The authors would like to acknowledge the Utah Science Technology and Research fund for support of YML and the Korea National Research Foundation grants (2009-0069679 and 2010-0010154) for support of SIY. This research was supported by the Utah Agricultural Experiment Station, Utah State University, and approved as journal paper number UAES #8753. Also, the authors thank Dr. Deborah McClellan for editorial assistance.

The authors have declared that they have no competing financial interests.

Mevcut protokolü başarılı bir şekilde, iki farklı suşları (CNU / LP2 27 ve SA 14 -14-2 28) JEV,, fonksiyonel cDNA kanıtlamıştır oluşturmak için doğal zor bir flavivirüs ve tam uzunlukta enfeksiyon cDNA klonlarının üretilmesi için kullanılmıştır Çünkü konakçı hücre toksisitesi ve klonlanmış cDNA&#39;dan genetik instabilitesi yaymak 8,74-76 Bu protokol, üç ana bileşeni içerir:. yüksek kalitede ters transkriptaz kullanılarak viral RNA&#39;nın bir cDNA sadık bir kopyasının sentezi / amplifikasyon maksimize, birinci / bir DNA polimerazı; ikinci olarak, son, tam uzunlukta cDNA takımı adımları alt klonlama başlangıç ​​cDNA&#39;dan çok düşük kopya sayılı vektör BAC (yayınlanmamış veriler), toksik sekanslar ihtiva eden viral prM-E kodlama bölgesini 74,77,78 klonlanması; ve üçüncü, görünüşe göre daha büyük bir DNA INSE tolere 120-350 kb, 19-21 arasında bir ortalama boyutu olan bir yabancı DNA için uygun bir klonlama vektörü kullanılarak BACdaha rts başka klonlama vektörleri yapmak. Bu klonlama yaklaşımı birçok pozitif sarmallı RNA virüsleri, ~ 10 ila 32 kb&#39;lik bir büyük RNA genomu olan, özellikle de genel olarak geçerli olacaktır. Genom konukçu hücre ribozomlar tarafından proteinler çevrilir viral mRNA görür, çünkü enfeksiyon cDNA klonunun Generation, özellikle de pozitif sarmallı RNA virüsleri için, RNA virüs bir karşıt genetik sistem geliştirilmesi önemli bir adımdır. Bu durumda, viral replikasyon duyarlı bir konakçı hücreye bir cDNA kaynaklı genom uzunlukta RNA molekülünün yerleştirilmesi suretiyle başlatılabilir. Bulaşıcı JEV cDNA klonunun durumu, yeniden birleştirici DNA teknolojisi ile birlikte kullanıldığında, bu tip gen ekspresyonu 73,79 ve genom replikasyonu gibi, moleküler seviyede viral yaşam döngüsünün çeşitli yönlerine ilişkin anlaşılmasını artmıştır. 63,64 Ayrıca, tam uzunluktaki cDNA klonu JEV antiviral aşı 28 ve gen iletim vektörleri gelişimi için değerli bir alet olduğu kanıtlanmıştır. &lt;sup&gt; 80,81 Tüm pozitif sarmallı RNA virüsleri gibi, yüksek derecede bulaşıcı RNA&#39;lar, in vitro olarak sentezlenebilir olan JEV için güvenilir bir fonksiyon cDNA&#39;yı oluşturmak birden çok kritik adım vardır. İdeal olarak, tam uzunluktaki cDNA klonu transkribe sentetik RNA&#39;ların dizisi viral genomik RNA, viral RNA replikasyonunun başlatılması için gerekli olan, özellikle 5&#39;- ve 3&#39;-terminal dizilerinin aynı olmalıdır . 60-62 mevcut protokol otantik 5 &#39;ve 3-uçları geçen alt baş viral genomunun birinci adenin nükleotid üst akışında SP6 promotör sekansını yerleştirilmesi ve yapay benzersiz Xba I sınırlama sitesi konumlandırılması sağlanmıştır sırasıyla, viral genomun timin nükleotid. Bir Xba I ile doğrusallaştırılmış ve MBN ile tedavi edilen cDNA te run-off transkripsiyonu ile üretildi otantik 5 &#39;ve 3&#39; uçları olan sentetik RNA&#39;ların Kapaklımplate m 7 G (5 &#39;) ile prime SP6 RNA polimerazı ppp (5&#39;), bir başlık kullanarak analog. Bu protokol, çeşitli şekillerde değiştirilebilir. Bu içinde mevcut değilse, in vitro transkripsiyon için, bir bakteriyofaj RNA polimeraz (örneğin, T3 ya da T7) iyi tanımlanmış promotör sekansı ile bağlantılı olarak kullanılabilir. 27, bir çalışma-dışı sitesi olarak, farklı bir kısıtlama alanı kullanılabilir doğrusallaştırılmış cDNA&#39;dan viral genom ve eğer sentetik RNA otantik 3 &#39;ucu ile biter. Sentetik RNA, 3 &#39;ucunda üç veya dört virüs ilişkisiz nükleotidini ihtiva ettiği zaman, 3&#39;-ucu nükleotid dizisinin önemi RNA enfekte bir ~ 10 kat azalma ile gösterilmiştir. Bir in vitro transkripsiyon reaksiyonunda 27, her iki m 7 G (5 &#39;) ppp (5&#39;), A ve m 7 G (5 &#39;) ppp (5&#39;) G kap analog 5 viral ikinci yerleri ne kadar alakasız bir ekstra G nükleotid yukarı aynı kalitede kullanılabilir &#39;-end, ancakİlave enfeksiyon veya sentetik RNA replikasyonunu değiştirmez. 27 Ayrıca, DNase I sindirimi ile RNA transkriptlerinden cDNA şablonu çıkarılması RNA enfekte testler için gerekli değildir, cDNA şablonu kendisi bulaşıcı değildir, çünkü. 27 BAC teknolojisi artık pozitif sarmallı RNA virüslerinin, yani, iki JEVs, CNU / LP2 27 ve SA 14 -14-2 28 (genom boyutu, ~ 11 kb) bir avuç enfeksiyon cDNA klonlarının oluşturulması uygulanmıştır; İki dang virüs, BR / 90 26 ve NGC 29 (~ 11 kb); sığır viral diyare virüsü, SD1 (~ 12 kb) 25 iki domuz vebası virüsleri, C ve Paderborn (~ 12 kb) 24 sınır hastalığı virüsü, Gifhorn (~ 12 kb) 24 domuz üreme ve solunum sendromu virüsü , PL97-1 / LP1 (~ 15 kb) 30 bulaşıcı gastroenterit virüsü, PUR46-MAD (~ 29 kb) 16 kedi bulaşıcı peritonit virüsü,DF-2 (~ 29 kb) 32 ağır akut solunum sendromu coronavirus, Urbani (~ 30 kb) 9 MERS-CoV, EMC / 2012 (~ 30 kb) 17 ve insan koronavirüsü, OC43 (~ 31 kb) 31 cDNA yapımı için BAC&#39;ler kullanılarak ana avantajı, büyük, 1- ya da 2-kopyalama BAC plazmidlerin yüksek genetik stabilitesidir.; Bununla birlikte, son derece düşük kopya sayısı iç yapısı nedeniyle BAC DNA ve kromozomal DNA&#39;yı barındıran göre BAC DNA saflıkta azalmasının çok düşük verimleri, aynı zamanda büyük bir dezavantaj teşkil etmektedir. Geçerli protokolde, BAC DNA verimi E. büyüyen maksimize edilir coli DH10B bir besin açısından zengin bir ortamda, 2xYT içinde / bulaşıcı BAC pBAC ile SA 14 -14-2 dönüştürdü. Bu çabaya rağmen, ortalama verim sadece ~ 15 ug 2xYT suyu 500 ml BAC DNA taşımaktadır. Ayrıca, BAC DNA saflığı en iyi temizleme için CsCl-EtBr yoğunluk gradyan santrifüj ile elde edilirOldukça yaygın olarak kullanılan kolon bazlı plazmid izolasyon daha. Ancak, akılda tutulması gereken önemli olduğunu BAC-dönüştürülmüş E. klonlanmış cDNA genetik istikrarı tehlikeye olabilir çünkü coli sarmak olmamalı ve yüksek büyüme mutlaka büyük verimleri veya daha yüksek saflıkta BAC DNA yol açmaz. Burada açıklanan protokol JEV bir BAC olarak genetik olarak stabil, tam uzunlukta enfeksiyon cDNA klonunun inşaat ve yayılması için optimize edilmiş, etkili ve akıcı bir yöntemdir, bir prosedür bir kez pratik olarak imkansız düşünülmektedir. Bu, aynı klonlama stratejisi aynı zamanda pek çok diğer pozitif sarmallı RNA virüsü tatbik edilebilir. Genel olarak, bulaşıcı cDNA klonları, viral replikasyon ve patogenezinde biyolojik fonksiyonlarını incelemek için, bir viral RNA genomu içine mutasyon (örneğin, silmeler, girmeler ve nokta mutasyonları) çeşitli tanıtmak için olanak sağlar. Bu cDNA tabanlı ters genetik sistemi geliştirmek mümkün ve tes kılart aşısı ve belirli bir ilgi pozitif sarmallı RNA virüsü oluşturma faktörünü (ler) hedefleyen terapötik aday. Buna ek olarak, bu bulaşıcı cDNA&#39;dan teknolojisi de biyomedikal araştırmalarda birçok uygulama için, ilgili bir yabancı gen (ler) ifade edebilen bir virüs vektörü olarak kullanılabilir.

