The authors would like to acknowledge the Utah Science Technology and Research fund for support of YML and the Korea National Research Foundation grants (2009-0069679 and 2010-0010154) for support of SIY. This research was supported by the Utah Agricultural Experiment Station, Utah State University, and approved as journal paper number UAES #8753. Also, the authors thank Dr. Deborah McClellan for editorial assistance.

The authors have declared that they have no competing financial interests.

הפרוטוקול הנוכחי שמש בהצלחה לייצר שיבוטים cDNA זיהומיות באורך מלא לשני זנים שונים (CNU / 27 LP2 ו -14 SA -14-2 28) של JEV, flavivirus שפונקציונלי cDNA הוכיח להיות קשה מטבעו לבנות ו להפיץ בגלל רעילות תא מארח וחוסר היציבות הגנטית של cDNA המשובט 8,74-76 פרוטוקול זה כולל שלושה מרכיבים עיקריים:. ראשון, למקסם את הסינתזה / ההגברה של עותק cDNA נאמן של רנ&quot;א הנגיפי באמצעות טרנסקריפטאז באיכות גבוהה / DNA פולימראז; שני, שיבוט האזור הנגיפי PRM-E קידוד המכיל רצפים רעילים (נתונים שלא פורסמו) 74,77,78 בBAC וקטור מספר מאוד נמוך עותק מcDNA הראשוני subcloning לצעדי ההרכבה cDNA באורך מלא הסופיים; ושלישית, ניצול BAC וקטור שיבוט שיכול להכיל דנ&quot;א זר עם גודל של 120-350 kb, 19-21 ממוצע שככל הנראה סובל inse DNA הגדולRTS מאשר לעשות וקטורי שיבוט אחרים. גישת שיבוט זה תהיה בדרך כלל החלים רב וירוסים אחרים חיובי גדיל RNA, במיוחד אלו עם הגנום RNA גדול של ~ 10-32 קילו. דור של שיבוט cDNA זיהומיות הוא צעד מפתח בפיתוח מערכת גנטיקה הפוכה לאיתור וירוסי RNA, במיוחד לוירוסי RNA חיובי גדיל, כי הגנום שלו פועל mRNA ויראלי כמו שמתורגמת לחלבונים על ידי הריבוזומים תא מארח. לפיכך, שכפול נגיפי יכול להיות שיזם את ההקדמה של מולקולת רנ&quot;א הגנום באורך נגזר cDNA לתוך תא מארח רגיש. הזמינות של שיבוט JEV cDNA זיהומיות, בשילוב עם טכנולוגיית ה- DNA רקומביננטי, גדלה ההבנה של היבטים שונים של מחזור החיים של נגיפנו ברמה המולקולרית, כגון ביטוי גנים 73,79 ושכפול הגנום. 63,64 כמו כן, באורך מלא שיבוט JEV cDNA הוכיח להיות כלי רב ערך לפיתוח של חיסונים אנטי 28 ווקטורי מסירת הגן. &lt;sup&gt; 80,81 כמו בכל וירוסי RNA חיובי גדיל, ישנם צעדים קריטיים מרובים בבניית cDNA הפונקציונלי אמין לJEV שממנו יכול להיות מסונתז RNAs המידבק ביותר במבחנה. באופן אידיאלי, הרצף של RNAs הסינתטי עיבד משיבוט של cDNA באורך מלא צריך להיות זהה לזה של RNA הגנומי ויראלי, במיוחד 5&#39;- ו3&#39;-מסוף הרצפים הנדרשים לייזום של שכפול רנ&quot;א הנגיפי . 60-62 בפרוטוקול הנוכחי, האותנטי 5&#39;- ו3&#39;-קצוות היו מובטח על ידי הצבת רצף אמרגן SP6 במעלה הזרם של נוקלאוטיד אדנין הראשון של הגנום הנגיפי ומיצוב אתר הגבלה ייחודי מלאכותי Xba אני במורד זרם של האחרון נוקלאוטיד תימין של הגנום הנגיפי, בהתאמה. כתרים RNAs הסינתטי עם 5 האותנטיים &#39;ו 3&#39; קצוות הופקו על ידי שעתוק נגר של te cDNA Xba אני-לינארית וטופל MBNmplate באמצעות פולימראז SP6 RNA דרוך עם G מ &#39;7 (5&#39;) PPP (5 &#39;) אנלוגי כובע. פרוטוקול זה יכול להיות שונה בכמה דרכים. לשעתוק במבחנה, אחר RNA פולימראז bacteriophage (למשל, T3 או T7) יכול לשמש בשילוב עם רצף האמרגן המוגדר היטב שלה. 27 כאתר נגר, אתר הגבלה שונה יכול להיות מנוצל אם היא לא נמצאת ב הגנום הנגיפי ואם RNA הסינתטי מcDNA לינארית מסתיים בסופו של הדבר האותנטי 3 &#39;. החשיבות של רצף נוקליאוטידים 3&#39;-הסוף הודגמה על ידי ירידה ~ של פי 10 בinfectivity RNA כאשר RNA סינטטי מכיל שלושה או ארבעה נוקלאוטידים וירוס-שאינו קשור בסופה 3 &quot;. 27 בתגובת שעתוק במבחנה, שני מ &#39;7 G (5&#39;) PPP (5 &#39;) ומטר 7 G (5&#39;) PPP (5 &#39;) אנלוגי כובע יכול לשמש G באותה מידה, אם כי המקומות האחרונים נוקלאוטיד G נוסף שאינו קשור במעלה הזרם של נגיפי 5 &quot;-end, אבל שבנוסף אינו משנה את ההדבקה או שכפול של RNA הסינתטי. 27 יתר על כן, הסרת תבנית cDNA מתעתיקי הרנ&quot;א על ידי DNase אני עיכול אין צורך לבדיקות infectivity RNA, כי תבנית cDNA עצמו אינה מדבקת. 27 טכנולוגית BAC עכשיו הוחל בבניית השיבוטים cDNA מדבקים לקומץ של וירוסים חיוביים גדיל RNA, כלומר, שתי JEVs, CNU / 27 LP2 וSA 14 -14-2 28 (גודל הגנום, ~ 11 KB); שני וירוסים דנגה, BR / 90 26 ו- NGC 29 (~ 11 KB); וירוס שלשולים הנגיפי שור, SD1 (~ 12 KB); 25 שני וירוסים קלאסיים קדחת חזירים, C ו- פאדרבורן (~ 12 KB); 24 וירוס המחלה גבול, Gifhorn (~ 12 KB); 24 וירוס תסמונת רבייה ונשימה חזירי , PL97-1 / LP1 (~ 15 KB); 30 וירוס גסטרו-ההעברה, PUR46-MAD (~ 29 KB); 16 וירוס דלקת הצפק המדבק של חתולים,DF-2 (~ 29 KB); 32 קורונה החמור החריף בדרכי הנשימה תסמונת, Urbani (~ 30 KB); 9 קורונה תסמונת הנשימה המזרח התיכון, EMC / 2012 (~ 30 KB); 17 וקורונה האנושי, OC43 (~ 31 KB) 31 היתרון העיקרי של שימוש בBACS לבניית cDNA הוא היציבות הגנטית הגבוהה של פלסמידים BAC הגדולים, 1 או 2-עותק.; עם זאת, הטבע הפנימי של מאוד נמוך העותק מספרו הוא גם חסרון גדול, בגלל תשואות נמוכות מאוד של DNA BAC וההפחתה הסוגר בטוהר של ה- DNA BAC ביחס לארח DNA כרומוזומליות. בפרוטוקול הנוכחי, התשואה של BAC DNA מוגדל על ידי גידול E. coli DH10B הפך עם pBAC BAC המדבק / 14 SA -14-2 במדיום עשיר בחומרים מזינים, 2xYT. למרות מאמץ זה, התשואה הממוצעת היא רק ~ 15 מיקרוגרם של ה- DNA BAC מ 500 מיליליטר של מרק 2xYT. כמו כן, את הטוהר של ה- DNA BAC הוא הטוב ביותר להשיג באמצעות צנטריפוגה שיפוע צפיפות CsCl-EtBr לטיהור, ולא בידוד פלסמיד המבוסס על טור הנפוץ. עם זאת, חשוב לזכור כי א-שינה BAC coli לא צריך לגדול יותר, כי זה עלול לסכן את היציבות הגנטית של cDNA המשובט, וצמיחה גבוהה יותר לא בהכרח תוביל לתשואות גדולות יותר או DNA BAC גבוה-הטוהר. הפרוטוקול המתואר כאן הוא ושיטה מותאמות, יעילים, יעילה לבנייה וההפצה של שיבוט cDNA זיהומיות יציב מבחינה גנטית באורך מלא כBAC לJEV, הליך חשב כמעט בלתי אפשרי פעם אחת. אותה אסטרטגית שיבוט זה יכול גם להיות מיושם לרב וירוסי RNA חיובי גדיל אחרים. באופן כללי, שיבוטים cDNA זיהומיות יאפשר לנו להציג את מגוון רחב של מוטציות (למשל, מחיקות, הוספות, ומוטציות נקודה) לגנום רנ&quot;א נגיפי ללמוד פונקציות הביולוגיות שלהם בשכפול ופתוגנזה ויראלי. מערכת גנטיקה ההפוכה מבוסס cDNA זה מאפשר לפתח וTESחיסון לא ומועמדים טיפוליים מיקוד גורם ארסיות (ים) של נגיף RNA חיובי גדיל מסוים של עניין. בנוסף, טכנולוגית cDNA זיהומיות זה יכול גם לשמש כוקטור נגיפי, מסוגל להביע גן זר (ים) של עניין עבור יישומים רבים במחקר ביו-רפואי.

