The authors would like to acknowledge the Utah Science Technology and Research fund for support of YML and the Korea National Research Foundation grants (2009-0069679 and 2010-0010154) for support of SIY. This research was supported by the Utah Agricultural Experiment Station, Utah State University, and approved as journal paper number UAES #8753. Also, the authors thank Dr. Deborah McClellan for editorial assistance.

The authors have declared that they have no competing financial interests.

Il protocollo attuale è stata utilizzata con successo per generare full-length cDNA cloni infettive, per due diversi ceppi (CNU / LP2 27 e SA 14 -14-2 28) di ICE, un flavivirus cui cDNA funzionale ha dimostrato di essere di per sé difficile da costruire e propagare causa della tossicità cellula ospite e l&#39;instabilità genetica del cDNA clonato 8,74-76 Questo protocollo prevede tre componenti principali:. prime, massimizzando la sintesi / amplificazione del cDNA una copia fedele del RNA virale con alta fedeltà transcrittasi inversa / DNA polimerasi; secondo, la clonazione il PRM-E codificanti regione virale contenente sequenze tossiche (dati non pubblicati) 74,77,78 in un bassissimo copia numero vettore BAC del cDNA iniziale subcloning ai full-length fasi di montaggio cDNA finali; e in terzo luogo, utilizzando un tasso alcolemico di clonazione vettore che può ospitare un DNA estraneo con una dimensione media di 120-350 kb, 19-21 che tollera apparentemente più grande inse DNArts di quanto non facciano altri vettori di clonazione. Questo approccio clonazione sarà generalmente applicabile a molti altri virus a RNA positivi filamento, in particolare quelli con una grande genoma RNA del ~ 10 a 32 kb. Generazione di un clone di cDNA infettiva è un passo fondamentale nello sviluppo di un sistema di genetica inversa per virus a RNA, soprattutto per i virus a RNA positivi a filo, perché il suo genoma agisce come mRNA virale che si traduce in proteine ​​dai ribosomi della cellula ospite. Così, la replicazione virale può essere iniziato con l&#39;introduzione di un genoma lunghezza RNA molecola di cDNA derivato in una cellula ospite suscettibile. La disponibilità di un clone di infettiva ICE cDNA, quando combinato con la tecnologia del DNA ricombinante, ha aumentato la nostra comprensione dei vari aspetti del ciclo di vita virale a livello molecolare, come ad esempio l&#39;espressione genica 73,79 e replicazione del genoma. 63,64 Inoltre, un full-length ICE clone di cDNA ha dimostrato di essere uno strumento prezioso per lo sviluppo di vaccini antivirali 28 e vettori di trasferimento genico. &lt;sup&gt; 80,81 Come per tutti i virus RNA positivi fili, ci sono più passaggi critici nella costruzione di un cDNA funzionale affidabile per ICE da cui RNA altamente infettivi possono essere sintetizzate in vitro. Idealmente, la sequenza di RNA sintetici trascritti da un clone della intera lunghezza cDNA dovrebbe essere identica a quella del RNA genomico virale, in particolare i 5&#39;- e 3&#39;-terminale sequenze che sono necessari per l&#39;inizio della replicazione virale RNA . 60-62 Nel protocollo corrente, l&#39;autentica e 5&#39;-3&#39;-estremità erano assicurati mettendo la sequenza del promotore SP6 monte della prima adenina nucleotide del genoma virale e il posizionamento di un sito di restrizione Xba I artificiale unica valle dell&#39;ultimo timina nucleotide del genoma virale, rispettivamente. Capped RNA sintetici con l&#39;autentico 5 &#39;e 3&#39; estremità sono state prodotte dalla trascrizione run-off di un Xba I-linearizzato e MBN trattati cDNA template usando SP6 RNA polimerasi innescato con il m 7 G (5 &#39;) ppp (5&#39;) Un analogo cap. Questo protocollo può essere modificato in vari modi. Per la trascrizione in vitro, un&#39;altra RNA batteriofago polimerasi (ad esempio, T3 o T7) può essere utilizzato in combinazione con la sua sequenza promotore ben definita. 