RNA virologists, 1970&#39;lerin rekombinant DNA teknolojisindeki gelişmeler, daha sonra mümkün RNA virüslerinin genetik manipülasyonu için bakterilerde plazmidler gibi yayınlanabilirdi cDNA klonları, viral RNA genomları dönüştürmek için yapılmıştır. 1, ilk RNA virüsü olduğu Klonlanmış moleküler bakteriyofaj Qβ, Escherichia coli bozar pozitif sarmallı RNA virüsü oldu. E. verildiğinde Qβ genomik RNA&#39;nın bir cDNA kopyasını ihtiva eden bir plasmid, bulaşıcı Qβ fajlar yol açan E. coli. 2 Kısa bir süre sonra, bu teknik, poliovirüs uygulanan, insanlarda ve hayvanlarda bir pozitif tek iplikli RNA virüsüdür edildi. Çocuk felci virüsü genomik RNA&#39;nın bir tam boy bir cDNA taşıyan bir plazmid, bulaşıcı memeli hücrelerine transfekte edilmiş ve enfeksiyöz virionlann üretebilen zaman 3, klonlanmış cDNA&#39;lar, viral RNA replikasyonunu başlatmak için hücre transkribe edilmesi gerekmektedir, bu &quot;DNA başlatıldı&quot; yaklaşımında.;transkripsiyon başlatılır ve nasıl transkript doğru viral diziye nasıl işlendiğini, ancak belirsizdir. Bu kaygı, bir alternatif &quot;RNA fırlatılan&quot; bir gelişmesine yol açmıştır yaklaşımı viral RNA genomunun tam bir cDNA kopyası bir E. tarafından tanınan bir promoter altında klonlanır, böylece Ev sahibi hücre içine sokulduğunda virüsün replikasyon çembere devam tanımlandığı 5 &#39;ve 3&#39; uçlarının ile in vitro olarak sentetik RNA&#39;ların üretimi için E. coli ya da faj RNA polimeraz. Bu yaklaşım ilk başarılı brom mozaik virüsü için bildirilmiştir 4,5 6,7 bitki pozitif iplikli bir RNA virüsüdür. O zamandan beri, RNA fırlatılan bir yaklaşım kalisivirüs alfavirüsler, flavivirüsler, arteriviruses ve koronavirüslerin dahil pozitif iplik RNA virüslerinin geniş bir yelpazesi için geliştirilmiştir. 1,4,5,8 Nitelikteki DNA- ve her ikisinde de, ful inşaatı karşıt genetik sistemler RNA başlatılan~ 10 l-uzunluklu cDNA klonu enfeksiyon DNA veya pozitif sarmallı RNA virüslerinin RNA üreten anahtarı, ancak viral genomun boyutu arttıkça önemli bir teknik sorun. Özellikle 9-17, geniş bir RNA genomu olur -32 kb, tam uzunlukta cDNA işlevsel klonlama ile üç büyük sorun sunulur. RT-PCR aslına viral RNA&#39;nın uzunluğu ile ters orantılı olduğundan, 18 ilk zorluk, kopyalama sadık bir cDNA sentezi. Uzun RNA molekülleri E. kararsız plazmidler cDNA fragmanının yapabilen beklenmeyen dizileri içeren daha büyük olasılıkla, çünkü ikinci bir engel, potansiyel olarak toksik sekansların varlığı E. coli. O&gt; 10 kb viral cDNA insert ev bir klonlama vektörü bulmak zor olduğundan üçüncü ve en kritik konu, uygun bir vektör mevcudiyetidir. Son üç yılda, bu engeller enzimolojisi, metodoloji, An çeşitli gelişmeler aşılmıştırd vectorology. Bunlardan 1,4,5,8, en yenilikçi gelişimi büyük pozitif sarmallı RNA virüsleri gibi bulaşıcı bakteriyel yapay kromozomları (BAC&#39;ler) klonlanması olup. BAC vektörü E. göre bir düşük kopya plazmid klonlama (1-2 kopya / hücre) bir arasında bir ortalama DNA insert boyutu ile coli doğurganlık faktörü, ~ 120-350 kb 19-21 bir DNA parçası, genel klonlama vektörleri içine klonlama için benzer bir şekilde BAC vektörü içine sokulur.; Ortaya çıkan BAC klonları E. birçok nesiller boyunca stabil E. coli. Bugüne kadar 22,23, BAC teknolojisi yani üç pozitif iplikli RNA virüsüdür aileleri, Flaviviridae, 24-29 Arteriviridae, 30 ve Coronaviridae&gt; 10 üyeleri için bulaşıcı cDNA klonları oluşturmak için kullanılır olmuştur. 9,16,17 , 31,32 Örnek olarak Japon ensefaliti virüsü (JEV) kullanarak, mevcut iş olabilir detaylı prosedürler raporlarıpozitif sarmallı RNA virüslerinin çeşitliliği için bir genetik olarak stabil, tam uzunlukta enfeksiyon BAC oluşturmak için kullanılır. Meydana JEV, JEV enfeksiyonu ağır sıklıkla ölümcül bir nörolojik hastalıktır Japon ensefalit neden olabilir İnsanlarda bir zoonotik sivrisinek vektörleri tarafından kuş, domuz ve diğer omurgalı konaklar arasında doğada iletilir flavivirüs 33. 34,35 olan (JE), 36 ~ 50,000-175,000 klinik vakaların tahmini yıllık insidansı Asya ve Batı Pasifik, 37,38 parçaları. 39,40 Jev genomu bir ~ 11-kb, tek iplikli, pozitif-sens RNA molekülüdür ve oluşan 5 &#39;ve 3&#39; iki kodlayıcı olmayan bölgeleri (NCRs) ile çevrili bir tek bir açık okuma çerçevesi (ORF) sona erer. 41,42 ORF olarak 10 bağımsız proteinlerin üretilmesi için host ve viral proteazlar tarafından bölünen bir poliproteini şifreler C prM, E, NS1, NS2A, NS2B, NS3, NS4A, NS4B ve NS5 Ayrıca C-terminal yönüne N-. 34,43,44, eNS1 (NS1 &#39;) ne sahip Xtended şekilde kodonları NS2A 8-9 de tarafından -1 ribozomal çerçeve ifade edilir. Bu 11 proteinlerden 45,46, üç yapısal proteinleri (Cı prM ve E) enfeksiyon oluşumu için gerekli olan virionlar, 47,48 ve kalan sekiz yapısal olmayan proteinler (NS5&#39;in için NS1 ve NS1 &#39;), viral RNA replikasyonu, 49-51 parçacık montaj, 52-56 ve doğal bağışıklık kaçırma için çok önemlidir. 57-59 İkisi 5&#39; ve 3 &#39;NCRs birincil dizileri ve viral RNA replikasyonu modüle için önemli olan formu RNA ikincil / üçüncül yapıları, 60-62 korunmuş içerirler. 63,64 Bu protokol, SA 14 -14-2 tam uzunlukta JEV enfeksiyöz BAC üretilmesi için araçlar, yöntem ve stratejiler açıklanmaktadır. 28 Bu fonksiyonel BAC klonu bir promoter tarafından kapsanmaktadır JEV genomik RNA&#39;nın bir cDNA kopyasını, 65 içerir SP6 RNA polimeraz için üst başViral 5&#39;-uç ve in vitro Çoğaltma transkripsiyonu ayrıca viral 3&#39;-ucunun alt baş benzersiz bir Xba I kısıtlama sahasının. Bu BAC teknolojisi pozitif sarmallı RNA virüslerinin bir dizi için tamamen işlevsel bir cDNA klonu molekül oluşturmak için de geçerlidir.