לירולוגים RNA, כניסתו של טכנולוגיית ה- DNA רקומביננטי בשנתי ה -1970 המאוחרות שאפשר להמיר את הגנום רנ&quot;א נגיפי לשיבוטי cDNA, אשר לאחר מכן יכול להיות מופץ כפלסמידים בחיידקים למניפולציה הגנטית של נגיפי RNA. 1 להיות וירוס RNA הראשון מולקולרי המשובטים היה Qβ bacteriophage, וירוס RNA חיובי גדיל שמדביק coli Escherichia. פלסמיד המכיל עותק cDNA מלא של RNA הגנומי Qβ הוליד פאגים Qβ זיהומיות כאשר הציג לE. coli. 2 זמן קצר לאחר מכן, בטכניקה זו יושמה לנגיף פוליו, נגיף RNA חיובי גדיל של בני אדם ובעלי חיים. פלסמיד הנושא cDNA באורך מלא של RNA הגנומי נגיף הפוליו היה מידבק כאשר transfected לתאי יונקים ומסוגלים לייצר virions זיהומיות 3 בזה גישה &quot;שהושק ה- DNA&quot;, צריך להיות עיבד cDNAs המשובט intracellularly ליזום שכפול רנ&quot;א נגיפי.;עם זאת, לא ברור כיצד השעתוק הוא יזם ואיך התמלילים מעובדים לרצף הנגיפי הנכון. חשש זה הוביל לפיתוח של חלופה &quot;שהושק RNA&quot; גישה, לפיה עותק cDNA מלא של הגנום רנ&quot;א הנגיפי הוא משובט תחת אמרגן מוכר על ידי א &#39; coli או RNA פולימראז הפאג לייצור RNAs הסינתטי במבחנה עם &#39;ו 3&#39; טרמיני המוגדרים 5, שעובר את מחזור השכפול הנגיפי השלם כאשר הוכנסו לתאי מארח. 4,5 ההצלחה הראשונה עם גישה זו דווחה לוירוס פסיפס ברום , 6,7 וירוס RNA חיובי גדיל של צמחים. מאז, הגישה השיק RNA פותחה עבור מגוון רחב של וירוסי RNA חיובי גדיל, כולל caliciviruses, alphaviruses, flaviviruses, arteriviruses, וקורונה. 1,4,5,8 בשני דנ&quot;א ורנ&quot;א השיק מערכות גנטיקה הפוכה, הבנייה של פולשיבוט cDNA L-אורך הוא המפתח ליצירת DNA או RNA של וירוסי RNA חיובי גדיל מדבק, אבל זה הופך להיות אתגר משמעותי טכני כמו הגודל של עליות הגנום נגיפיות. 9-17 בפרט, הגנום RNA גדול של ~ 10 -32 Kb מציג שלושה מכשולים עיקריים לשיבוט של cDNA הפונקציונלי באורך מלא. 18 הקושי הראשון הוא הסינתזה של cDNA נאמן להעתיק, מאז הנאמנות של RT-PCR היא ביחס הפוך לאורכו של רנ&quot;א הנגיפי. המשוכה השנייה היא נוכחותם של רצפים רעילים, מאז מולקולות RNA ארוכות יותר עלולות להכיל רצפים בלתי צפויים מסוגלים לבצע את בר cDNA בפלסמידים לא יציבים בE. coli. הנושא השלישי והקריטי ביותר הוא הזמינות של וקטור מתאים, שכן קשה למצוא וקטור שיבוט שיכול לשכן להוסיף cDNA ויראלי של&gt; 10 KB. במהלך שלושת העשורים האחרונים, חסמים אלה היו להתגבר על ידי כמה התקדמויות בenzymology, מתודולוגיה,vectorology ד. 1,4,5,8 מבין אלה, הפיתוח המבטיח וחדשני ביותר הוא השיבוט של וירוסים גדולים חיובי גדיל RNA כרומוזומים מלאכותיים בקטריאלי זיהומיות כ( BACS). וקטור BAC הוא פלסמיד נמוך עותק שיבוט (1-2 עותקים / תא) המבוסס על ה גורם פוריות coli, עם גודל ממוצע של ה- DNA להוסיף ~ 120-350 kb 19-21 קטע DNA מוכנס לתוך וקטור BAC באופן דומה לשיבוט לתוך וקטורי שיבוט כלליים.; השיבוטים BAC וכתוצאה מכך הם יציבים לאורך דורות רבים בE. coli. 22,23 עד כה, טכנולוגית BAC נעשה שימוש כדי ליצור שיבוטים cDNA מדבקים ל&gt; 10 חברי שלוש משפחות חיוביות גדיל RNA וירוס, כלומר, Flaviviridae, 24-29 Arteriviridae, 30 וCoronaviridae. 9,16,17 , 31,32 שימוש בוירוס דלקת מוח יפני (JEV) כדוגמא, את העבודה הנוכחית מדווחת נהלים מפורטים שיכול להיותמשמש לבניית BAC זיהומיות באורך מלא יציב מבחינה גנטית עבור מגוון רחב של וירוסי RNA חיובי גדיל. JEV הוא flavivirus zoonotic 33 שמועבר בטבע בין ציפורים, חזירים, ומארחי חוליות אחרים על ידי וקטורי יתושים. 34,35 בבני אדם, זיהום JEV יכול לגרום לדלקת קרום המוח הקטלנית לעתים קרובות החמורה המחלה נוירולוגית היפנית (י&quot;א), 36 אשר מתרחש ב אסיה וחלקים של האוקיינוס ​​השקט במערב, 37,38 עם שכיחות שנתית משוערת של ~ 50,000-175,000 מקרים קליניים. 39,40 הגנום של JEV היא 11 KB, מולקולה ~ חד-גדילים, חיובי תחושת RNA ומורכבת מסגרת קריאה פתוחה יחידה (ORF) מוקפת שני אזורי קידוד-עישון (NCRs) ב5 &#39;ו 3&#39; מסתיימת. 41,42 ORF מקודד polyprotein שהוא ביקע על ידי מארח ופרוטאזות הנגיפית כדי לייצר 10 חלבונים בודדים, מיועד C, PRM, E, ns1, NS2A, NS2B, ns3 NS4A, NS4B, וNS5 בN- לכיוון C-מסוף. 34,43,44 כמו כן, דוארטופס xtended של ns1 (ns1 &#39;) בא לידי הביטוי על ידי -1 frameshifting ריבוזומלי בקודונים 8-9 של NS2A. 45,46 של 11 חלבונים אלה, שלושה החלבונים המבניים (C, PRM, ו- E) הם חיוניים ליצירה של זיהומיות virions, 47,48 ושמונת חלבוני nonstructural הנותרים (ns1 לNS5, וns1 &#39;) הם קריטיים עבור שכפול נגיפי RNA, הרכבה 49-51 חלקיקים, 52-56 והתחמקות חסינות מולדת. 57-59 שניהם 5&#39; ו 3 &quot;NCRs מכיל רצפי שימור ראשוניים ומבני RNA צורה משניים / יישונים, 60-62 שהם חשובים לויסות שכפול רנ&quot;א נגיפי. 63,64 פרוטוקול זה מתאר את הכלים, שיטות והאסטרטגיות ליצירת באורך מלא BAC זיהומיות של JEV 14 SA -14-2. 28 שיבוט BAC פונקציונלי זה מכיל עותק מלא cDNA של RNA הגנומי JEV, 65 אשר הקיף על ידי אמרגן לRNA פולימראז SP6 במעלה הזרםשל 5&#39;-הסוף הנגיפי ואתר הגבלה ייחודי Xba אני במורד הזרם של 3&#39;-הסוף הנגיפי במבחנה תעתיק ניגר. טכנולוגית BAC זה חל על בניית שיבוט מולקולרי cDNA פונקציונלי מלא עבור מערך של וירוסי RNA חיובי גדיל.