27 Come sito scolo, un sito di restrizione differente può essere utilizzata se non è presente in il genoma virale e se l&#39;RNA sintetico del cDNA linearizzato termina con l&#39;autentico 3 &#39;. L&#39;importanza della sequenza nucleotidica 3&#39;-end è stata dimostrata da una diminuzione ~ 10 volte in RNA infettività quando un RNA sintetico contiene tre o quattro nucleotidi virus non correlato alla sua &#39;estremità 3. 27 In una reazione di trascrizione in vitro, sia la m 7 G (5 &#39;) ppp (5&#39;) A e m 7 G (5 &#39;) ppp (5&#39;) G tappo analogico può essere utilizzato altrettanto bene, anche se queste ultime posti un estraneo G nucleotide supplementare monte del virale 5 &#39;-end, ma cheInoltre non altera l&#39;infettività o la replica di RNA sintetico. 27 Inoltre, la rimozione del cDNA da RNA trascritti di DNasi I digestione non è necessaria per le prove RNA infettività, poiché il modello cDNA sé non è infettiva. 27 La tecnologia BAC è stata ora applicata alla costruzione di cloni di cDNA infettivi per una manciata di virus a RNA positivo filamento, vale a dire, due JEVs, CNU / LP2 27 e SA 14 -14-2 28 (dimensione del genoma, ~ 11 kb); due virus dengue, BR / 90 26 e NGC 29 (~ 11 kb); il virus della diarrea bovina virale, SD1 (~ 12 kb); 25 due classici virus della febbre suina, C e Paderborn (~ 12 kb); 24 il virus della malattia di confine, Gifhorn (~ 12 Kb); 24 il suino virus sindrome riproduttiva e respiratoria , PL97-1 / LP1 (~ 15 kb); 30 il virus gastroenterite trasmissibile, PUR46-MAD (~ 29 kb); 16 il felino virus della peritonite infettiva,DF-2 (~ 29 kb), 32 la grave sindrome acuta da coronavirus respiratorio, Urbani (~ 30 kb), 9 Medio Oriente sindrome respiratoria coronavirus, EMC / 2012 (~ 30 kb), 17 e coronavirus umano, OC43 (~ 31 kb) 31 Il principale vantaggio di utilizzare BAC per la costruzione di cDNA è l&#39;elevata stabilità genetica delle grandi, 1 o 2 copie plasmidi BAC.; tuttavia, la natura intrinseca del suo numero estremamente basso di copia è anche un grande svantaggio, a causa delle basse rese di DNA BAC e la conseguente riduzione della purezza del DNA BAC rispetto ospitare DNA cromosomico. Nel protocollo attuale, il rendimento del DNA BAC è massimizzata da una crescente E. coli DH10B trasformato con il contagioso BAC PBAC / SA 14 -14-2 in un mezzo ricco di sostanze nutritive, 2xYT. Nonostante questo sforzo, il rendimento medio è solo ~ 15 mg di DNA BAC da 500 ml di brodo 2xYT. Inoltre, la purezza del DNA BAC è meglio realizzato utilizzando CsCl-EtBr centrifugazione in gradiente di densità per la purificazione, Piuttosto che la colonna basata isolamento plasmide comunemente usato. Tuttavia, è importante tenere presente che la E. BAC trasformati coli non deve invadere perché potrebbe mettere a repentaglio la stabilità genetica del cDNA clonato, e una maggiore crescita non necessariamente portare a maggiori rendimenti o superiore purezza BAC DNA. Il protocollo qui descritto è ottimizzato, efficiente, e il metodo semplificato per la costruzione e la propagazione di un full-length geneticamente stabile clone cDNA infettiva come BAC per ICE, una procedura volta pensò praticamente impossibile. Questa stessa strategia di clonazione può anche essere applicato a molti altri virus a RNA positivo filamento. In generale, cloni di cDNA infettivi ci permettono di introdurre una varietà di mutazioni (ad esempio, delezioni, inserzioni e mutazioni puntiformi) in un RNA genoma virale per studiare le loro funzioni biologiche nella replicazione virale e la patogenesi. Questo sistema di genetica inversa basata cDNA-consente di sviluppare e TESt vaccino e candidati terapeutici mirati un fattore di virulenza (s) di un particolare virus RNA positivo filamento di interesse. Inoltre, questa tecnologia cDNA infettiva può essere utilizzato anche come un vettore virale, capace di esprimere un gene estraneo (s) di interesse per molte applicazioni nella ricerca biomedica.