<table border="0" cellpadding="0" cellspacing="0" width="1054">
	<tbody>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">1. Molecular Cloning</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td style="width:235px;"></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">2xYT Broth</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">Y2377</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">[3H]UTP</td>
			<td style="width:275px;">PerkinElmer</td>
			<td style="width:243px;">NET380250UC</td>
			<td>Radioactive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">50-mL Tube</td>
			<td style="width:275px;">Thermo Scientific (Nalgene)</td>
			<td style="width:243px;">3114-0050</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">250-mL Bottle</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">356011</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose</td>
			<td style="width:275px;">Lonza</td>
			<td style="width:243px;">50004</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose (Low Melting Point)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">16520-100</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">AvaI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0152S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">AvrII</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0174S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BamHI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0136S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BsiWI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0553S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BsrGI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0575S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Butanol</td>
			<td style="width:275px;">Fisher Scientific</td>
			<td style="width:243px;">A399-1&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cap Analog [m7G(5&#697;)ppp(5&#697;)A]</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">S1405S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cesium Chloride</td>
			<td style="width:275px;">Fisher Scientific</td>
			<td style="width:243px;">BP1595-1</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Chloramphenicol</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C0378</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Chloroform</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C2432</td>
			<td>Carcinogenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">DE-81 Filter Paper</td>
			<td style="width:275px;">GE Healthcare Life Sciences</td>
			<td style="width:243px;">3658-023</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">dNTP mix</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18427-088</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">E. coli DH10B&#160;</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18297-010</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">EDTA</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E5134</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Ethanol&#160;</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E7023</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Ethidium Bromide</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E7637</td>
			<td>Toxic and highly mutagenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Filter Column (Plasmid Maxiprep Kit)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">K2100-26</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glacial Acetic Acid</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">A6283</td>
			<td>Irritating</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glucose</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">G5400</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glycogen&#160;</td>
			<td style="width:275px;">Roche</td>
			<td style="width:243px;">10901393001</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">High-Fidelity DNA Polymerase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0491S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Isoamyl Alcohol</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">I9392</td>
			<td>Flammable</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Isopropanol&#160;</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0918</td>
			<td>Flammable</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">LB Broth</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">12795-027</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Lithium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">L9650</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Lysozyme</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0663</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Magnesium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">M8266</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">M-MLV Reverse Transcriptase</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18080-044</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Mung Bean Nuclease</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0250S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Needle (18G, 20G)</td>
			<td style="width:275px;">BD</td>
			<td style="width:243px;">305196, 305175</td>
			<td>Biohazardous (Sharps waste)</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">NotI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0189S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Oligonucleotide</td>
			<td style="width:275px;">Integrated DNA Technologies</td>
			<td style="width:243px;">Custom Oligonucleotide Synthesis</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">PacI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0547S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">pBeloBAC11</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">ER2420S (E4154S)</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol (Buffer-Saturated)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15513-039</td>
			<td>Toxic and highly corrosive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol:Chloroform:Isoamyl Alcohol</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15593-031</td>
			<td>Toxic and highly corrosive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol:Guanidine Isothiocyanate</td>
			<td style="width:275px;">Life Technologies (Ambion)</td>
			<td style="width:243px;">10296-010</td>
			<td>Toxic, corrosive, and irritating</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Pme I</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0560S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Acetate</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0698</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">RNase Inhibitor</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">10777-019</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">rNTP Set</td>
			<td style="width:275px;">GE Healthcare Life Sciences</td>
			<td style="width:243px;">27-2025-01</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sealable Polypropylene Tube (16 &#215; 76 mm)&#160;</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">342413</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">SfiI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0123S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sma I</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0141S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Acetate</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S2889</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Dodecyl Sulfate</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0227</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Hydroxide</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S5881</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">SP6 RNA Polymerase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0207S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Spin Column (Plasmid Miniprep Kit)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">K2100-11</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Syringe</td>
			<td style="width:275px;">HSW NORM-JECT</td>
			<td style="width:243px;">4200.000V0</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">T4 DNA Ligase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0202S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Tris</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0826</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">tRNA (yeast)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15401-011</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">XbaI&#160;</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0145S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Name</td>
			<td style="width:275px;">Company</td>
			<td style="width:243px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">2. Cell Culture</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Alpha Minimal Essential Medium</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">12561-049</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Conical Tube (50 mL)</td>
			<td style="width:275px;">VWR</td>
			<td style="width:243px;">21008-242</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Crystal Violet&#160;</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C0775</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Culture Dish (150 mm)&#160;</td>
			<td style="width:275px;">TPP</td>
			<td style="width:243px;">93150&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cuvette (2-mm Gap)</td>
			<td style="width:275px;">Harvard Apparatus</td>
			<td style="width:243px;">450125&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Fetal Bovine Serum&#160;</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">16000-044</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Formaldehyde</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">F1635</td>
			<td>Toxic and carcinogenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glutamine</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">25030-081</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Minimal Essential Medium</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">61100-061</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Penicillin/Streptomycin</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">15070-063</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">P3911</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Phosphate Monobasic</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">P9791</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Six-Well Plate</td>
			<td style="width:275px;">TPP</td>
			<td style="width:243px;">92006</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S3014</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Phosphate Dibasic</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S3264</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Trypsin-EDTA (0.25%)</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">25200-056</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Vitamins</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">M6895</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Name</td>
			<td style="width:275px;">Company</td>
			<td style="width:243px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">3. Equipment</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose Gel Electrophoresis System</td>
			<td style="width:275px;">Mupid</td>
			<td style="width:243px;">MPDEXU-01</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">CO2 Incubator</td>
			<td style="width:275px;">Thermo Scientific</td>
			<td style="width:243px;">Heracell 150i</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Desktop Centrifuge&#160;</td>
			<td style="width:275px;">Thermo Scientific</td>
			<td style="width:243px;">ST16R</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Electroporator</td>
			<td style="width:275px;">Harvard Apparatus</td>
			<td style="width:243px;">ECM 830</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Longwave Ultraviolet Lamps (Handheld)</td>
			<td style="width:275px;">UVP</td>
			<td style="width:243px;">UVGL-58</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Tabletop Centrifuge</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">368826</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Thermocycler</td>
			<td style="width:275px;">Life Technologies (Applied Biosystems)</td>
			<td style="width:243px;">GeneAmp PCR System 9700</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Vortexer</td>
			<td style="width:275px;">Scientific Industries</td>
			<td style="width:243px;">G-560</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Water Bath</td>
			<td style="width:275px;">Jeio Tech</td>
			<td style="width:243px;">WB-10E</td>
			<td></td>
		</tr>
	</tbody>
</table>