<table border="0" cellpadding="0" cellspacing="0" width="1054">
	<tbody>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">1. Molecular Cloning</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td style="width:235px;"></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">2xYT Broth</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">Y2377</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">[3H]UTP</td>
			<td style="width:275px;">PerkinElmer</td>
			<td style="width:243px;">NET380250UC</td>
			<td>Radioactive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">50-mL Tube</td>
			<td style="width:275px;">Thermo Scientific (Nalgene)</td>
			<td style="width:243px;">3114-0050</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">250-mL Bottle</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">356011</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose</td>
			<td style="width:275px;">Lonza</td>
			<td style="width:243px;">50004</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose (Low Melting Point)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">16520-100</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">AvaI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0152S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">AvrII</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0174S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BamHI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0136S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BsiWI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0553S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BsrGI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0575S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Butanol</td>
			<td style="width:275px;">Fisher Scientific</td>
			<td style="width:243px;">A399-1&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cap Analog [m7G(5&#697;)ppp(5&#697;)A]</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">S1405S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cesium Chloride</td>
			<td style="width:275px;">Fisher Scientific</td>
			<td style="width:243px;">BP1595-1</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Chloramphenicol</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C0378</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Chloroform</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C2432</td>
			<td>Carcinogenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">DE-81 Filter Paper</td>
			<td style="width:275px;">GE Healthcare Life Sciences</td>
			<td style="width:243px;">3658-023</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">dNTP mix</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18427-088</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">E. coli DH10B&#160;</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18297-010</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">EDTA</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E5134</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Ethanol&#160;</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E7023</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Ethidium Bromide</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E7637</td>
			<td>Toxic and highly mutagenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Filter Column (Plasmid Maxiprep Kit)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">K2100-26</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glacial Acetic Acid</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">A6283</td>
			<td>Irritating</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glucose</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">G5400</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glycogen&#160;</td>
			<td style="width:275px;">Roche</td>
			<td style="width:243px;">10901393001</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">High-Fidelity DNA Polymerase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0491S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Isoamyl Alcohol</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">I9392</td>
			<td>Flammable</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Isopropanol&#160;</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0918</td>
			<td>Flammable</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">LB Broth</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">12795-027</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Lithium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">L9650</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Lysozyme</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0663</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Magnesium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">M8266</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">M-MLV Reverse Transcriptase</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18080-044</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Mung Bean Nuclease</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0250S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Needle (18G, 20G)</td>
			<td style="width:275px;">BD</td>
			<td style="width:243px;">305196, 305175</td>
			<td>Biohazardous (Sharps waste)</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">NotI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0189S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Oligonucleotide</td>
			<td style="width:275px;">Integrated DNA Technologies</td>
			<td style="width:243px;">Custom Oligonucleotide Synthesis</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">PacI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0547S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">pBeloBAC11</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">ER2420S (E4154S)</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol (Buffer-Saturated)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15513-039</td>
			<td>Toxic and highly corrosive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol:Chloroform:Isoamyl Alcohol</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15593-031</td>
			<td>Toxic and highly corrosive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol:Guanidine Isothiocyanate</td>
			<td style="width:275px;">Life Technologies (Ambion)</td>
			<td style="width:243px;">10296-010</td>
			<td>Toxic, corrosive, and irritating</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Pme I</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0560S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Acetate</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0698</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">RNase Inhibitor</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">10777-019</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">rNTP Set</td>
			<td style="width:275px;">GE Healthcare Life Sciences</td>
			<td style="width:243px;">27-2025-01</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sealable Polypropylene Tube (16 &#215; 76 mm)&#160;</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">342413</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">SfiI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0123S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sma I</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0141S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Acetate</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S2889</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Dodecyl Sulfate</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0227</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Hydroxide</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S5881</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">SP6 RNA Polymerase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0207S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Spin Column (Plasmid Miniprep Kit)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">K2100-11</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Syringe</td>
			<td style="width:275px;">HSW NORM-JECT</td>
			<td style="width:243px;">4200.000V0</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">T4 DNA Ligase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0202S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Tris</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0826</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">tRNA (yeast)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15401-011</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">XbaI&#160;</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0145S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Name</td>
			<td style="width:275px;">Company</td>
			<td style="width:243px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">2. Cell Culture</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Alpha Minimal Essential Medium</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">12561-049</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Conical Tube (50 mL)</td>
			<td style="width:275px;">VWR</td>
			<td style="width:243px;">21008-242</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Crystal Violet&#160;</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C0775</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Culture Dish (150 mm)&#160;</td>
			<td style="width:275px;">TPP</td>
			<td style="width:243px;">93150&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cuvette (2-mm Gap)</td>
			<td style="width:275px;">Harvard Apparatus</td>
			<td style="width:243px;">450125&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Fetal Bovine Serum&#160;</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">16000-044</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Formaldehyde</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">F1635</td>
			<td>Toxic and carcinogenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glutamine</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">25030-081</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Minimal Essential Medium</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">61100-061</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Penicillin/Streptomycin</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">15070-063</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">P3911</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Phosphate Monobasic</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">P9791</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Six-Well Plate</td>
			<td style="width:275px;">TPP</td>
			<td style="width:243px;">92006</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S3014</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Phosphate Dibasic</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S3264</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Trypsin-EDTA (0.25%)</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">25200-056</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Vitamins</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">M6895</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Name</td>
			<td style="width:275px;">Company</td>
			<td style="width:243px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">3. Equipment</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose Gel Electrophoresis System</td>
			<td style="width:275px;">Mupid</td>
			<td style="width:243px;">MPDEXU-01</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">CO2 Incubator</td>
			<td style="width:275px;">Thermo Scientific</td>
			<td style="width:243px;">Heracell 150i</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Desktop Centrifuge&#160;</td>
			<td style="width:275px;">Thermo Scientific</td>
			<td style="width:243px;">ST16R</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Electroporator</td>
			<td style="width:275px;">Harvard Apparatus</td>
			<td style="width:243px;">ECM 830</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Longwave Ultraviolet Lamps (Handheld)</td>
			<td style="width:275px;">UVP</td>
			<td style="width:243px;">UVGL-58</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Tabletop Centrifuge</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">368826</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Thermocycler</td>
			<td style="width:275px;">Life Technologies (Applied Biosystems)</td>
			<td style="width:243px;">GeneAmp PCR System 9700</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Vortexer</td>
			<td style="width:275px;">Scientific Industries</td>
			<td style="width:243px;">G-560</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Water Bath</td>
			<td style="width:275px;">Jeio Tech</td>
			<td style="width:243px;">WB-10E</td>
			<td></td>
		</tr>
	</tbody>
</table>

