the translational program, therefore, plays a key role in establishing oocyte developmental competence to sustain embryo development. This paper is part of a focus on defining the program of maternal mRNA translation that takes place during meiotic maturation and at the oocyte-to-zygote transition. In this method paper, a strategy is presented to study the regulation of translation of target mRNAs during in vitro oocyte maturation. Here, a Ypet reporter is fused to the 3&#39; untranslated region (UTR) of the gene of interest and then micro-injected into oocytes together with polyadenylated mRNA encoding for mCherry to control for injected volume. By using time-lapse microscopy to measure reporter accumulation, translation rates are calculated at different transitions during oocyte meiotic maturation. Here, the protocols for oocyte isolation and injection, time-lapse recording, and data analysis have been described, using the Ypet/interleukin-7 (IL-7)-3&#39; UTR reporter as an example.

This protocol describes a reporter assay to study the regulation of mRNA translation in single oocytes during in vitro maturation.

Definition des Programms der mütterlichen mRNA-Translation während der In-vitro-Reifung mit einem Single Oocyte Reporter Assay

Events associated with oocyte nuclear maturation have been well described. However, much less is known about the molecular pathways and processes that ...

Entwicklungsbiologie

An Efficient Protocol to Assess ERK Activity Modulation in Early Zebrafish Noonan Syndrome Models via Live FRET Microscopy and Immunofluorescence

RASopathies are genetic syndromes caused by ERK hyperactivation and resulting in multisystemic diseases that can also lead to cancer predisposition. Despite a broad genetic heterogeneity, germline gain-of-function mutations in key regulators of the RAS-MAPK pathway underlie the majority of the cases, and, thanks to advanced sequencing techniques, potentially pathogenic variants affecting the RAS-MAPK pathway continue to be identified. Functional validation of the pathogenicity of these variants, essential for accurate diagnosis, requires fast and reliable protocols, preferably in vivo. Given the scarcity of effective treatments in early childhood, such protocols, especially if scalable in cost-effective animal models, can be instrumental in offering a preclinical ground for drug repositioning/repurposing. 
Here we describe step-by-step the protocol for rapid generation of transient RASopathy models in zebrafish embryos and direct inspection of live disease-associated ERK activity changes occurring already during gastrulation through real-time multispectral F&#246;rster resonance energy transfer (FRET) imaging. The protocol uses a transgenic ERK reporter recently established and integrated with the hardware of commercial microscopes. We provide an example application for Noonan syndrome (NS) zebrafish models obtained by expression of the Shp2D61G. We describe a straightforward method that enables registration of ERK signal change in the NS fish model before and after pharmacological signal modulation by available low-dose MEK inhibitors. We detail how to generate, retrieve, and assess ratiometric FRET signals from multispectral acquisitions before and after treatment and how to cross-validate the results via classical immunofluorescence on whole embryos at early stages. We then describe how, via examining standard morphometric parameters, to query late changes in embryo shape, indicative of a resulting impairment of gastrulation, in the same embryos whose ERK activity is assessed by live FRET at 6 h post fertilization.

RASopathies are multisystem genetic syndromes caused by RAS-MAPK pathway hyperactivation. Potentially pathogenic variants awaiting validation emerge continuously while poor preclinical evidence limits therapy. Here, we describe our in vivo protocol to test and cross-validate RASopathy-associated ERK activation levels and its pharmacological modulation during embryogenesis by live FRET imaging in Teen-reporter zebrafish.

Ein effizientes Protokoll zur Beurteilung der Modulation der ERK-Aktivität in frühen Modellen des Zebrafisch-Noonan-Syndroms mittels Live-FRET-Mikroskopie und Immunfluoreszenz

RASopathies are genetic syndromes caused by ERK hyperactivation and resulting in multisystemic diseases that can also lead to cancer predisposition. ...