bacterial artificial chromosomes: a functional genomics tool for the study of positive-strand rna viruses

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose genomes have the same polarity as cellular mRNA. The cDNA-based reverse genetics system is a seminal method that enables direct manipulation of the viral genomic RNA, thereby generating recombinant viruses for molecular and genetic studies of both viral RNA elements and gene products in viral replication and pathogenesis. It also provides a valuable platform that allows the development of genetically defined vaccines and viral vectors for the delivery of foreign genes. For many positive-strand RNA viruses such as Japanese encephalitis virus (JEV), however, the cloned cDNAs are unstable, posing a major obstacle to the construction and propagation of the functional cDNA. Here, the present report describes the strategic considerations in creating and amplifying a genetically stable full-length infectious JEV cDNA as a bacterial artificial chromosome (BAC) using the following general experimental procedures: viral RNA isolation, cDNA synthesis, cDNA subcloning and modification, assembly of a full-length cDNA, cDNA linearization, in vitro RNA synthesis, and virus recovery. This protocol provides a general methodology applicable to cloning full-length cDNA for a range of positive-strand RNA viruses, particularly those with a genome of &gt;10 kb in length, into a BAC vector, from which infectious RNAs can be transcribed in vitro with a bacteriophage RNA polymerase.

Tüm pozitif sarmallı RNA virüsü için bir karşıt genetik sistem güvenilirliği ve etkinliği olan dizisi viral genomik RNA&#39;nın konsensüs sekansına denk bir klonlanmış tam boy cDNA&#39;dan genetik stabilitesi, bağlıdır. 27 Şekil 1, bir beş göstermektedir JEV SA BAC gibi tam uzunlukta enfeksiyon cDNA yapımı için aşamalı bir strateji 14 -14-2 28: Aşama 1, JEV enfekte BHK-21 hücreleri (Şekil 1A), hücre kültürü üstte yüzen kısmından viral RNA&#39;nın saflaştırılması; Aşama 2, tüm viral genomun (Şekil 1B) kapsayan birbiriyle çakışan dört cDNA amplikonlarının (F1 ila F4) sentezi; PBAC / F4 (Şekil 1C) için pBAC / F1 oluşturma Aşama 3, bir BAC vektörüne bitişik dört cDNA parçalarının her birinin alt-klonlama; Aşama 4, SP6 RNA polimeraz, yani in vitro Çoğaltma transkripsiyonu için klonlanmış cDNA modifikasyonu, bir SP6 yerleştirerekpromoter dizisi, bir sessiz bir nokta mutasyonu sokulmasıyla nükleotid 9131 de önceden var olan bir iç Xba I bölgesi elimine viral 5&#39;-ucunda (pBAC / F1 SP6) hemen üst tarafından, bir 9134 T (pBAC / F3 KO) ve ekleme → Viral 3&#39;-ucunda (pBAC / F4 RO) (Şekil 1D) hemen aşağı tarafında, yeni bir yapay Xba I run-off yer; ve Aşama 5, tam uzunlukta bir montaj SA 14 -14-2 cDNA BAC, pBAC / SA 14 -14-2 (Şekil 1E). Tablo Klonlama işleminde kullanılan oligonükleotidler 1 listeler. 28 Fonksiyonel JEV cDNA yapımı için, ilk önemli adım RT-PCR için bir şablon olarak saflaştınlmış viral RNA kullanılarak, dört örtüşen cDNA fragmanlarının sentezidir. 2 olan dört RT-PCR ürünleri için temsili bir sonuç sağlar Şekil % 0.8 üzerinde elektroforezagaroz jel. Bu jel, bir tam uzunlukta cDNA JEV dört örtüşen cDNA fragmanları amplifiye olduğunu açık bir şekilde göstermektedir. Bazen, Rt-PCR reaksiyonu için cDNA sentezi / amplifikasyon prosesi esnasında primerlerin spesifik olmayan tavlamanın, istenen ürün daha çok küçük olan bir ya da daha fazla ilave virüse spesifik veya spesifik olmayan ürünler elde olabilir. Diğer taraftan, çok az veya hiç RT-PCR ürünü, viral RNA izolasyonu veya uygun olmayan RT-PCR performans sırasında kazara RNaz kirlenme amplifiye beklediği. Bir sonraki anahtar aşaması, bir kısmi ya da tam uzunluktaki standart rekombinant DNA teknikleri kullanır nispeten basit bir işlemdir BAC JEV cDNA klonlanması ve bir modifikasyonudur. 69 Şekil 3 içeren BAC klon saflaştırılması için temsili bir sonuç sunulur CsCI-EtBr gradyanı bantlayarak JEV SA 14 -14-2 tam boyda bir cDNA.Bu deneyde, 401.700 x g&#39;de 16 saat santrifüj işleminden sonra, iki farklı bantları, yani, E. Yukarıda coli kromozom DNA&#39;sı ve aşağıdaki süper-BAC plasmid DNA&#39;sı uzun dalgalı ultraviyole ışığı altında borunun ortasında görebilir. Alt BAC DNA bandının minimum bir hacmi (~ 400 | il) dikkatli bir şekilde borunun yan tarafında bulunan bir şırınga ile bir delik alay ile toplandı. Daha sonra, EtBr bütanol ekstre BAC DNA elde edildi ve EtBr içermeyen BAC DNA, etanol çökeltme ile konsantre edilmiştir. Son adım, permisif hücreler içine RNA transfeksiyonundan (Şekil 4) sonra, tam uzunluktaki SA 14 -14-2 BAC (pBAC / SA 14 -14-2) in vitro olarak transkripsiyonu sentetik RNA&#39;ların spesifik enfeksiyon belirlenmesidir. 3 &#39;de Adım 1, tam uzunluktaki doğrusallaştırma SA 14 -14-2 cDNA: Bu adım, üç ardışık adımları içerir-end viral genom (Şekil 4A); Aşama 2, run-off transkripsiyon (Şekil 4B) ile doğrusallaştırılmış cDNA&#39;dan sentetik RNA&#39;ların üretimi; ve Aşama 3, sentetik RNA&#39;ların (Şekil 4C) ile transfekte edilen BHK-21 hücrelerinde rekombinant virüslerin kurtarma. Deneysel olarak, pBAC / SA 14 -14-2 iki adet bağımsız klon Xba I sindirimi ile doğrusallaştırılmış ve Xba I sindirimi ile oluşturulan dört bazlı 5 &#39;çıkıntı kaldırmak için MBN ile muamele edilmiştir. Doğrusallaştırılmış BAC etanolle çökeltme izlenmiş ve fenol-kloroform ekstraksiyonu ile temizlendi. Saflaştırılmış olan iki BAC&#39;lerin doğrusallaştırma bir% 0.8 agaroz jeli (Şekil 5A) ile gösterilmiştir. Fenol-kloroform ekstraksiyon linearize BAC&#39;ler RNaz ücretsiz olmasını sağlamak için çok dikkatli yapılmalıdır. İki linearize BAC&#39;lerin her bir m, 7 G (5 &#39;) ppp mevcudiyetinde SP6 RNA polimerazı kullanılarak Çoğaltma transkripsiyonu için bir cDNA şablon olarak kullanıldı (5&#39;) Bir kapak benzeri. Sentetik RNA&#39;ların bütünlüğü referans 1kb DNA çaprazı (Şekil 5B) ile birlikte,% 0.6 agaroz jeli üzerinde, iki transkripsiyon reaksiyonu karışımları alikotları çalıştırarak gördü. Bu basit bir deneyde, büyük bir belirgin RNA bandı her zaman sadece geçirilmiş 3 kb altında DNA bandı başvuru ve keskin olduğu ortaya çıktı. Ancak, RNA aynı jel üzerinde bir bulaşmış bir görünüm olurdu bozulmuş. Bulaşıcı bir merkez tahlil sentetik RNA&#39;ların spesifik enfeksiyon belirlenmesi için altın standarttır. Bu deney, (3 x 10 5 hücre / çukur) saf BHK-21 hücreleri ihtiva eden 6 oyuklu plakalar içinde 10-kat seri olarak seyreltilmiş elektroporate edilmiş hücrelerde eşit hacimde tohumlama, RNA örnekleri ile BHK-21 hücrelerini elektroporat ve agaroz çakıştırılarak yapıldı Hücre mono tabakaları üzerine. 4 gün süreyle inkübe edildikten sonra, kalan hücreler formaldehid ile sabitlendi ve kristal mor ile boyandı sların çözüme hücreleri (Şekil 6A) içine verilecek, enfeksiyöz RNA moleküllerinin sayısına karşılık gelir enfeksiyonlu merkezlerden (plaklar) sayısını ölçmek için. In vitro transkripsiyonu için kullanılan cDNA şablonu olmayan bulaşıcı olması için, kanıtlanmıştır yana transkripsiyon reaksiyon karışımı 27, bir kısım, doğrudan elektroporasyon için kullanılmıştır. Elektroporasyon RNA transfeksiyonundan için tercih edilen yöntemdir; Alternatif olarak, RNA DEAE-dekstran ve katyonik lipozomlar kullanılarak diğer yöntemler ile transfekte edilebilir. RNA elektroporasyon çok etkili olmakla birlikte, elektrik akımının &quot;ark&quot; Tuzlar elektroporasyon reaksiyonunda ya da elektroporasyon küveti yeniden, mevcut nadir oluşur. RNA-transfekte edilmiş hücrelerde viral proteinlerin ekspresyonu bir anti-NS1 tavşan antiserumu (Şekil 6B) kullanılarak imüno-deney ile araştırılmıştır. RNA-transfekte edilmiş hücrelerin yüzer maddeleri içinde biriken viral parçacıkların üretimi olan birplak deneyleri (Şekil 6C) tarafından alyzed. Bu deneylerin sonuçları, bir cDNA türevli sentetik RNA&#39;ların rekombinan