bacterial artificial chromosomes: a functional genomics tool for the study of positive-strand rna viruses

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose genomes have the same polarity as cellular mRNA. The cDNA-based reverse genetics system is a seminal method that enables direct manipulation of the viral genomic RNA, thereby generating recombinant viruses for molecular and genetic studies of both viral RNA elements and gene products in viral replication and pathogenesis. It also provides a valuable platform that allows the development of genetically defined vaccines and viral vectors for the delivery of foreign genes. For many positive-strand RNA viruses such as Japanese encephalitis virus (JEV), however, the cloned cDNAs are unstable, posing a major obstacle to the construction and propagation of the functional cDNA. Here, the present report describes the strategic considerations in creating and amplifying a genetically stable full-length infectious JEV cDNA as a bacterial artificial chromosome (BAC) using the following general experimental procedures: viral RNA isolation, cDNA synthesis, cDNA subcloning and modification, assembly of a full-length cDNA, cDNA linearization, in vitro RNA synthesis, and virus recovery. This protocol provides a general methodology applicable to cloning full-length cDNA for a range of positive-strand RNA viruses, particularly those with a genome of &gt;10 kb in length, into a BAC vector, from which infectious RNAs can be transcribed in vitro with a bacteriophage RNA polymerase.

לכל וירוסי RNA חיובי גדיל, האמינות והיעילות של מערכת גנטיקה הפוכה תלויה ביציבות הגנטית של cDNA באורך מלא משובט, הרצף שהוא שווה ערך לרצף הקונצנזוס של RNA הגנומי ויראלי. 27 איור 1 מציג חמישה אסטרטגית צעד לבניית cDNA זיהומיות באורך מלא כBAC לJEV SA 14 -14-2 28: שלב 1, טיהור של רנ&quot;א הנגיפי מsupernatant תרבית תאים של BHK-21 תאים נגועים JEV (איור 1 א); שלב 2, סינתזה של ארבע amplicons החופפות cDNA (F1 כדי F4) פורש הגנום הנגיפי השלם (איור 1); שלב 3, subcloning של כל אחד מארבעת שברי cDNA רציפים לתוך וקטור BAC, יצירת pBAC / F1 כדי pBAC / F4 (איור 1 ג); שלב 4, שינוי של cDNAs המשובט לשעתוק ניגר במבחנה עם RNA פולימראז SP6, כלומר, הצבת SP6רצף אמרגן מייד במעלה הזרם של 5&#39;-הסוף הנגיפי (pBAC / F1 SP6), ביטול מראש קיימים-פנימי אתר Xba אני בנוקלאוטיד 9,131 ידי החדרת מוטציה נקודה שקטה, 9,134 → T (pBAC / F3 KO), והכנסת אתר Xba המלאכותי החדש אני רץ-מייד במורד הזרם של 3&#39;-הסוף הנגיפי (pBAC / F4 RO) (איור 1D); ושלב 5, הרכבה של באורך מלא SA 14 -14-2 cDNA BAC, pBAC / SA 14 -14-2 (איור 1E). טבלת 1 רשימות oligonucleotides המשמש בתהליך שכפול זה. 28 לבניית JEV cDNA פונקציונלי, הצעד החשוב הראשון הוא הסינתזה של ארבעה שברי cDNA החופפים באמצעות רנ&quot;א הנגיפי המטוהר כתבנית לRT-PCR. איור 2 מספק תוצאת נציג לארבעה מוצרי RT-PCR שהיו electrophoresed על 0.8%agarose ג&#39;ל. ג&#39;ל זו ממחיש באופן ברור כי באורך מלא JEV cDNA מוגבר לארבעה שברי cDNA חופפים. מדי פעם, תגובות RT-PCR עשויות להניב מוצרי וירוס ספציפי או ספציפי נוסף אחת או יותר, כי הם קטנים יותר מאשר ברוב המוצר הצפוי, בגלל חישול ספציפי של פריימרים במהלך סינתזה / ההגברה cDNA. מצד השני, קטן או לא צפוי מוצר RT-PCR היה להיות מוגבר בגלל זיהום RNase המקרי במהלך בידוד RNA הנגיפי או ביצועי RT-PCR לא תקינים. הצעד הבא הוא מפתח השיבוט והשינוי של אורך מלא partial- או JEV cDNA בBAC, שהנו הליך פשוט יחסית שמשתמש בטכניקות DNA רקומביננטי סטנדרטיים. 69 איור 3 מציג תוצאות נציג לטיהור שיבוט BAC מכילה cDNA באורך מלא של JEV SA 14 -14-2 על ידי רצועות בשיפוע CsCl-EtBr.בניסוי זה, לאחר צנטריפוגה במשך 16 שעות ב401700 × גרם, שתי להקות שונות, כלומר, א &#39; DNA coli כרומוזומליות לעיל ופלסמיד דנ&quot;א BAC supercoiled להלן, נראה באמצע הצינור תחת אור אולטרה סגול גל ארוך. נפח מינימאלי (~ 400 μl) של להקת ה- DNA BAC הנמוכה נאסף בקפידה על ידי תוקע חור עם מזרק בצד של הצינור. בהמשך לכך, EtBr הופק מה- DNA BAC על ידי מיצוי butanol, וללא EtBr BAC DNA היה מרוכז על ידי משקעים אתנול. השלב האחרון הוא קביעת infectivity הספציפי של RNAs הסינתטי עיבד במבחנה באורך המלא SA 14 -14-2 BAC (pBAC / 14 SA -14-2) לאחר transfection RNA בתאי יתר (איור 4). צעד זה כרוך בשלושה שלבים עוקבים: שלב 1, linearization של האורך המלא SA 14 -14-2 cDNA ב&#39;3-end של הגנום הנגיפי (איור 4 א); שלב 2, ייצור RNAs הסינתטי מcDNA לינארית על ידי שעתוק נגר (איור 4); ושלב 3, הצלה של וירוסי רקומביננטי בBHK-21 תאים transfected עם RNAs הסינתטי (איור 4C). בניסוי, שני שיבוטים עצמאיים של pBAC / 14 SA -14-2 היו לינארית עם Xba אני עיכול וטופלו בMBN להסיר 5 הסככה ארבעה-הבסיס &quot;שנוצרה על ידי עיכול Xba אני. BACS ינארית נוקה על ידי מיצוי פנול, כלורופורם, ואחריו משקעים אתנול. Linearization של שני BACS המטוהר הודגם על 0.8% agarose ג&#39;ל (איור 5 א &#39;). חילוץ פנול, כלורופורם חייב להיעשות בזהירות כדי להבטיח שBACS לינארית הוא RNase ללא. כל אחד משני BACS ינארית שימש כתבנית cDNA לשעתוק נגר באמצעות פולימראז SP6 RNA בנוכחות G מ &#39;7 (5&#39;) PPP (5&#39;) אנלוגי כובע. שלמות RNAs הסינתטי הוצגה על ידי הפעלת aliquots של שתי תערובות תגובת שעתוק על 0.6% agarose ג&#39;ל, יחד עם סולם DNA KB התייחסות 1 (איור 5). ב assay זה פשוט, להקת RNA הבולט הגדולה תמיד היגרה רק להלן 3 kb התייחסות להקת DNA ונראיתי חד. עם זאת, מושפל RNA יהיה בעלת מראה מרוח על אותו ג&#39;ל. Assay מרכז זיהומיות הוא סטנדרט הזהב להחלטת infectivity הספציפי של RNAs הסינתטי. assay זה נעשה על ידי electroporating BHK-21 תאים עם דגימות RNA, זריעת aliquots שווה של פי 10 בדילול סדרתי התאים electroporated 6 צלחות המכילות גם BHK-21 תאים נאיביים (3 × 10 5 תאים היטב /), וכיסית agarose על monolayers התא. לאחר הדגירה במשך 4 ימים, תאים ששרדו היו קבועים עם פורמלדהיד ומוכתם בים סגול גבישolution לכמת את מספר מרכזי זיהומיות (פלאק), אשר תואם את מספר מולקולות RNA זיהומיות מועברות לתוך התאים (איור 6 א). מאז תבנית cDNA משמשת לשעתוק במבחנה הוכחה להיות שאינו מדבק, 27 aliquot של תערובת תגובת השעתוק היה ישירות המשמש לelectroporation. Electroporation הוא השיטה המועדפת לtransfection RNA; לחלופין, ניתן transfected RNAs בשיטות אחרות באמצעות יפוזומים DEAE-dextran וקטיוני. electroporation RNA הוא מאוד יעיל, אבל &quot;קשתי&quot; של הדופק החשמלי מתרחש רק לעתים נדירות, אם מלחים נמצאים בתגובת electroporation או אם קובט electroporation הוא שימוש חוזר. הביטוי של חלבונים נגיפיים בתאים-transfected RNA נבדק על ידי מבחני immunofluorescence באמצעות antiserum ארנב נגד ns1 (איור 6). הייצור של חלקיקים נגיפיים שנצברו בsupernatants של תאי transfected RNA היהalyzed על ידי מבחני פלאק (איור 6 ג). התוצאות של ניסויים אלה מראים בבירור כי RNAs הסינתטי נגזר cDNA הם מדבק בBHK-21 תאים מתירנית, יצירת כייל גבוה של וירוסי רקומביננטי. <table fo:keep-together.within-page="1" style=";text-align:right;direction:rtl"><tbody><tr><td> Oligonucleotide </td><td> רצף (5 &#39;ל 3&#39;) </td><td> ב מיקום </td><td> קוטביות </td></tr><tr><td> 1RT </td><td> TAGGGATCTGGGCGTTTCTG GCAAAT </td><td> 2578-2603 </td><td> Antisense </td></tr><tr><td> 