Per virologi di RNA, l&#39;avvento della tecnologia del DNA ricombinante alla fine del 1970 ha permesso di convertire i genomi di RNA virale in cloni di cDNA, che potrebbero poi essere propagati come plasmidi nei batteri per la manipolazione genetica dei virus RNA. 1 Il primo virus RNA per essere molecolarmente clonato era batteriofago Qβ, un virus a RNA positivo filamento che infetta Escherichia coli. Un plasmide contenente una copia completa del cDNA dell&#39;RNA genomico Qβ all&#39;origine infettive fagi Qβ quando introdotto in E. coli. 2 Poco dopo, questa tecnica è stata applicata a poliovirus, virus RNA positivo filamento di esseri umani e animali. Un plasmide recante un full-length cDNA dell&#39;RNA genomico poliovirus è infettivo quando trasfettato in cellule di mammifero e in grado di produrre virioni infettivi 3 In questo approccio &quot;DNA-lanciato&quot;, i cDNA clonati andrebbe trascritto intracellulare di avviare la replicazione dell&#39;RNA virale.;Tuttavia, non è chiaro come si inizia la trascrizione e come le trascrizioni vengono elaborati nella sequenza corretta virale. Questa preoccupazione ha portato allo sviluppo di un&#39;alternativa &quot;RNA-lanciato&quot; approccio, in cui una copia completa del cDNA dell&#39;RNA genoma virale viene clonato sotto promotore riconosciuto da un E. coli o fago RNA polimerasi per la produzione di RNA sintetici in vitro con definito 5 &#39;e 3&#39; termini, che subiscono il ciclo completo di replicazione virale quando introdotto in cellule ospiti. 4,5 Il primo successo con questo approccio è stato segnalato per brome mosaic virus , 6,7 un virus RNA positivo filamento di piante. Da allora, l&#39;approccio RNA lanciato è stato sviluppato per una vasta gamma di virus a RNA positivo filamento, tra cui calicivirus, alphaviruses, flavivirus, arteriviruses e coronavirus. 1,4,5,8 Sia il DNA e RNA-lanciato sistemi genetica inversa, la costruzione di un Full lunghezza clone di cDNA è la chiave per generare DNA infettivo o RNA di virus a RNA positivo filamento, ma diventa una sfida considerevole tecnica come la dimensione degli aumenti genoma virale. 9-17 In particolare, una grande genoma RNA di ~ 10 -32 kb presenta tre principali ostacoli alla clonazione di un cDNA funzionale full-length. 18 La prima difficoltà è la sintesi di un fedele cDNA copiano, poiché la fedeltà di RT-PCR è inversamente proporzionale alla lunghezza del RNA virale. Il secondo ostacolo è la presenza di sequenze potenzialmente tossici, poiché le molecole di RNA lunghi sono più probabile che contengono sequenze inaspettati capaci di rendere il frammento di cDNA in plasmidi instabili in E. coli. Il terzo e più importante problema è la disponibilità di un vettore adatto, dal momento che è difficile trovare un vettore di clonazione che può alloggiare un inserto di cDNA virale&gt; 10 kb. Nel corso degli ultimi tre decenni, queste barriere sono state superate da alcuni progressi in enzimologia, la metodologia, und vectorology. 1,4,5,8 Di questi, lo sviluppo più promettente e innovativo è la clonazione di grandi virus a RNA positivo filamento come infettive cromosomi batterici artificiali (BAC). Il vettore BAC è un plasmide a basso copia clonazione (1-2 copie / cella) in base alla E. coli plasmide f, con una dimensione media di DNA dell&#39;inserto ~ 120-350 kb 19-21 Un frammento di DNA viene inserito nel vettore BAC in modo simile alla clonazione nei vettori di clonazione generali.; le conseguenti cloni BAC sono stabili per molte generazioni a E. coli. 22,23 ad oggi, la tecnologia BAC è stata utilizzata per creare cloni di cDNA infettivi per&gt; 10 membri di tre positivo-strand famiglie di virus RNA, cioè flaviviridae, 24-29 Arteriviridae, 30 e Coronaviridae. 9,16,17 , 31,32 Utilizzando virus dell&#39;encefalite giapponese (JEV), come esempio, il presente lavoro riporta le procedure dettagliate che possono essereutilizzato per costruire un full-length BAC infettiva geneticamente stabile per una varietà di virus RNA positivo filamento. ICE è un flavivirus zoonotici 33 che si trasmette nella natura tra gli uccelli, maiali e altri host vertebrati da zanzare vettori. 34,35 Nell&#39;uomo, l&#39;infezione può causare il ICE spesso fatale malattia neurologica grave encefalite giapponese (JE), 36 che si verifica in Asia e parti del Pacifico occidentale, 37,38 con un&#39;incidenza annuale stimata di ~ 50,000-175,000 casi clinici. 39,40 Il genoma di ICE è un ~ 11 kb, a singolo filamento, positivo-senso molecola di RNA ed è composto da un unico open reading frame (ORF) affiancato da due regioni non codificanti (NCR) al 5 &#39;e 3&#39; termina. 41,42 L&#39;ORF codifica una poliproteina che viene scisso dagli host e proteasi virali per generare 10 singole proteine, designato C, PRM E, NS1, NS2A, NS2B, NS3, NS4A, NS4B, e NS5 nella N in direzione C-terminale. 34,43,44 inoltre, una esotto forma di Xtended NS1 (NS1 &#39;) si esprime con -1 frameshifting ribosomiale ai codoni 8-9 di NS2A. 45,46 Di queste 11 proteine, le tre proteine ​​strutturali (C, PRM, ed E) sono essenziali per la formazione di malattie infettive virioni, 47,48 e le restanti otto proteine ​​non strutturali (NS1 a NS5, e NS1 &#39;) sono fondamentali per la replicazione virale RNA, assemblea 49-51 particella, 52-56 e innata immunità evasione. 57-59 Sia il 5&#39; e 3 &#39;NCR contengono conservati sequenze primarie e strutture forma RNA secondari e / o terziari, 60-62 che sono importanti per modulare la replicazione RNA virale. 63,64 Questo protocollo descrive gli strumenti, i metodi e le strategie per la generazione di un full-length BAC infettiva di ICE SA 14 -14-2. 28 Questo clone BAC funzionale contiene una copia completa del cDNA dell&#39;RNA genomico ICE, 65 che è comprendeva da un promotore per la polimerasi SP6 RNA a montedel virale 5&#39;-end e un sito di restrizione Xba I unica valle del 3&#39;-end virale per la trascrizione in vitro di dilavamento. Questa tecnologia BAC è applicabile alla costruzione di un clone molecolare di cDNA completamente funzionale per una vasta gamma di virus a RNA positivo-strand.