Measurement of Specific Mycobacterial Mistranslation Rates with Gain-of-function Reporter Systems

The translation of genes into proteins is prone to errors. Although the average rate of translational error in model systems is estimated to be 1/10,000 per codon, the actual error rates vary widely, depending on the species, environment, and codons being studied. We have previously shown that mycobacteria use a two-step pathway for the generation of aminoacylated glutamine and asparagine tRNAs and that this is specifically associated with relatively high error rates due to the modulation of mistranslation rates by an essential component of the pathway, the amidotransferase GatCAB. We modified a previously employed Renilla-Firefly dual-luciferase system that had been used to measure mistranslation rates in Escherichia coli for use in mycobacteria to measure specific mistranslation rates of glutamate at glutamine codons and aspartate for asparagine codons. Although this reporter system was suitable for the accurate estimation of specific error rates, lack of sensitivity and requirements for excessive manipulation steps made it unsuitable for high-throughput applications. Therefore, we developed a second gain-of-function reporter system, using Nluc luciferase and green fluorescent protein (GFP), which is more amenable to medium/high-throughput settings. We used this system to identify kasugamycin as a small molecule that can decrease mycobacterial mistranslation. Although the reporters that we describe here have been used to measure specific types of mycobacterial mistranslation, they may be modified to measure other types of mistranslation in a number of model systems.

In this article, we present two complementary methods to measure specific rates of translational error and mistranslation in the model mycobacterium, Mycobacterium smegmatis, using gain-of-function reporter systems. The methods can be employed to measure accurate error rates in low throughput or relative error rates in a more high-throughput setting.

Messung spezieller mycobakterieller Mistranslation-Raten mit Funktionsfunktionen

The translation of genes into proteins is prone to errors. Although the average rate of translational error in model systems is estimated to be 1/10,000 ...

Immunologie und Infektion

Functional Evaluation of Olfactory Pathways in Living Xenopus Tadpoles

Xenopus tadpoles offer a unique platform to investigate the function of the nervous system. They provide multiple experimental advantages, such as accessibility to numerous imaging approaches, electrophysiological techniques and behavioral assays. The Xenopus tadpole olfactory system is particularly well suited to investigate the function of synapses established during normal development or reformed after injury. Here, we describe methodologies to evaluate the processing of olfactory information in living Xenopus larvae. We outline a combination of in vivo measurements of presynaptic calcium responses in glomeruli of the olfactory bulb with olfactory-guided behavior assays. Methods can be combined with the transection of olfactory nerves to study the rewiring of synaptic connectivity. Experiments are presented using both wild-type and genetically modified animals expressing GFP reporters in central nervous system cells. Application of the approaches described to genetically modified tadpoles can be useful for unraveling the molecular bases that define vertebrate behavior.

Functional Evaluation of Olfactory Pathways in Living Xenopus Tadpoles

Xenopus tadpoles offer a unique platform to investigate the function of the nervous system in vivo. We describe methodologies to evaluate the processing of olfactory information in living Xenopus larvae in normal rearing conditions or after injury.

Funktionsauswertung olfaktorische Wege im Leben Xenopus Kaulquappen

Xenopus tadpoles offer a unique platform to investigate the function of the nervous system. They provide multiple experimental advantages, such as ...

Neurowissenschaften

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present methods for the development of assays to query potentially clinically significant nonsynonymous changes using in vivo complementation in zebrafish. Zebrafish (Danio rerio) are a useful animal system due to their experimental tractability; embryos are transparent to enable facile viewing, undergo rapid development ex vivo, and can be genetically manipulated.1 These aspects have allowed for significant advances in the analysis of embryogenesis, molecular processes, and morphogenetic signaling. Taken together, the advantages of this vertebrate model make zebrafish highly amenable to modeling the developmental defects in pediatric disease, and in some cases, adult-onset disorders. Because the zebrafish genome is highly conserved with that of humans (~70% orthologous), it is possible to recapitulate human disease states in zebrafish. This is accomplished either through the injection of mutant human mRNA to induce dominant negative or gain of function alleles, or utilization of morpholino (MO) antisense oligonucleotides to suppress genes to mimic loss of function variants. Through complementation of MO-induced phenotypes with capped human mRNA, our approach enables the interpretation of the deleterious effect of mutations on human protein sequence based on the ability of mutant mRNA to rescue a measurable, physiologically relevant phenotype. Modeling of the human disease alleles occurs through microinjection of zebrafish embryos with MO and/or human mRNA at the 1-4 cell stage, and phenotyping up to seven days post fertilization (dpf). This general strategy can be extended to a wide range of disease phenotypes, as demonstrated in the following protocol. We present our established models for morphogenetic signaling, craniofacial, cardiac, vascular integrity, renal function, and skeletal muscle disorder phenotypes, as well as others.

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present a systematic approach for developing physiologically relevant, sensitive and specific in vivo assays for interpreting variation in human pathology. Transient genetic manipulation via microinjection of WT and mutant human mRNA and morpholino (MO) antisense oligonucleotides harness the tractability of the developing zebrafish embryo to rapidly assay pathogenic mutations, especially, but not exclusively, in the context of human developmental disorders.