1F </td><td> aatcccgggAGAAGTTTATC TGTGTGAACTT </td><td> 1-22 </td><td> לָחוּשׁ </td></tr><tr><td> 1R </td><td> attgcggccgcCCACGTCGT TGTGCACGAAGAT </td><td> 2532-2553 </td><td> Antisense </td></tr><tr><td> 2RT </td><td> TTCTGCCTACTCTGCCCCTC CGTTGA </td><td> 5975-6000 </td><td> נְמָלָהisense </td></tr><tr><td> 2F </td><td> aatcccgggTCAAGCTCAGT GATGTTAACAT </td><td> 1800-1821 </td><td> לָחוּשׁ </td></tr><tr><td> 2R </td><td> attgcggccgcGATGGGTTT CCGAGGATGACTC </td><td> 5929-5950 </td><td> Antisense </td></tr><tr><td> 3RT </td><td> ACGGTCTTTCCTTCTGCTGC AGGTCT </td><td> 9426-9451 </td><td> Antisense </td></tr><tr><td> 3F </td><td> aatcccgggGAGGATACATT GCTACCAAGGT </td><td> 5500-5521 </td><td> לָחוּשׁ </td></tr><tr><td> 3R </td><td> attgcggccgcGTAAGTCAG TTCAATTATGGCT </td><td> 9380-9401 </td><td> Antisense </td></tr><tr><td> 4RT </td><td> AGATCCTGTGTTCTTCCTCA CCACCA </td><td> 10,952-10,977 </td><td> Antisense </td></tr><tr><td> 4F </td><td> aatcccgggAGTGGAAGGCT CAGGCGTCCAA </td><td> 9200-9221 </td><td> לָחוּשׁ </td></tr><tr><td> 4R </td><td> attgcggccgcAGATCCTGT GTTCTTCCTCACC </td><td> 10,956-10,977 </td><td> Antisense </td></tr><tr><td> SP6F </td><td> cataccccgcgtattcccac ת&quot;א </td><td></td><td> לָחוּשׁ </td></tr><tr><td> SP6R </td><td> ACAGATAAACTTCTctatag tgtcccctaaa </td><td> 1-14 </td><td> Antisense </td></tr><tr><td> F1F </td><td> aggggacactatagAGAAGT TTATCTGTGTG </td><td> 1-17 </td><td> לָחוּשׁ </td></tr><tr><td> F1R </td><td> TGGATCATTGCCCATGGTAA GCTTA </td><td> 638-662 </td><td> Antisense </td></tr><tr><td> X1F </td><td> CGAATGGATCGCACAGTGTG GAGAG </td><td> 8403-8427 </td><td> לָחוּשׁ </td></tr><tr><td> X1R </td><td> AAAGCTTCAAACTCAAGATA CCGTGCTCC </td><td> 9120-9148 </td><td> Antisense </td></tr><tr><td> X2F </td><td> GGAGCACGGTATCTTGAGTT TGAAGCTTT </td><td> 9120-9148 </td><td> לָחוּשׁ </td></tr><tr><td> X2R </td><td> cacgtggacgagggcatgcc tgcag </td><td></td><td> Antisense </td></tr><tr><td> ROF </td><td> CCAGGAGGACTGGGTTACCA AAGCC </td><td> 10,670-10,694 </td><td> לָחוּשׁ </td></tr><tr><td> ROR </td><td> agggcggccgctctagAGAT CCTGTGTTCTTCCTCACCAC </td><td> 10,954-10,977 </td><td> Antisense </td></tr><tr><td colspan="4"> רצפי JEV מוצגים באותיות רישיות, ורצפי BAC מסומנים באותיות קטנות. עמדת נוקלאוטיד ב מתייחסת לרצף הגנום המלא של JEV SA 14 -14-2 (מספר הצטרפות GenBank JN604986). </td></tr></tbody></table> טבלה 1: Oligonucleotides משמש לסינתזת cDNA, הגברה PCR, וmutagenesis BAC. <img alt="איור 1" src="/files/ftp_upload/53164/53164fig1.jpg" /> איור 1.0; אסטרטגיה לבניית cDNA באורך מלא של JEV SA 14 -14-2 כBAC בידוד () של רנ&quot;א הנגיפי מחלקיקי JEV.. מוצג הוא תרשים סכמטי של RNA הגנומי של JEV SA 14 -14-2. (ב) סינתזה של ארבעה שברי cDNA חופפים (F1 כדי F4) המכסה את כל הגנום הנגיפי. Subcloning (C) של ארבעה שברי cDNA חופפים לוקטור BAC, יצירת pBAC / F1 כדי pBAC / F4. שינוי (D) של cDNAs המשובט לשעתוק נגר במבחנה. pBAC / F1 SP6 הוא נגזר של pBAC / F1 שמכיל את רצף אמרגן SP6 במעלה הזרם של 5&#39;-סוף ויראלי. pBAC / F3 KO הוא נגזר של pBAC / F3 המכיל מוטציה שקטה נקודה (9,134 → T, כוכבית). pBAC / F4 RO הוא נגזר של pBAC / F4 המכיל Xba אני מלאכותי אתר נגר במורד הזרם של 3&#39;-סוף ויראלי. (E </<html> strong&gt;) עצרת של באורך מלא SA 14 -14-2 BAC (pBAC / 14 SA -14-2). <a href="https://www.jove.com/files/ftp_upload/53164/53164fig1large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 2" src="/files/ftp_upload/53164/53164fig2.jpg" /> איור 2. סינתזה של ארבעה שברי cDNA חופפים (F1 כדי F4) פורש RNA הגנומי באורך המלא של JEV SA 14 -14-2. ארבעה מוצרי RT-PCR מוערכים על ידי אלקטרופורזה בג&#39;ל 0.8% agarose. M, סולם DNA 1 KB. הגדלים הצפויים של ארבעה שברי cDNA מסומנים בתחתית תמונת ג&#39;ל. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig2large.jpg" target="_blank">אנא לחצו כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> /ftp_upload/53164/53164fig3.jpg &quot;/&gt; טיהור איור 3. של BAC מכיל cDNA באורך מלא של 14 JEV SA -14-2. פלסמיד BAC מבודד מא coli DH10B בשיטת תמוגה SDS-בסיסית ומטוהר יותר על ידי רצועות בשיפוע CsCl-EtBr. הציג הוא דוגמא לשיפוע CsCl-EtBr באמצעות צינור פוליפרופילן סגר 16 × 76 מ&quot;מ. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig3large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 4" src="/files/ftp_upload/53164/53164fig4.jpg" /> סקירת איור 4. ההתאוששות של וירוסים מדבקים באורך מלא JEV SA 14 -14-2 cDNA התאסף בBAC. (א) לינאריזציה של תבנית cDNA. באורך המלא JEV BAC הוא לחתוך עםטופלתי Xba אני ועם MBN. סינתזה (ב) לתעתיקי הרנ&quot;א. CDNA לינארית הוא עיבד על ידי RNA פולימראז SP6 בנוכחות מ &#39;7 G (5&#39;) PPP (5 &#39;) אנלוגי כובע. (ג) שחזור של JEVs הסינתטי. במבחנה RNAs עבד הם transfected לBHK-21 תאים על ידי electroporation, אשר מייצר כייל גבוה של וירוס סינטטי. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig4large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 5" src="/files/ftp_upload/53164/53164fig5.jpg" /> איור 5. סינתזה של RNAs ידי שעתוק במבחנה באמצעות BAC JEV באורך מלא כתבנית cDNA. דור (א) לאורך המלא לינארית JEV BAC, pBAC / 14 SA -14-2. שני שיבוטים עצמאיים של pBAC/ SA 14 -14-2 (Cl.1 וCl.2) הם ינארית על ידי עיכול עם Xba אני וטיפול שלאחר מכן עם MBN. BACS ינארית נבחנים על ידי אלקטרופורזה בג&#39;ל 0.8% agarose. הפקה (ב) לRNAs הסינתטי על ידי שעתוק נגר. כל אחד משני BACS ינארית משמש כתבנית לשעתוק ניגר RNA פולימראז SP6. Aliquots של שתי תגובות השעתוק מנוהלים על 0.6% agarose ג&#39;ל. M, 1 KB סולם DNA. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig5large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 6" src="/files/ftp_upload/53164/53164fig6.jpg" /> איור 6. infectivity ספציפי של RNAs הסינתטי עיבד מBAC JEV באורך מלא וההתאוששות של וירוס סינטטי. BHK-21 תאים (מוק)-electroporated מדומים או electroporated עם תעתיקי הרנ&quot;א נגזרים frאום כל אחד משני השיבוטים העצמאיים של BAC JEV באורך מלא (Cl.1 וCl.2). () Infectivity RNA. התאים הם כיסו עם agarose ומוכתם בסגולים קריסטל ב 4 ימים לאחר transfection. infectivity RNA נקבע על ידי מבחני מרכז זיהומיות כדי להעריך את הכמות של RNA זיהומיות electroporated לתוך התאים (פנל משמאל). כמו כן, נציג תמונות של מרכזי זיהומיות מוצגות (פנל מימין). ביטוי חלבון (B). התאים בתרבית שקופיות קאמריות 4 היטב. ביטוי חלבון נגיפי בתאים-electroporated RNA ב 20 שעות שלאחר transfection (HPT) מנותח על ידי מבחני immunofluorescence באמצעות antiserum עיקרי נגד ns1 ארנב וIgG העז Cy3 מצומדות- המשני נגד ארנב (אדום). הגרעינים counterstained עם 4 &#39;, 6-diamidino-2-phenylindole (כחול). תמונות immunofluorescence הם כיסו על תמונות התערבות ההפרש לעומת זאת מקביל שלהם. תשואת וירוס (C). התאים בתרבית 150 מנות תרבות מ&quot;מ. הייצור של virions זיהומיות שנצבר בsupernatants התרבות של תאי electroporated RNA ב 22 ו -40 HPT נבדק על ידי מבחני פלאק. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig6large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a>