virüslerin yüksek titresi üreten permisif BHK-21 hücrelerinde enfeksiyon olduğunu açık bir şekilde göstermektedir. <table fo:keep-together.within-page="1"><tbody><tr><td> Oligonükleotid </td><td> Sekans, bir (5 &#39;ila 3&#39;), </td><td> Pozisyon b </td><td> Polarite </td></tr><tr><td> 1RT </td><td> TAGGGATCTGGGCGTTTCTG GCAAAT </td><td> 2578-2603 </td><td> Antisens </td></tr><tr><td> 1F </td><td> aatcccgggAGAAGTTTATC TGTGTGAACTT </td><td> 1-22 </td><td> Duyu </td></tr><tr><td> 1R </td><td> attgcggccgcCCACGTCGT TGTGCACGAAGAT </td><td> 2532-2553 </td><td> Antisens </td></tr><tr><td> 2RT </td><td> TTCTGCCTACTCTGCCCCTC CGTTGA </td><td> 5975-6000 </td><td> KarıncaISENSE </td></tr><tr><td> 2F </td><td> aatcccgggTCAAGCTCAGT GATGTTAACAT </td><td> 1800-1821 </td><td> Duyu </td></tr><tr><td> 2R </td><td> attgcggccgcGATGGGTTT CCGAGGATGACTC </td><td> 5929-5950 </td><td> Antisens </td></tr><tr><td> 3RT </td><td> ACGGTCTTTCCTTCTGCTGC AGGTCT </td><td> 9426-9451 </td><td> Antisens </td></tr><tr><td> 3F </td><td> aatcccgggGAGGATACATT GCTACCAAGGT </td><td> 5500-5521 </td><td> Duyu </td></tr><tr><td> 3R </td><td> attgcggccgcGTAAGTCAG TTCAATTATGGCT </td><td> 9380-9401 </td><td> Antisens </td></tr><tr><td> 4RT </td><td> AGATCCTGTGTTCTTCCTCA CCACCA </td><td> 10.952-10.977 </td><td> Antisens </td></tr><tr><td> 4F </td><td> aatcccgggAGTGGAAGGCT CAGGCGTCCAA </td><td> 9200-9221 </td><td> Duyu </td></tr><tr><td> 4R </td><td> attgcggccgcAGATCCTGT GTTCTTCCTCACC </td><td> 10.956-10.977 </td><td> Antisens </td></tr><tr><td> SP6F </td><td> cataccccgcgtattcccac ta </td><td></td><td> Duyu </td></tr><tr><td> SP6R </td><td> ACAGATAAACTTCTctatag tgtcccctaaa </td><td> 1-14 </td><td> Antisens </td></tr><tr><td> F1F </td><td> aggggacactatagAGAAGT TTATCTGTGTG </td><td> 1-17 </td><td> Duyu </td></tr><tr><td> F1R </td><td> TGGATCATTGCCCATGGTAA GCTTA </td><td> 638-662 </td><td> Antisens </td></tr><tr><td> X1F </td><td> CGAATGGATCGCACAGTGTG GAGAG </td><td> 8403-8427 </td><td> Duyu </td></tr><tr><td> X1R </td><td> AAAGCTTCAAACTCAAGATA CCGTGCTCC </td><td> 9120-9148 </td><td> Antisens </td></tr><tr><td> X2F </td><td> GGAGCACGGTATCTTGAGTT TGAAGCTTT </td><td> 9120-9148 </td><td> Duyu </td></tr><tr><td> X2R </td><td> cacgtggacgagggcatgcc tgcag </td><td></td><td> Antisens </td></tr><tr><td> ROF </td><td> CCAGGAGGACTGGGTTACCA AAGCC </td><td> 10.670-10.694 </td><td> Duyu </td></tr><tr><td> ROR </td><td> agggcggccgctctagAGAT CCTGTGTTCTTCCTCACCAC </td><td> 10.954-10.977 </td><td> Antisens </td></tr><tr><td colspan="4"> Bir JEV dizileri büyük harflerle gösterilir ve BAC dizileri küçük harflerle belirtilir. b nükleotid pozisyonu JEV SA 14 -14-2 (Genbank erişim numarası JN604986) tam genom sekansı anlamına gelir. </td></tr></tbody></table> Tablo 1: cDNA sentezi, PCR büyütmesi ve BAC mutagenezi için kullanılan oligonükleotidler. <img alt="figür 1" src="/files/ftp_upload/53164/53164fig1.jpg" /> Figür 1.0, Strateji BAC olarak JEV SA 14 -14-2 bir tam boy cDNA&#39;dan yapımı için JEV partiküllerden viral RNA&#39;nın (A) izolasyonu.. JEV SA 14 -14-2 genomik RNA bir şematik diyagramı gösterilmiştir. Tüm viral genomu kapsayan (B) dört örtüşen cDNA parçalarının Sentezi (F4 F1). PBAC / F4 pBAC / F1 yaratan bir BAC vektörü içine dört örtüşen cDNA fragmanlarının (C) Altklonlaması. In vitro olarak run-off transkripsiyonu için klonlanmış cDNA&#39;lar (D) modifikasyonu. pBAC / F1 SP6 viral 5&#39;-ucunda akış yukarı SP6 başlatıcısı dizisini ihtiva pBAC / F1 bir türevidir. pBAC / F3 KO sessiz nokta mutasyonu (T → A 9134, yıldız) içeren pBAC / F3 bir türevidir. pBAC / F4 RO viral 3&#39;-ucunun alt baş yapay Xba I run-off siteyi içeren pBAC / F4 bir türevidir. (E </<html> strong&gt;) tam uzunlukta SA 14 -14-2 BAC Meclisi (pBAC / SA 14 -14-2). <a href="https://www.jove.com/files/ftp_upload/53164/53164fig1large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 2," src="/files/ftp_upload/53164/53164fig2.jpg" /> JEV SA 14 -14-2 tam uzunlukta genomik RNA kapsayan Şekil dört örtüşen cDNA fragmanlarının 2. N- (F1 ila F4). Dört RT-PCR ürünleri,% 0.8 agaroz jeli içinde elektroforez ile değerlendirilir. M, 1 kb DNA merdiveni. Dört cDNA fragmanlarının beklenen boyutları jel görüntüsünün altında belirtilmiştir. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig2large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> /ftp_upload/53164/53164fig3.jpg &quot;/&gt; JEV bir tam boy bir cDNA SA 14 -14-2 ihtiva eden BAC Şekil 3. saflaştırılması. BAC plazmid E. izole edilir SDS-alkalin lisiz yöntemi ile coli DH10B ve ayrıca bir CsCl-EtBr gradyanı şeritleme ile saflaştırılmıştır. 16 × 76 mm yapışmalı polipropilen tüp kullanarak CsCl-EtBr degrade bir örnektir sunulmuştur. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig3large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 4," src="/files/ftp_upload/53164/53164fig4.jpg" /> JEV SA 14 -14-2 cDNA BAC monte tam uzunlukta bir bulaşıcı virüslerin geri kazanımı Şekil 4. bakış., CDNA şablonunun (A) doğrusallaştırılması. JEV BAC ile kesilir tam uzunluktaXba I ve MBN ile muamele edilmiştir. RNA transkriptlerinin (B) Sentezi. Doğrusallaştırılmış cDNA m 7 G (5 &#39;) ppp (5&#39;), bir başlık analogunun varlığında, SP6 RNA polimeraz tarafından transkribe edilmektedir. Sentetik JEVs (C) Kurtarma. In vitro transkripsiyonu RNA&#39;lar sentetik bir virüs titresi yüksek üretir elektroporasyon ile BHK-21 hücrelerine transfekte. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig4large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 5," src="/files/ftp_upload/53164/53164fig5.jpg" /> Bir cDNA, şablon olarak tam boyda JEV BAC kullanılarak in vitro transkripsiyon Şekil RNA&#39;lar 5. sentezi. Linearize tam uzunlukta JEV BAC, pBAC / SA 14 -14-2 (A) üretimi. PBAC İki bağımsız klon/ SA 14 -14-2 (Cl.1 ve CL.2) MBN ile Xba I ile sindirim ve daha sonra tedavi ile lineerleştirilebilir edilir. Doğrusallaştırılmış BAC% 0.8 agaroz jeli içinde elektroforez ile incelenmiştir. Çoğaltma transkripsiyonu ayrıca, sentetik RNA&#39;ların (B) üretimi. İki linearize BAC&#39;lerin her SP6 RNA polimeraz Çoğaltma transkripsiyonu için bir şablon olarak kullanılır. İki transkripsiyon reaksiyonları alikoları% 0.6 agaroz jeli üzerinde çalıştırılır. M, 1 kb DNA merdiveni. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig5large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 6," src="/files/ftp_upload/53164/53164fig6.jpg" /> Tam uzunlukta bir JEV BAC ve sentetik virüsün geri transkribe sentetik RNA&#39;ların Şekil 6. Belirli enfeksiyon. BHK-21 hücreleri, fr türetilmiş RNA transkriptleri ile (Mock), elektroporasyona-sahte veya elektroporasyona olantam uzunlukta JEV BAC (Cl.1 ve CL.2) iki bağımsız klon, her om. (A) RNA enfekte. Hücreler agaroz ile örtüldü ve post-transfeksiyon 4 gün sonra kristal mor ile boyandı. RNA enfekte hücrelerin (sol panel), elektroporasyona enfeksiyöz RNA miktarını tahmin etmek için enfeksiyöz merkezi deneyleri ile belirlenir. Ayrıca enfeksiyonlu merkezlerden temsili görüntüleri (sağ panel) gösterilmiştir. (B) Protein ifadesi. Hücreler 4 oyuklu oda slaytlar kültürlenir. 20 saat post-transfeksiyon (hpt) RNA-elektroporate edilmiş hücrelerde viral protein ifadesi, bir birincil anti-NS1 tavşan antiserumu ve ikincil bir Cy3-konjüge edilmiş keçi anti-tavşan IgG (kırmızı) ile imüno-tahlilleri ile analiz edilir. Çekirdekleri 4 &#39;, 6-diamidino-2-fenilindol (mavi) ile ters. Immunofloresan görüntüleri bunlara karşılık gelen diferansiyel girişim kontrast görüntülerde üst üste. (C) Virüs verimi. Hücreler 1 kültürlenir50 mm kültür yemekleri. 22 ve 40 hpt RNA-electroporated hücrelerinin kültür yüzer biriken enfeksiyöz virionlann üretim plak tahlilleri tarafından incelenir. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig6large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a>