<table border="0" cellpadding="0" cellspacing="0" width="1054">
	<tbody>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">1. Molecular Cloning</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td style="width:235px;"></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">2xYT Broth</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">Y2377</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">[3H]UTP</td>
			<td style="width:275px;">PerkinElmer</td>
			<td style="width:243px;">NET380250UC</td>
			<td>Radioactive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">50-mL Tube</td>
			<td style="width:275px;">Thermo Scientific (Nalgene)</td>
			<td style="width:243px;">3114-0050</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">250-mL Bottle</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">356011</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose</td>
			<td style="width:275px;">Lonza</td>
			<td style="width:243px;">50004</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose (Low Melting Point)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">16520-100</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">AvaI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0152S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">AvrII</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0174S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BamHI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0136S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BsiWI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0553S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BsrGI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0575S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Butanol</td>
			<td style="width:275px;">Fisher Scientific</td>
			<td style="width:243px;">A399-1&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cap Analog [m7G(5&#697;)ppp(5&#697;)A]</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">S1405S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cesium Chloride</td>
			<td style="width:275px;">Fisher Scientific</td>
			<td style="width:243px;">BP1595-1</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Chloramphenicol</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C0378</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Chloroform</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C2432</td>
			<td>Carcinogenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">DE-81 Filter Paper</td>
			<td style="width:275px;">GE Healthcare Life Sciences</td>
			<td style="width:243px;">3658-023</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">dNTP mix</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18427-088</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">E. coli DH10B&#160;</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18297-010</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">EDTA</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E5134</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Ethanol&#160;</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E7023</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Ethidium Bromide</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E7637</td>
			<td>Toxic and highly mutagenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Filter Column (Plasmid Maxiprep Kit)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">K2100-26</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glacial Acetic Acid</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">A6283</td>
			<td>Irritating</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glucose</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">G5400</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glycogen&#160;</td>
			<td style="width:275px;">Roche</td>
			<td style="width:243px;">10901393001</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">High-Fidelity DNA Polymerase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0491S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Isoamyl Alcohol</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">I9392</td>
			<td>Flammable</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Isopropanol&#160;</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0918</td>
			<td>Flammable</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">LB Broth</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">12795-027</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Lithium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">L9650</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Lysozyme</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0663</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Magnesium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">M8266</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">M-MLV Reverse Transcriptase</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18080-044</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Mung Bean Nuclease</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0250S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Needle (18G, 20G)</td>
			<td style="width:275px;">BD</td>
			<td style="width:243px;">305196, 305175</td>
			<td>Biohazardous (Sharps waste)</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">NotI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0189S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Oligonucleotide</td>
			<td style="width:275px;">Integrated DNA Technologies</td>
			<td style="width:243px;">Custom Oligonucleotide Synthesis</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">PacI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0547S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">pBeloBAC11</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">ER2420S (E4154S)</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol (Buffer-Saturated)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15513-039</td>
			<td>Toxic and highly corrosive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol:Chloroform:Isoamyl Alcohol</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15593-031</td>
			<td>Toxic and highly corrosive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol:Guanidine Isothiocyanate</td>
			<td style="width:275px;">Life Technologies (Ambion)</td>
			<td style="width:243px;">10296-010</td>
			<td>Toxic, corrosive, and irritating</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Pme I</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0560S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Acetate</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0698</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">RNase Inhibitor</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">10777-019</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">rNTP Set</td>
			<td style="width:275px;">GE Healthcare Life Sciences</td>
			<td style="width:243px;">27-2025-01</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sealable Polypropylene Tube (16 &#215; 76 mm)&#160;</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">342413</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">SfiI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0123S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sma I</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0141S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Acetate</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S2889</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Dodecyl Sulfate</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0227</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Hydroxide</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S5881</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">SP6 RNA Polymerase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0207S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Spin Column (Plasmid Miniprep Kit)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">K2100-11</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Syringe</td>
			<td style="width:275px;">HSW NORM-JECT</td>
			<td style="width:243px;">4200.000V0</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">T4 DNA Ligase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0202S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Tris</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0826</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">tRNA (yeast)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15401-011</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">XbaI&#160;</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0145S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Name</td>
			<td style="width:275px;">Company</td>
			<td style="width:243px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">2. Cell Culture</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Alpha Minimal Essential Medium</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">12561-049</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Conical Tube (50 mL)</td>
			<td style="width:275px;">VWR</td>
			<td style="width:243px;">21008-242</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Crystal Violet&#160;</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C0775</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Culture Dish (150 mm)&#160;</td>
			<td style="width:275px;">TPP</td>
			<td style="width:243px;">93150&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cuvette (2-mm Gap)</td>
			<td style="width:275px;">Harvard Apparatus</td>
			<td style="width:243px;">450125&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Fetal Bovine Serum&#160;</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">16000-044</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Formaldehyde</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">F1635</td>
			<td>Toxic and carcinogenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glutamine</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">25030-081</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Minimal Essential Medium</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">61100-061</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Penicillin/Streptomycin</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">15070-063</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">P3911</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Phosphate Monobasic</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">P9791</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Six-Well Plate</td>
			<td style="width:275px;">TPP</td>
			<td style="width:243px;">92006</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S3014</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Phosphate Dibasic</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S3264</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Trypsin-EDTA (0.25%)</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">25200-056</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Vitamins</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">M6895</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Name</td>
			<td style="width:275px;">Company</td>
			<td style="width:243px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">3. Equipment</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose Gel Electrophoresis System</td>
			<td style="width:275px;">Mupid</td>
			<td style="width:243px;">MPDEXU-01</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">CO2 Incubator</td>
			<td style="width:275px;">Thermo Scientific</td>
			<td style="width:243px;">Heracell 150i</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Desktop Centrifuge&#160;</td>
			<td style="width:275px;">Thermo Scientific</td>
			<td style="width:243px;">ST16R</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Electroporator</td>
			<td style="width:275px;">Harvard Apparatus</td>
			<td style="width:243px;">ECM 830</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Longwave Ultraviolet Lamps (Handheld)</td>
			<td style="width:275px;">UVP</td>
			<td style="width:243px;">UVGL-58</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Tabletop Centrifuge</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">368826</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Thermocycler</td>
			<td style="width:275px;">Life Technologies (Applied Biosystems)</td>
			<td style="width:243px;">GeneAmp PCR System 9700</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Vortexer</td>
			<td style="width:275px;">Scientific Industries</td>
			<td style="width:243px;">G-560</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Water Bath</td>
			<td style="width:275px;">Jeio Tech</td>
			<td style="width:243px;">WB-10E</td>
			<td></td>
		</tr>
	</tbody>
</table>