Watch this Scientific Journal Video about Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses at JoVE.com

Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

חיידקים מלאכותיים כרומוזומים: Genomics כלי פונקציונלי לחקר חיובי גדיל RNA וירוסים

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose ...

bacterial-artificial-chromosomes-functional-genomics-tool-for-study

Research

JoVE Journal

Immunology and Infection

21.2K Views.  Utah State University. Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

Video: Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the generation of extreme population diversity that facilitates virus adaptation and evolution. Increasing evidence shows that the intrinsic error rates, and the resulting mutation frequencies, of RNA viruses can be modulated by subtle amino acid changes to the viral polymerase. Although biochemical assays exist for some viral RNA polymerases that permit quantitative measure of incorporation fidelity, here we describe a simple method of measuring mutation frequencies of RNA viruses that has proven to be as accurate as biochemical approaches in identifying fidelity altering mutations. The approach uses conventional virological and sequencing techniques that can be performed in most biology laboratories. Based on our experience with a number of different viruses, we have identified the key steps that must be optimized to increase the likelihood of isolating fidelity variants and generating data of statistical significance. The isolation and characterization of fidelity altering mutations can provide new insights into polymerase structure and function1-3. Furthermore, these fidelity variants can be useful tools in characterizing mechanisms of virus adaptation and evolution4-7.