Watch this Scientific Journal Video about Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses at JoVE.com

Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

Bakteriyel Yapay Kromozom: RNA Virüsler Pozitif iplikli Araştırmaları Fonksiyonel Genomik Aracı

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose ...

bacterial-artificial-chromosomes-functional-genomics-tool-for-study

Research

JoVE Journal

Immunology and Infection

21.2K Görüntüleme.  Utah State University. Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

Video: Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the generation of extreme population diversity that facilitates virus adaptation and evolution. Increasing evidence shows that the intrinsic error rates, and the resulting mutation frequencies, of RNA viruses can be modulated by subtle amino acid changes to the viral polymerase. Although biochemical assays exist for some viral RNA polymerases that permit quantitative measure of incorporation fidelity, here we describe a simple method of measuring mutation frequencies of RNA viruses that has proven to be as accurate as biochemical approaches in identifying fidelity altering mutations. The approach uses conventional virological and sequencing techniques that can be performed in most biology laboratories. Based on our experience with a number of different viruses, we have identified the key steps that must be optimized to increase the likelihood of isolating fidelity variants and generating data of statistical significance. The isolation and characterization of fidelity altering mutations can provide new insights into polymerase structure and function1-3. Furthermore, these fidelity variants can be useful tools in characterizing mechanisms of virus adaptation and evolution4-7.