bacterial artificial chromosomes: a functional genomics tool for the study of positive-strand rna viruses

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose genomes have the same polarity as cellular mRNA. The cDNA-based reverse genetics system is a seminal method that enables direct manipulation of the viral genomic RNA, thereby generating recombinant viruses for molecular and genetic studies of both viral RNA elements and gene products in viral replication and pathogenesis. It also provides a valuable platform that allows the development of genetically defined vaccines and viral vectors for the delivery of foreign genes. For many positive-strand RNA viruses such as Japanese encephalitis virus (JEV), however, the cloned cDNAs are unstable, posing a major obstacle to the construction and propagation of the functional cDNA. Here, the present report describes the strategic considerations in creating and amplifying a genetically stable full-length infectious JEV cDNA as a bacterial artificial chromosome (BAC) using the following general experimental procedures: viral RNA isolation, cDNA synthesis, cDNA subcloning and modification, assembly of a full-length cDNA, cDNA linearization, in vitro RNA synthesis, and virus recovery. This protocol provides a general methodology applicable to cloning full-length cDNA for a range of positive-strand RNA viruses, particularly those with a genome of &gt;10 kb in length, into a BAC vector, from which infectious RNAs can be transcribed in vitro with a bacteriophage RNA polymerase.

Per tutti i virus RNA positivi filamento, l&#39;affidabilità e l&#39;efficienza di un sistema di genetica inversa dipendono dalla stabilità genetica di un full-length cDNA clonato, la cui sequenza è equivalente alla sequenza consensus di RNA genomico virale. 27 La Figura 1 mostra un cinque strategia passo per la costruzione di un cDNA infettiva intera lunghezza come per BAC ICE SA 14 -14-2 28: Fase 1, purificazione dell&#39;RNA virale dal supernatante di coltura cellulare di ICE-infettate cellule BHK-21 (Figura 1A); Fase 2, la sintesi di quattro ampliconi cDNA sovrapposti (da F1 a F4) che coprono l&#39;intero genoma virale (Figura 1B); Fase 3, subcloning di ciascuno dei quattro frammenti di cDNA contigui in un vettore BAC, creando PBAC / F1 a PBAC / F4 (Figura 1C); Fase 4, la modifica dei cDNA clonati per la trascrizione in vitro run-off con SP6 RNA polimerasi, cioè, mettendo un SP6sequenza promotrice immediatamente a monte del virale 5&#39;-end (PBAC / F1 SP6), eliminando un preesistente sito interno Xba I al nucleotide 9131 introducendo una mutazione puntiforme silenzioso, 9134 A → T (PBAC / F3 KO), ed inserendo un sito immediatamente a valle del virale 3&#39;-end (PBAC / F4 RO) (Figura 1D) nuovo Xba artificiale I run-off; e Step 5, il montaggio di un full-length SA 14 -14-2 cDNA BAC, PBAC / SA 14 -14-2 (Figura 1E). La tabella 1 elenca i oligonucleotidi utilizzati in questa procedura di clonazione. 28 Per la costruzione di un funzionale ICE cDNA, il primo passo importante è la sintesi dei quattro frammenti di cDNA sovrapposizioni con RNA virale purificato come modello per RT-PCR. La Figura 2 fornisce un risultato rappresentativo per i quattro prodotti RT-PCR che erano elettroforesi su 0,8%gel di agarosio. Questo gel dimostra chiaramente che un integrale ICE cDNA viene amplificato in quattro frammenti di cDNA sovrapposti. Occasionalmente, reazioni di RT-PCR potrebbero produrre uno o più prodotti specifici per il virus o aspecifiche che sono per lo più piccolo del prodotto atteso, a causa della ricottura non specifico di primer durante cDNA sintesi / amplificazione. D&#39;altra parte, poca o nessuna prevede prodotto RT-PCR sarebbe amplificato a causa della contaminazione RNasi accidentale durante l&#39;isolamento dell&#39;RNA virale o improprio prestazioni RT-PCR. Il successivo passaggio chiave è la clonazione e la modifica di un integrale parzialmente autonome o ICE cDNA in BAC, che è una procedura relativamente semplice che utilizza tecniche di DNA ricombinante standard. 69 Figura 3 presenta un risultato rappresentativo per la purificazione del clone BAC contenenti un full-length cDNA di ICE SA 14 -14-2 da bande in un gradiente di CsCl-EtBr.In questo esperimento, dopo centrifugazione per 16 ore a 401.700 xg, due bande distinte, vale a dire, la E. coli DNA cromosomico sopra e la BAC DNA plasmidico superavvolto seguito, sono visibili al centro del tubo sotto la luce ultravioletta a onda lunga. Un volume minimo (~ 400 microlitri) della fascia BAC DNA inferiore è stato accuratamente recuperato colpendo un foro con una siringa sul lato del tubo. Successivamente, l&#39;EtBr è stato estratto dal DNA BAC per estrazione butanolo, e il BAC DNA libero-EtBr stata concentrata mediante precipitazione in etanolo. Il passo finale è la determinazione della infettività specifica degli RNA trascritti in vitro di sintesi dal full-length SA 14 -14-2 BAC (PBAC / SA 14 -14-2) dopo RNA trasfezione in cellule permissive (Figura 4). Questa fase prevede tre fasi successive: Fase 1, linearizzazione del full-length SA 14 -14-2 cDNA al 3 &#39;-end del genoma virale (Figura 4A); Fase 2, la produzione di RNA di sintesi del cDNA linearizzata di run-off di trascrizione (Figura 4B); e Step 3, salvataggio dei virus ricombinanti in BHK-21 cellule transfettate con RNA sintetici (Figura 4C). Sperimentalmente, due cloni indipendenti di PBAC / SA 14 -14-2 stati linearizzati con Xba I digestione e trattati con MBN per rimuovere le