The present article describes the steps required to isolate and characterize RNA polymerase fidelity variants of RNA viruses and how to use mutation frequency data to confirm fidelity changes in tissue culture.

בידוד של פידליטי גרסאות של וירוסים RNA ו אפיון תדירות המוטציה וירוס

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

Separation of Single-stranded DNA, Double-stranded DNA and RNA from an Environmental Viral Community Using Hydroxyapatite Chromatography

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2. Viruses modulate host cell abundance and diversity, contribute to the cycling of nutrients, alter host cell phenotype, and influence the evolution of both host cell and viral communities through the lateral transfer of genes 3. Numerous studies have highlighted the staggering genetic diversity of viruses and their functional potential in a variety of natural environments. 
Metagenomic techniques have been used to study the taxonomic diversity and functional potential of complex viral assemblages whose members contain single-stranded DNA (ssDNA), double-stranded DNA (dsDNA) and RNA genotypes 4-9. Current library construction protocols used to study environmental DNA-containing or RNA-containing viruses require an initial nuclease treatment in order to remove nontargeted templates 10. However, a comprehensive understanding of the collective gene complement of the virus community and virus diversity requires knowledge of all members regardless of genome composition. Fractionation of purified nucleic acid subtypes provides an effective mechanism by which to study viral assemblages without sacrificing a subset of the community&#x2019;s genetic signature. 
Hydroxyapatite, a crystalline form of calcium phosphate, has been employed in the separation of nucleic acids, as well as proteins and microbes, since the 1960s11. By exploiting the charge interaction between the positively-charged Ca2+ ions of the hydroxyapatite and the negatively charged phosphate backbone of the nucleic acid subtypes, it is possible to preferentially elute each nucleic acid subtype independent of the others. We recently employed this strategy to independently fractionate the genomes of ssDNA, dsDNA and RNA-containing viruses in preparation of DNA sequencing 12. Here, we present a method for the fractionation and recovery of ssDNA, dsDNA and RNA viral nucleic acids from mixed viral assemblages using hydroxyapatite chromotography.

We describe an efficient method to separate single-stranded DNA, double-stranded DNA and RNA molecules from environmental viral communities. Nucleic acids are fractionated using hydroxyapatite chromatography with increasing concentrations of phosphate-containing buffers. This method permits the isolation of all viral nucleic acid types from environmental samples.

ההפרדה של ה-DNA חד גדילי, פעמיים תקועים DNA ו-RNA מהקהילה ויראלי הסביבה באמצעות כרומטוגרפיה hydroxyapatite

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2.  Viruses modulate host cell abundance and diversity, ...

Introducing Shear Stress in the Study of Bacterial Adhesion

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the initial and determining step of the pathogenesis. Although experimentally adhesion is mostly studied in static conditions adhesion actually takes place in the presence of flowing liquid. First encounters between bacteria and their host often occur at the mucosal level, mouth, lung, gut, eye, etc. where mucus flows along the surface of epithelial cells. Later in infection, pathogens occasionally access the blood circulation causing life-threatening illnesses such as septicemia, sepsis and meningitis. A defining feature of these infections is the ability of these pathogens to interact with endothelial cells in presence of circulating blood. The presence of flowing liquid, mucus or blood for instance, determines adhesion because it generates a mechanical force on the pathogen. To characterize the effect of flowing liquid one usually refers to the notion of shear stress, which is the tangential force exerted per unit area by a fluid moving near a stationary wall, expressed in dynes/cm2. Intensities of shear stress vary widely according to the different vessels type, size, organ, location etc. (0-100 dynes/cm2). Circulation in capillaries can reach very low shear stress values and even temporarily stop during periods ranging between a few seconds to several minutes 1. On the other end of the spectrum shear stress in arterioles can reach 100 dynes/cm2 2. The impact of shear stress on different biological processes has been clearly demonstrated as for instance during the interaction of leukocytes with the endothelium 3. To take into account this mechanical parameter in the process of bacterial adhesion we took advantage of an experimental procedure based on the use of a disposable flow chamber 4. Host cells are grown in the flow chamber and fluorescent bacteria are introduced in the flow controlled by a syringe pump. We initially focused our investigations on the bacterial pathogen Neisseria meningitidis, a Gram-negative bacterium responsible for septicemia and meningitis. The procedure described here allowed us to study the impact of shear stress on the ability of the bacteria to: adhere to cells 1, to proliferate on the cell surface 5and to detach to colonize new sites 6 (Figure 1). Complementary technical information can be found in reference 7. Shear stress values presented here were chosen based on our previous experience1 and to represent values found in the literature. The protocol should be applicable to a wide range of pathogens with specific adjustments depending on the objectives of the study.

During the infection process, a key step is the adhesion of pathogens with host cells. In most instances this adhesion step occurs in the presence of mechanical stress generated by flowing liquid. We describe a technique that introduces shear stress as an important parameter in the study of bacterial adhesion.

היכרות עם מתח שאר בחקר הדבקה חיידקית

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the ...

Isolation and Genome Analysis of Single Virions using 'Single Virus Genomics'

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which are ubiquitous and the most numerous entities on our planet 4 and important in all environments 5, have yet to be revealed via similar approaches. Here we describe an approach for isolating and characterizing the genomes of single virions called 'Single Virus Genomics' (SVG). SVG utilizes flow cytometry to isolate individual viruses and whole genome amplification to obtain high molecular weight genomic DNA (gDNA) that can be used in subsequent sequencing reactions.

Isolation and Genome Analysis of Single Virions using &#039;Single Virus Genomics&#039;

Single Virus Genomics (SVG) is a method to isolate and amplify the genomes of single virons. Viral suspensions of a mixed assemblage are sorted using flow cytometry onto a microscope slide with discrete wells containing agarose, thereby capturing the virion and reducing genome shearing during downstream processing. Whole genome amplification is achieved using multiple displacement amplification (MDA) resulting in genomic material that is suitable for sequencing.

בידוד ואנליזה של הגנום virions יחיד באמצעות &#39;נומיקס וירוס אחד &quot;

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

הקמת תרבות הנוזלית מכוסית של Airway האנושי המקוטב-3 Calu תאי אפיתל ללמוד תגובת תא מארחת לפתוגנים נשימה<em&gt; במבחנה</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Following in Real Time the Impact of Pneumococcal Virulence Factors in an Acute Mouse Pneumonia Model Using Bioluminescent Bacteria

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. Despite advances in knowledge of this illness, the availability of intensive care units (ICU), and the use of potent antimicrobial agents and effective vaccines, the mortality rates remain high1. Streptococcus pneumoniae is the leading pathogen of community-acquired pneumonia (CAP) and one of the most common causes of bacteremia in humans. This pathogen is equipped with an armamentarium of surface-exposed adhesins and virulence factors contributing to pneumonia and invasive pneumococcal disease (IPD). The assessment of the in vivo role of bacterial fitness or virulence factors is of utmost importance to unravel S. pneumoniae pathogenicity mechanisms. Murine models of pneumonia, bacteremia, and meningitis are being used to determine the impact of pneumococcal factors at different stages of the infection. Here we describe a protocol to monitor in real-time pneumococcal dissemination in mice after intranasal or intraperitoneal infections with bioluminescent bacteria. The results show the multiplication and dissemination of pneumococci in the lower respiratory tract and blood, which can be visualized and evaluated using an imaging system and the accompanying analysis software.