In Vivo Modellierung des Morbid Human Genome mit Danio rerio

Here,  we present methods for the development of assays to query potentially clinically  significant nonsynonymous changes using in  vivo complementation ...

Biologie

Production of Xenopus tropicalis Egg Extracts to Identify Microtubule-associated RNAs

Many organisms localize mRNAs to specific subcellular destinations to spatially and temporally control gene expression. Recent studies have demonstrated that the majority of the transcriptome is localized to a nonrandom position in cells and embryos. One approach to identify localized mRNAs is to biochemically purify a cellular structure of interest and to identify all associated transcripts. Using recently developed high-throughput sequencing technologies it is now straightforward to identify all RNAs associated with a subcellular structure. To facilitate transcript identification it is necessary to work with an organism with a fully sequenced genome. One attractive system for the biochemical purification of subcellular structures are egg extracts produced from the frog Xenopus laevis. However, X. laevis currently does not have a fully sequenced genome, which hampers transcript identification. In this article we describe a method to produce egg extracts from a related frog, X. tropicalis, that has a fully sequenced genome. We provide details for microtubule polymerization, purification and transcript isolation. While this article describes a specific method for identification of microtubule-associated transcripts, we believe that it will be easily applied to other subcellular structures and will provide a powerful method for identification of localized RNAs.

Production of Xenopus tropicalis Egg Extracts to Identify Microtubule-associated RNAs

We describe the collection of unfertilized Xenopus tropicalis eggs and production of a meiosis II-arrested egg extract. This egg extract can be used to purify microtubules and microtubule-associated RNAs.

Produktion von<em&gt; Xenopus tropicalis</em&gt; Egg Extrakte Mikrotubuli-assoziierten RNAs identifizieren

Many  organisms localize mRNAs to specific subcellular destinations to spatially and  temporally control gene expression. Recent studies have demonstrated ...

Analysis of Translation in the Developing Mouse Brain using Polysome Profiling

The proper development of the mammalian brain relies on a fine balance of neural stem cell proliferation and differentiation into different neural cell types. This balance is tightly controlled by gene expression that is fine-tuned at multiple levels, including transcription, post-transcription and translation. In this regard, a growing body of evidence highlights a critical role of translational regulation in coordinating neural stem cell fate decisions. Polysome fractionation is a powerful tool for the assessment of mRNA translational status at both global and individual gene levels. Here, we present an in-house polysome profiling pipeline to assess translational efficiency in cells from the developing mouse cerebral cortex. We describe the protocols for sucrose gradient preparation, tissue lysis, ultracentrifugation and fractionation-based analysis of mRNA translational status.

The development of the mammalian brain requires proper control of gene expression at the level of translation. Here, we describe a polysome profiling system with an easy-to-assemble sucrose gradient-making and fractionation platform to assess the translational status of mRNAs in the developing brain.

Analyse der Übersetzung im sich entwickelnden Mausgehirn mit Polysome Profiling

The proper development of the mammalian brain relies on a fine balance of neural stem cell proliferation and differentiation into different neural cell ...

Assessment of Selective mRNA Translation in Mammalian Cells by Polysome Profiling

Regulation of protein synthesis represents a key control point in cellular response to stress. In particular, discreet RNA regulatory elements were shown to allow to selective translation of specific mRNAs, which typically encode for proteins required for a particular stress response. Identification of these mRNAs, as well as the characterization of regulatory mechanisms responsible for selective translation has been at the forefront of molecular biology for some time. Polysome profiling is a cornerstone method in these studies. The goal of polysome profiling is to capture mRNA translation by immobilizing actively translating ribosomes on different transcripts and separate the resulting polyribosomes by ultracentrifugation on a sucrose gradient, thus allowing for a distinction between highly translated transcripts and poorly translated ones. These can then be further characterized by traditional biochemical and molecular biology methods. Importantly, combining polysome profiling with high throughput genomic approaches allows for a large scale analysis of translational regulation.

The ability of cells to adapt to stress is crucial for their survival. Regulation of mRNA translation is one such adaptation strategy, providing for rapid regulation of the proteome. Here, we provide a standardized polysome profiling protocol to identify specific mRNAs that are selectively translated under stress conditions.

Bewertung der Selective mRNA Translation in Säugerzellen durch Polysomen Profilieren

Regulation of protein synthesis represents a key control point in cellular response to stress. In particular, discreet RNA regulatory elements were shown ...