quattro-base 5 sbalzo &#39;generato dalla digestione Xba I. I BAC linearizzate sono stati puliti da estrazione con fenolo-cloroformio, seguita da precipitazione in etanolo. La linearizzazione delle due BAC purificati è stata dimostrata su un gel di agarosio 0,8% (Figura 5A). L&#39;estrazione con fenolo-cloroformio deve essere fatto con attenzione per assicurare che le BAC linearizzate sono privi di RNasi. Ciascuno dei due BAC linearizzate servito come modello per la trascrizione cDNA scolo usando SP6 RNA polimerasi in presenza di m 7 G (5 &#39;) PPP (5&#39;) Un analogo cap. L&#39;integrità degli RNA sintetici stato dimostrato eseguendo aliquote delle due miscele di reazione trascrizione su un gel di agarosio 0,6%, con un kb scala di riferimento 1 DNA (Figura 5B). In questo semplice test, la principale fascia RNA prominente sempre migrato solo al di sotto dei 3 kb riferimento banda DNA e sembrava essere tagliente. Tuttavia, degradato RNA avrebbe un aspetto spalmato sullo stesso gel. Un test centro infettiva è il gold standard per la determinazione del infettività specifica dei RNA sintetici. Questo test è stato fatto da electroporating cellule BHK-21 con campioni di RNA, la semina uguali aliquote delle 10 volte le cellule elettroporate serialmente diluiti in 6 pozzetti contenenti naïve cellule BHK-21 (3 x 10 5 cellule / pozzetto), e la sovrapposizione agarosio sui monostrati cellulari. Dopo incubazione per 4 giorni, cellule sopravvissute sono state fissate con formaldeide e colorate con cristalvioletto soluzione di quantificare il numero di centri infettive (placche), che corrisponde al numero di molecole di RNA infettivi trasportati nelle cellule (Figura 6A). Poiché il cDNA utilizzato per la trascrizione in vitro è stato dimostrato di essere non-infettiva, 27 una aliquota della miscela di reazione di trascrizione è stata utilizzata direttamente per elettroporazione. Elettroporazione è il metodo preferito per l&#39;RNA trasfezione; In alternativa, RNA possono essere trasfettate con altri metodi usando liposomi DEAE-destrano e cationici. RNA elettroporazione è molto efficace, ma &quot;arco&quot; dell&#39;impulso elettrico si verifica raramente, se sono presenti nella reazione elettroporazione o se la cuvetta elettroporazione viene riutilizzato sali. L&#39;espressione di proteine ​​virali in cellule transfettate RNA è stato esaminato mediante saggi di immunofluorescenza usando un antisiero di coniglio anti-NS1 (Figura 6B). La produzione di particelle virali accumulati nei surnatanti di cellule transfettate RNA eraalyzed mediante saggi placca (Figura 6C). I risultati di questi esperimenti mostrano chiaramente che gli RNA sintetici cDNA derivati ​​sono infettive in permissivi cellule BHK-21, generando un alto titolo di virus ricombinanti. <table fo:keep-together.within-page="1"><tbody><tr><td> Oligonucleotide </td><td> Sequenza di un (5 &#39;a 3&#39;) </td><td> Posizione b </td><td> Polarità </td></tr><tr><td> 1RT </td><td> TAGGGATCTGGGCGTTTCTG GCAAAT </td><td> 2578-2603 </td><td> Antisenso </td></tr><tr><td> 1F </td><td> aatcccgggAGAAGTTTATC TGTGTGAACTT </td><td> 1-22 </td><td> Senso </td></tr><tr><td> 1R </td><td> attgcggccgcCCACGTCGT TGTGCACGAAGAT </td><td> 2532-2553 </td><td> Antisenso </td></tr><tr><td> 2RT </td><td> TTCTGCCTACTCTGCCCCTC CGTTGA </td><td> 5975-6000 </td><td> FormicaIo percepisco </td></tr><tr><td> 2F </td><td> aatcccgggTCAAGCTCAGT GATGTTAACAT </td><td> 1800-1821 </td><td> Senso </td></tr><tr><td> 2R </td><td> attgcggccgcGATGGGTTT CCGAGGATGACTC </td><td> 5929-5950 </td><td> Antisenso </td></tr><tr><td> 3RT </td><td> ACGGTCTTTCCTTCTGCTGC AGGTCT </td><td> 9426-9451 </td><td> Antisenso </td></tr><tr><td> 3F </td><td> aatcccgggGAGGATACATT GCTACCAAGGT </td><td> 5500-5521 </td><td> Senso </td></tr><tr><td> 3R </td><td> attgcggccgcGTAAGTCAG TTCAATTATGGCT </td><td> 9380-9401 </td><td> Antisenso </td></tr><tr><td> 4RT </td><td> AGATCCTGTGTTCTTCCTCA CCACCA </td><td> 10.952-10.977 </td><td> Antisenso </td></tr><tr><td> 4F </td><td> aatcccgggAGTGGAAGGCT CAGGCGTCCAA </td><td> 9200-9221 </td><td> Senso </td></tr><tr><td> 4R </td><td> attgcggccgcAGATCCTGT GTTCTTCCTCACC </td><td> 10.956-10.977 </td><td> Antisenso </td></tr><tr><td> SP6F </td><td> cataccccgcgtattcccac ta </td><td></td><td> Senso </td></tr><tr><td> SP6R </td><td> ACAGATAAACTTCTctatag tgtcccctaaa </td><td> 1-14 </td><td> Antisenso </td></tr><tr><td> F1F </td><td> aggggacactatagAGAAGT TTATCTGTGTG </td><td> 1-17 </td><td> Senso </td></tr><tr><td> F1R </td><td> TGGATCATTGCCCATGGTAA GCTTA </td><td> 638-662 </td><td> Antisenso </td></tr><tr><td> X1f </td><td> CGAATGGATCGCACAGTGTG GAGAG </td><td> 8403-8427 </td><td> Senso </td></tr><tr><td> X1R </td><td> AAAGCTTCAAACTCAAGATA CCGTGCTCC </td><td> 9120-9148 </td><td> Antisenso </td></tr><tr><td> X2F </td><td> GGAGCACGGTATCTTGAGTT TGAAGCTTT </td><td> 9120-9148 </td><td> Senso </td></tr><tr><td> X2R </td><td> cacgtggacgagggcatgcc tgcag </td><td></td><td> Antisenso </td></tr><tr><td> ROF </td><td> CCAGGAGGACTGGGTTACCA AAGCC </td><td> 10.670-10.694 </td><td> Senso </td></tr><tr><td> ROR </td><td> agggcggccgctctagAGAT CCTGTGTTCTTCCTCACCAC </td><td> 10.954-10.977 </td><td> Antisenso </td></tr><tr><td colspan="4"> una sequenza JEV sono riportati in lettere maiuscole, e le sequenze BAC sono indicati in lettere minuscole. posizione b Nucleotide si riferisce alla sequenza completa del genoma di ICE SA 14 -14-2 (numero di accesso Genbank JN604986). </td></tr></tbody></table> Tabella 1: oligonucleotidi utilizzati per la sintesi