Streptococcus pneumoniae is the leading pathogen causing severe community-acquired pneumonia and responsible for over 2&#160;million deaths worldwide. The impact of bacterial factors implicated in fitness or virulence can be monitored in real-time in an acute mouse pneumonia or bacteremia model using bioluminescent bacteria.

בעקבות בזמן אמת השפעת גורמי דלקת ריאות ארסיים בעכבר דלקת ריאות דגם אקוטי באמצעות חיידקי Bioluminescent

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat because of increased worldwide exchanges and human populations penetrating more and more natural ecosystems. A good example of such an emerging situation is chikungunya virus epidemics of 2005-2006 in the Indian Ocean. Recent progresses in our understanding of cellular pathways controlling viral replication suggest that compounds targeting host cell functions, rather than the virus itself, could inhibit a large panel of RNA viruses. Some broad-spectrum antiviral compounds have been identified with host target-oriented assays. However, measuring the inhibition of viral replication in cell cultures using reduction of cytopathic effects as a readout still represents a paramount screening strategy. Such functional screens have been greatly improved by the development of recombinant viruses expressing reporter enzymes capable of bioluminescence such as luciferase. In the present report, we detail a high-throughput screening pipeline, which combines recombinant measles and chikungunya viruses with cellular viability assays, to identify compounds with a broad-spectrum antiviral profile.

In vitro assays to measure virus replication have been greatly improved by the development of recombinant RNA viruses expressing luciferase or other enzymes capable of bioluminescence. Here we detail a high-throughput screening pipeline that combines such recombinant strains of measles and chikungunya viruses to isolate broad-spectrum antivirals from chemical libraries.

הקרנת תפוקה גבוהה לספקטרום רחב כימיים מעכבי RNA וירוסים

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

Detecting Glycogen in Peripheral Blood Mononuclear Cells with Periodic Acid Schiff Staining

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. Polysaccharides such as glycogen, glycoproteins, and glycolipids stain bright magenta making it easy to enumerate positive and negative cells within the tissue. In muscle cells PAS staining is used to determine the glycogen content in different types of muscle cells, while in blood cell samples PAS staining has been explored as a diagnostic tool for a variety of conditions. Blood contains a proportion of white blood cells that belong to the immune system. The notion that cells of the immune system possess glycogen and use it as an energy source has not been widely explored. Here, we describe an adapted version of the PAS staining protocol that can be applied on peripheral blood mononuclear immune cells from human venous blood. Small cells with PAS-positive granules and larger cells with diffuse PAS staining were observed. Treatment of samples with amylase abrogates these patterns confirming the specificity of the stain. An alternate technique based on enzymatic digestion confirmed the presence and amount of glycogen in the samples. This protocol is useful for hematologists or immunologists studying polysaccharide content in blood-derived lymphocytes.

Periodic acid Schiff staining is a technique that visualizes the polysaccharide content of tissues. This article demonstrates periodic acid Schiff staining protocol adapted for use on peripheral blood mononuclear cells purified from human venous blood. Such samples are enriched for lymphocytes and other white blood cells of the immune system.

גילוי גליקוגן בתאי הדם היקפי mononuclear עם תקופתי חומצה שיף מכתים

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. ...

Electroporation of Functional Bacterial Effectors into Mammalian Cells

The study of protein interactions in the context of living cells can generate critical information about localization, dynamics, and interacting partners. This information is particularly valuable in the context of host-pathogen interactions. Many pathogen proteins function within host cells in a variety of way such as, enabling evasion of the host immune system and survival within the intracellular environment. To study these pathogen-protein host-cell interactions, several approaches are commonly used, including: in vivo infection with a strain expressing a tagged or mutant protein, or introduction of pathogen genes via transfection or transduction. Each of these approaches has advantages and disadvantages. We sought a means to directly introduce exogenous proteins into cells. Electroporation is commonly used to introduce nucleic acids into cells, but has been more rarely applied to proteins although the biophysical basis is exactly the same. A standard electroporator was used to introduce affinity-tagged bacterial effectors into mammalian cells. Human epithelial and mouse macrophage cells were cultured by traditional methods, detached, and placed in 0.4 cm gap electroporation cuvettes with an exogenous bacterial pathogen protein of interest (e.g. Salmonella Typhimurium GtgE). After electroporation (0.3 kV) and a short (4 hr) recovery period, intracellular protein was verified by fluorescently labeling the protein via its affinity tag and examining spatial and temporal distribution by confocal microscopy. The electroporated protein was also shown to be functional inside the cell and capable of correct subcellular trafficking and protein-protein interaction. While the exogenous proteins tended to accumulate on the surface of the cells, the electroporated samples had large increases in intracellular effector concentration relative to incubation alone. The protocol is simple and fast enough to be done in a parallel fashion, allowing for high-throughput characterization of pathogen proteins in host cells including subcellular targeting and function of virulence proteins.

Electroporation was used to insert purified bacterial virulence effector proteins directly into living eukaryotic cells. Protein localization was monitored by confocal immunofluorescence microscopy. This method allows for studies on trafficking, function, and protein-protein interactions using active exogenous proteins, avoiding the need for heterologous expression in eukaryotic cells.

Electroporation של effectors בקטריאלי פונקציונלי לתאי יונקים

The study of protein interactions in the context of living cells can generate critical information about localization, dynamics, and interacting partners. ...

Intranasal Administration of Recombinant Influenza Vaccines in Chimeric Mouse Models to Study Mucosal Immunity

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the physiological mechanisms that mediate immune responses to vaccines perhaps due to the overall success of vaccination, which has reduced interest into the molecular and physiological mechanisms of vaccine immunity. However, several important human pathogens including influenza virus still pose a challenge for vaccination, and may benefit from immune-based strategies. 
Although influenza reverse genetics has been successfully applied to the generation of live-attenuated influenza vaccines (LAIVs), the addition of molecular tools in vaccine preparations such as tracer components to follow up the kinetics of vaccination in vivo, has not been addressed. In addition, the recent generation of mouse models that allow specific depletion of leukocytes during kinetic studies has opened a window of opportunity to understand the basic immune mechanisms underlying vaccine-elicited protection. Here, we describe how the combination of reverse genetics and chimeric mouse models may help to provide new insights into how vaccines work at physiological and molecular levels, using as example a recombinant, cold-adapted, live-attenuated influenza vaccine (LAIV). We utilized laboratory-generated LAIVs harboring cell tracers as well as competitive bone marrow chimeras (BMCs) to determine the early kinetics of vaccine immunity and the main physiological mechanisms responsible for the initiation of vaccine-specific adaptive immunity. In addition, we show how this technique may facilitate gene function studies in single animals during immune responses to vaccines. We propose that this technique can be applied to improve current prophylactic strategies against pathogens for which urgent medical countermeasures are needed, for example influenza, HIV, Plasmodium, and hemorrhagic fever viruses such as Ebola virus.

There is an overall lack of knowledge about how vaccines work. Here we propose the combined use of reverse genetics and bone marrow chimeric mice to gain insight into the early host immune responses to vaccines with a special focus on dendritic cells and T cell immunity.

Intranasal המינהל של החיסונים שפעת רקומביננטי במודלי כימרי עכבר ללמוד חסינות רירית

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the ...