The present article describes the steps required to isolate and characterize RNA polymerase fidelity variants of RNA viruses and how to use mutation frequency data to confirm fidelity changes in tissue culture.

Virüs mutasyon Frekans RNA Virüsler ve Karakterizasyonu Fidelity Varyantlar izolasyonu

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

İmmünoloji ve Enfeksiyon

Separation of Single-stranded DNA, Double-stranded DNA and RNA from an Environmental Viral Community Using Hydroxyapatite Chromatography

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2. Viruses modulate host cell abundance and diversity, contribute to the cycling of nutrients, alter host cell phenotype, and influence the evolution of both host cell and viral communities through the lateral transfer of genes 3. Numerous studies have highlighted the staggering genetic diversity of viruses and their functional potential in a variety of natural environments. 
Metagenomic techniques have been used to study the taxonomic diversity and functional potential of complex viral assemblages whose members contain single-stranded DNA (ssDNA), double-stranded DNA (dsDNA) and RNA genotypes 4-9. Current library construction protocols used to study environmental DNA-containing or RNA-containing viruses require an initial nuclease treatment in order to remove nontargeted templates 10. However, a comprehensive understanding of the collective gene complement of the virus community and virus diversity requires knowledge of all members regardless of genome composition. Fractionation of purified nucleic acid subtypes provides an effective mechanism by which to study viral assemblages without sacrificing a subset of the community&#x2019;s genetic signature. 
Hydroxyapatite, a crystalline form of calcium phosphate, has been employed in the separation of nucleic acids, as well as proteins and microbes, since the 1960s11. By exploiting the charge interaction between the positively-charged Ca2+ ions of the hydroxyapatite and the negatively charged phosphate backbone of the nucleic acid subtypes, it is possible to preferentially elute each nucleic acid subtype independent of the others. We recently employed this strategy to independently fractionate the genomes of ssDNA, dsDNA and RNA-containing viruses in preparation of DNA sequencing 12. Here, we present a method for the fractionation and recovery of ssDNA, dsDNA and RNA viral nucleic acids from mixed viral assemblages using hydroxyapatite chromotography.

We describe an efficient method to separate single-stranded DNA, double-stranded DNA and RNA molecules from environmental viral communities. Nucleic acids are fractionated using hydroxyapatite chromatography with increasing concentrations of phosphate-containing buffers. This method permits the isolation of all viral nucleic acid types from environmental samples.

Tek iplikli DNA, çift iplikli DNA ve RNA Hidroksiapatit Kromatografisi kullanarak bir Çevre Viral Topluluk ayrılması

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2.  Viruses modulate host cell abundance and diversity, ...

Introducing Shear Stress in the Study of Bacterial Adhesion

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the initial and determining step of the pathogenesis. Although experimentally adhesion is mostly studied in static conditions adhesion actually takes place in the presence of flowing liquid. First encounters between bacteria and their host often occur at the mucosal level, mouth, lung, gut, eye, etc. where mucus flows along the surface of epithelial cells. Later in infection, pathogens occasionally access the blood circulation causing life-threatening illnesses such as septicemia, sepsis and meningitis. A defining feature of these infections is the ability of these pathogens to interact with endothelial cells in presence of circulating blood. The presence of flowing liquid, mucus or blood for instance, determines adhesion because it generates a mechanical force on the pathogen. To characterize the effect of flowing liquid one usually refers to the notion of shear stress, which is the tangential force exerted per unit area by a fluid moving near a stationary wall, expressed in dynes/cm2. Intensities of shear stress vary widely according to the different vessels type, size, organ, location etc. (0-100 dynes/cm2). Circulation in capillaries can reach very low shear stress values and even temporarily stop during periods ranging between a few seconds to several minutes 1. On the other end of the spectrum shear stress in arterioles can reach 100 dynes/cm2 2. The impact of shear stress on different biological processes has been clearly demonstrated as for instance during the interaction of leukocytes with the endothelium 3. To take into account this mechanical parameter in the process of bacterial adhesion we took advantage of an experimental procedure based on the use of a disposable flow chamber 4. Host cells are grown in the flow chamber and fluorescent bacteria are introduced in the flow controlled by a syringe pump. We initially focused our investigations on the bacterial pathogen Neisseria meningitidis, a Gram-negative bacterium responsible for septicemia and meningitis. The procedure described here allowed us to study the impact of shear stress on the ability of the bacteria to: adhere to cells 1, to proliferate on the cell surface 5and to detach to colonize new sites 6 (Figure 1). Complementary technical information can be found in reference 7. Shear stress values presented here were chosen based on our previous experience1 and to represent values found in the literature. The protocol should be applicable to a wide range of pathogens with specific adjustments depending on the objectives of the study.

During the infection process, a key step is the adhesion of pathogens with host cells. In most instances this adhesion step occurs in the presence of mechanical stress generated by flowing liquid. We describe a technique that introduces shear stress as an important parameter in the study of bacterial adhesion.

Bakteriyel Yapışma Çalışma Kesme Stres Tanıtımı

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the ...

Isolation and Genome Analysis of Single Virions using 'Single Virus Genomics'

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which are ubiquitous and the most numerous entities on our planet 4 and important in all environments 5, have yet to be revealed via similar approaches. Here we describe an approach for isolating and characterizing the genomes of single virions called 'Single Virus Genomics' (SVG). SVG utilizes flow cytometry to isolate individual viruses and whole genome amplification to obtain high molecular weight genomic DNA (gDNA) that can be used in subsequent sequencing reactions.

Isolation and Genome Analysis of Single Virions using &#039;Single Virus Genomics&#039;

Single Virus Genomics (SVG) is a method to isolate and amplify the genomes of single virons. Viral suspensions of a mixed assemblage are sorted using flow cytometry onto a microscope slide with discrete wells containing agarose, thereby capturing the virion and reducing genome shearing during downstream processing. Whole genome amplification is achieved using multiple displacement amplification (MDA) resulting in genomic material that is suitable for sequencing.

&#39;Tek Virüs Genomik&#39; kullanarak Tek viryonlar İzolasyonu ve Genom Analizi

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

Polarize İnsan Havayolu bir sıvı kaplı Kültürünün Oluşturulması Solunum Patojenler için Host Hücre Yanıtı Okumak Epitel Calu-3 Hücreler<em&gt; In vitro</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Following in Real Time the Impact of Pneumococcal Virulence Factors in an Acute Mouse Pneumonia Model Using Bioluminescent Bacteria

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. Despite advances in knowledge of this illness, the availability of intensive care units (ICU), and the use of potent antimicrobial agents and effective vaccines, the mortality rates remain high1. Streptococcus pneumoniae is the leading pathogen of community-acquired pneumonia (CAP) and one of the most common causes of bacteremia in humans. This pathogen is equipped with an armamentarium of surface-exposed adhesins and virulence factors contributing to pneumonia and invasive pneumococcal disease (IPD). The assessment of the in vivo role of bacterial fitness or virulence factors is of utmost importance to unravel S. pneumoniae pathogenicity mechanisms. Murine models of pneumonia, bacteremia, and meningitis are being used to determine the impact of pneumococcal factors at different stages of the infection. Here we describe a protocol to monitor in real-time pneumococcal dissemination in mice after intranasal or intraperitoneal infections with bioluminescent bacteria. The results show the multiplication and dissemination of pneumococci in the lower respiratory tract and blood, which can be visualized and evaluated using an imaging system and the accompanying analysis software.