del DNA, amplificazione PCR, e BAC mutagenesi. <img alt="Figura 1" src="/files/ftp_upload/53164/53164fig1.jpg" /> Figura 1.0; strategia per la costruzione di un full-length cDNA di ICE SA 14 -14-2 come BAC (A) Isolamento di RNA virale da particelle ICE.. Viene mostrato un diagramma schematico del RNA genomico di ICE SA 14 -14-2. (B) Sintesi di quattro frammenti di cDNA sovrapposti (F1 a F4) che copre l&#39;intero genoma virale. (C) Subclonaggio di quattro frammenti di cDNA sovrapposti in un vettore BAC, creando PBAC / F1 a PBAC / F4. (D) Modifica dei cDNA clonati per la trascrizione ballottaggio in vitro. PBAC / F1 SP6 è un derivato di PBAC / F1 che contiene la sequenza del promotore SP6 monte del virale 5&#39;-end. PBAC / F3 KO è un derivato di PBAC / F3 che contiene una mutazione puntiforme silente (A 9134 → T, asterisco). PBAC / F4 RO è un derivato del PBAC / F4 che contiene un artificiale Xba I sito deflusso a valle del virale 3&#39;-end. (E </<html> strong&gt;) Assemblaggio di un full-length SA 14 -14-2 BAC (PBAC / SA 14 -14-2). <a href="https://www.jove.com/files/ftp_upload/53164/53164fig1large.jpg" target="_blank">Cliccate qui per vedere una versione più grande di questa figura.</a> <img alt="Figura 2" src="/files/ftp_upload/53164/53164fig2.jpg" /> Figura 2. Sintesi di quattro frammenti di cDNA sovrapposti (da F1 a F4) che attraversa il full-length RNA genomico di ICE SA 14 -14-2. I quattro prodotti RT-PCR vengono valutati mediante elettroforesi in gel di agarosio 0,8%. M, 1 kb scala del DNA. Le dimensioni attese dei quattro frammenti di cDNA sono indicati nella parte inferiore dell&#39;immagine gel. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig2large.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a> /ftp_upload/53164/53164fig3.jpg &quot;/&gt; Figura 3. Purificazione della BAC contenente un full-length cDNA di ICE SA 14 -14-2. Il plasmide BAC è isolato dal E. coli DH10B con il metodo di lisi SDS-alcalino e ulteriormente purificato mediante bande in un gradiente di CsCl-EtBr. Presentato è un esempio del gradiente CsCl-EtBr utilizzando un tubo di polipropilene sigillato 16 × 76 millimetri. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig3large.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a> <img alt="Figura 4" src="/files/ftp_upload/53164/53164fig4.jpg" /> Figura 4. Sommario del recupero di virus infettivi da un integrale ICE SA 14 -14-2 cDNA assemblato in un BAC. (A) linearizzazione del cDNA. Il full-length ICE BAC è tagliato conXba I e trattati con MBN. (B) Sintesi dei trascritti di RNA. Il cDNA linearizzato viene trascritto da RNA polimerasi SP6 in presenza di m 7 G (5 &#39;) ppp (5&#39;) Un analogo cap. (C) Recupero del sintetico JEVs. In vitro RNA trascritti sono trasfettati in cellule BHK-21 per l&#39;elettroporazione, che genera un alto titolo di virus sintetico. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig4large.jpg" target="_blank">Cliccate qui per vedere una versione più grande di questa figura.</a> <img alt="Figura 5" src="/files/ftp_upload/53164/53164fig5.jpg" /> Figura 5. Sintesi degli RNA mediante trascrizione in vitro utilizzando un full-length BAC ICE come modello cDNA. (A) Generazione del full-length linearizzato ICE BAC, PBAC / SA 14 -14-2. Due cloni indipendenti di PBAC/ SA 14 -14-2 (Cl.1 e Cl.2) linearizzate mediante digestione con Xba I e successivo trattamento con MBN. I BAC linearizzate sono esaminati mediante elettroforesi su gel di agarosio 0,8%. (B) La produzione di RNA sintetici per trascrizione run-off. Ciascuno dei due BAC linearizzate viene utilizzato come modello per SP6 RNA polimerasi di trascrizione run-off. Aliquote delle due reazioni di trascrizione vengono eseguiti su un gel di agarosio 0,6%. M, 1 kb scala del DNA. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig5large.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a> <img alt="Figura 6" src="/files/ftp_upload/53164/53164fig6.jpg" /> Figura 6. infettività specifica dei RNA sintetici trascritti da un BAC ICE full-length e il recupero del virus sintetico. BHK-21 cellule sono mock-elettroporate (Mock) o elettroporate con i trascritti di RNA derivati ​​from ciascuno dei due cloni indipendenti del full-length ICE BAC (Cl.1 e Cl.2). (A) RNA infettività. Le cellule sono sovrapposti con agarosio e colorate con cristallo viola a 4 giorni dopo la trasfezione. RNA infettività è determinata mediante saggi centro infettivi per stimare la quantità di RNA infettivi elettroporate nelle cellule (pannello di sinistra). Inoltre, le immagini rappresentative di centri infettive sono riportati (pannello di destra). (B) L&#39;espressione proteica. Le cellule sono coltivate in 4 pozzetti camera di diapositive. Espressione di proteine ​​virali in cellule elettroporate-RNA a 20 ore dopo la trasfezione (HPT) viene analizzata mediante saggi di immunofluorescenza usando un antisiero di coniglio anti-NS1 primaria e IgG anti-coniglio di capra secondario Cy3-coniugato (rosso). I nuclei sono contrastate con 4 &#39;, 6-diamidino-2-fenilindolo (blu). Le immagini di immunofluorescenza sono sovrapposte le immagini di contrasto interferenza corrispondente differenziali. (C) resa virus. Le cellule vengono coltivate in 150 piatti mm cultura. La produzione di virioni infettivi accumulati nei sovranatanti di coltura di cellule RNA-elettroporate a 22 e 40 HPT viene esaminato attraverso saggi placca. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig6large.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a>