Streptococcus pneumoniae is the leading pathogen causing severe community-acquired pneumonia and responsible for over 2&#160;million deaths worldwide. The impact of bacterial factors implicated in fitness or virulence can be monitored in real-time in an acute mouse pneumonia or bacteremia model using bioluminescent bacteria.

Biyoluminesen Bakteriler Kullanılarak Gerçek Zamanda Bir Akut Fare Pnömoni Modelinde Pnömokok virulans faktörlerinin etkisi aşağıdaki

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat because of increased worldwide exchanges and human populations penetrating more and more natural ecosystems. A good example of such an emerging situation is chikungunya virus epidemics of 2005-2006 in the Indian Ocean. Recent progresses in our understanding of cellular pathways controlling viral replication suggest that compounds targeting host cell functions, rather than the virus itself, could inhibit a large panel of RNA viruses. Some broad-spectrum antiviral compounds have been identified with host target-oriented assays. However, measuring the inhibition of viral replication in cell cultures using reduction of cytopathic effects as a readout still represents a paramount screening strategy. Such functional screens have been greatly improved by the development of recombinant viruses expressing reporter enzymes capable of bioluminescence such as luciferase. In the present report, we detail a high-throughput screening pipeline, which combines recombinant measles and chikungunya viruses with cellular viability assays, to identify compounds with a broad-spectrum antiviral profile.

In vitro assays to measure virus replication have been greatly improved by the development of recombinant RNA viruses expressing luciferase or other enzymes capable of bioluminescence. Here we detail a high-throughput screening pipeline that combines such recombinant strains of measles and chikungunya viruses to isolate broad-spectrum antivirals from chemical libraries.

RNA Virüslerinin geniş spektrumlu Kimyasal Önleyicileri için yüksek verimli tarama

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

Detecting Glycogen in Peripheral Blood Mononuclear Cells with Periodic Acid Schiff Staining

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. Polysaccharides such as glycogen, glycoproteins, and glycolipids stain bright magenta making it easy to enumerate positive and negative cells within the tissue. In muscle cells PAS staining is used to determine the glycogen content in different types of muscle cells, while in blood cell samples PAS staining has been explored as a diagnostic tool for a variety of conditions. Blood contains a proportion of white blood cells that belong to the immune system. The notion that cells of the immune system possess glycogen and use it as an energy source has not been widely explored. Here, we describe an adapted version of the PAS staining protocol that can be applied on peripheral blood mononuclear immune cells from human venous blood. Small cells with PAS-positive granules and larger cells with diffuse PAS staining were observed. Treatment of samples with amylase abrogates these patterns confirming the specificity of the stain. An alternate technique based on enzymatic digestion confirmed the presence and amount of glycogen in the samples. This protocol is useful for hematologists or immunologists studying polysaccharide content in blood-derived lymphocytes.

Periodic acid Schiff staining is a technique that visualizes the polysaccharide content of tissues. This article demonstrates periodic acid Schiff staining protocol adapted for use on peripheral blood mononuclear cells purified from human venous blood. Such samples are enriched for lymphocytes and other white blood cells of the immune system.

Periyodik Asit Schiff Boyama ile periferik kan mononükleer hücreleri glikojen algılama

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. ...

Electroporation of Functional Bacterial Effectors into Mammalian Cells

The study of protein interactions in the context of living cells can generate critical information about localization, dynamics, and interacting partners. This information is particularly valuable in the context of host-pathogen interactions. Many pathogen proteins function within host cells in a variety of way such as, enabling evasion of the host immune system and survival within the intracellular environment. To study these pathogen-protein host-cell interactions, several approaches are commonly used, including: in vivo infection with a strain expressing a tagged or mutant protein, or introduction of pathogen genes via transfection or transduction. Each of these approaches has advantages and disadvantages. We sought a means to directly introduce exogenous proteins into cells. Electroporation is commonly used to introduce nucleic acids into cells, but has been more rarely applied to proteins although the biophysical basis is exactly the same. A standard electroporator was used to introduce affinity-tagged bacterial effectors into mammalian cells. Human epithelial and mouse macrophage cells were cultured by traditional methods, detached, and placed in 0.4 cm gap electroporation cuvettes with an exogenous bacterial pathogen protein of interest (e.g. Salmonella Typhimurium GtgE). After electroporation (0.3 kV) and a short (4 hr) recovery period, intracellular protein was verified by fluorescently labeling the protein via its affinity tag and examining spatial and temporal distribution by confocal microscopy. The electroporated protein was also shown to be functional inside the cell and capable of correct subcellular trafficking and protein-protein interaction. While the exogenous proteins tended to accumulate on the surface of the cells, the electroporated samples had large increases in intracellular effector concentration relative to incubation alone. The protocol is simple and fast enough to be done in a parallel fashion, allowing for high-throughput characterization of pathogen proteins in host cells including subcellular targeting and function of virulence proteins.

Electroporation was used to insert purified bacterial virulence effector proteins directly into living eukaryotic cells. Protein localization was monitored by confocal immunofluorescence microscopy. This method allows for studies on trafficking, function, and protein-protein interactions using active exogenous proteins, avoiding the need for heterologous expression in eukaryotic cells.

Memeli Hücreleri içinde fonksiyonel Bakteriyel Efektör elektroporasyonu

The study of protein interactions in the context of living cells can generate critical information about localization, dynamics, and interacting partners. ...

Intranasal Administration of Recombinant Influenza Vaccines in Chimeric Mouse Models to Study Mucosal Immunity

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the physiological mechanisms that mediate immune responses to vaccines perhaps due to the overall success of vaccination, which has reduced interest into the molecular and physiological mechanisms of vaccine immunity. However, several important human pathogens including influenza virus still pose a challenge for vaccination, and may benefit from immune-based strategies. 
Although influenza reverse genetics has been successfully applied to the generation of live-attenuated influenza vaccines (LAIVs), the addition of molecular tools in vaccine preparations such as tracer components to follow up the kinetics of vaccination in vivo, has not been addressed. In addition, the recent generation of mouse models that allow specific depletion of leukocytes during kinetic studies has opened a window of opportunity to understand the basic immune mechanisms underlying vaccine-elicited protection. Here, we describe how the combination of reverse genetics and chimeric mouse models may help to provide new insights into how vaccines work at physiological and molecular levels, using as example a recombinant, cold-adapted, live-attenuated influenza vaccine (LAIV). We utilized laboratory-generated LAIVs harboring cell tracers as well as competitive bone marrow chimeras (BMCs) to determine the early kinetics of vaccine immunity and the main physiological mechanisms responsible for the initiation of vaccine-specific adaptive immunity. In addition, we show how this technique may facilitate gene function studies in single animals during immune responses to vaccines. We propose that this technique can be applied to improve current prophylactic strategies against pathogens for which urgent medical countermeasures are needed, for example influenza, HIV, Plasmodium, and hemorrhagic fever viruses such as Ebola virus.

There is an overall lack of knowledge about how vaccines work. Here we propose the combined use of reverse genetics and bone marrow chimeric mice to gain insight into the early host immune responses to vaccines with a special focus on dendritic cells and T cell immunity.

Kimerik fare modellerinde Rekombinant Grip aşıların burun içinde yoluyla mukozal bağışıklık Okumak

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the ...