Watch this Scientific Journal Video about Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses at JoVE.com

Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

Bacterial Artificial Chromosomes: uno strumento Genomica Funzionale per lo studio di positivo-strand virus RNA

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose ...

bacterial-artificial-chromosomes-functional-genomics-tool-for-study

Research

JoVE Journal

Immunology and Infection

21.2K Views.  Utah State University. Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

Video: Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the generation of extreme population diversity that facilitates virus adaptation and evolution. Increasing evidence shows that the intrinsic error rates, and the resulting mutation frequencies, of RNA viruses can be modulated by subtle amino acid changes to the viral polymerase. Although biochemical assays exist for some viral RNA polymerases that permit quantitative measure of incorporation fidelity, here we describe a simple method of measuring mutation frequencies of RNA viruses that has proven to be as accurate as biochemical approaches in identifying fidelity altering mutations. The approach uses conventional virological and sequencing techniques that can be performed in most biology laboratories. Based on our experience with a number of different viruses, we have identified the key steps that must be optimized to increase the likelihood of isolating fidelity variants and generating data of statistical significance. The isolation and characterization of fidelity altering mutations can provide new insights into polymerase structure and function1-3. Furthermore, these fidelity variants can be useful tools in characterizing mechanisms of virus adaptation and evolution4-7.

The present article describes the steps required to isolate and characterize RNA polymerase fidelity variants of RNA viruses and how to use mutation frequency data to confirm fidelity changes in tissue culture.

Isolamento di varianti di virus RNA Fidelity e caratterizzazione di frequenza Virus Mutation

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

Ricerca

Immunologia e infezioni

Separation of Single-stranded DNA, Double-stranded DNA and RNA from an Environmental Viral Community Using Hydroxyapatite Chromatography

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2. Viruses modulate host cell abundance and diversity, contribute to the cycling of nutrients, alter host cell phenotype, and influence the evolution of both host cell and viral communities through the lateral transfer of genes 3. Numerous studies have highlighted the staggering genetic diversity of viruses and their functional potential in a variety of natural environments. 
Metagenomic techniques have been used to study the taxonomic diversity and functional potential of complex viral assemblages whose members contain single-stranded DNA (ssDNA), double-stranded DNA (dsDNA) and RNA genotypes 4-9. Current library construction protocols used to study environmental DNA-containing or RNA-containing viruses require an initial nuclease treatment in order to remove nontargeted templates 10. However, a comprehensive understanding of the collective gene complement of the virus community and virus diversity requires knowledge of all members regardless of genome composition. Fractionation of purified nucleic acid subtypes provides an effective mechanism by which to study viral assemblages without sacrificing a subset of the community&#x2019;s genetic signature. 
Hydroxyapatite, a crystalline form of calcium phosphate, has been employed in the separation of nucleic acids, as well as proteins and microbes, since the 1960s11. By exploiting the charge interaction between the positively-charged Ca2+ ions of the hydroxyapatite and the negatively charged phosphate backbone of the nucleic acid subtypes, it is possible to preferentially elute each nucleic acid subtype independent of the others. We recently employed this strategy to independently fractionate the genomes of ssDNA, dsDNA and RNA-containing viruses in preparation of DNA sequencing 12. Here, we present a method for the fractionation and recovery of ssDNA, dsDNA and RNA viral nucleic acids from mixed viral assemblages using hydroxyapatite chromotography.

We describe an efficient method to separate single-stranded DNA, double-stranded DNA and RNA molecules from environmental viral communities. Nucleic acids are fractionated using hydroxyapatite chromatography with increasing concentrations of phosphate-containing buffers. This method permits the isolation of all viral nucleic acid types from environmental samples.

Separazione di DNA a singolo filamento, doppia elica del DNA e RNA da una Comunità Ambientale virale usando la cromatografia idrossiapatite

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2.  Viruses modulate host cell abundance and diversity, ...

Introducing Shear Stress in the Study of Bacterial Adhesion

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the initial and determining step of the pathogenesis. Although experimentally adhesion is mostly studied in static conditions adhesion actually takes place in the presence of flowing liquid. First encounters between bacteria and their host often occur at the mucosal level, mouth, lung, gut, eye, etc. where mucus flows along the surface of epithelial cells. Later in infection, pathogens occasionally access the blood circulation causing life-threatening illnesses such as septicemia, sepsis and meningitis. A defining feature of these infections is the ability of these pathogens to interact with endothelial cells in presence of circulating blood. The presence of flowing liquid, mucus or blood for instance, determines adhesion because it generates a mechanical force on the pathogen. To characterize the effect of flowing liquid one usually refers to the notion of shear stress, which is the tangential force exerted per unit area by a fluid moving near a stationary wall, expressed in dynes/cm2. Intensities of shear stress vary widely according to the different vessels type, size, organ, location etc. (0-100 dynes/cm2). Circulation in capillaries can reach very low shear stress values and even temporarily stop during periods ranging between a few seconds to several minutes 1. On the other end of the spectrum shear stress in arterioles can reach 100 dynes/cm2 2. The impact of shear stress on different biological processes has been clearly demonstrated as for instance during the interaction of leukocytes with the endothelium 3. To take into account this mechanical parameter in the process of bacterial adhesion we took advantage of an experimental procedure based on the use of a disposable flow chamber 4. Host cells are grown in the flow chamber and fluorescent bacteria are introduced in the flow controlled by a syringe pump. We initially focused our investigations on the bacterial pathogen Neisseria meningitidis, a Gram-negative bacterium responsible for septicemia and meningitis. The procedure described here allowed us to study the impact of shear stress on the ability of the bacteria to: adhere to cells 1, to proliferate on the cell surface 5and to detach to colonize new sites 6 (Figure 1). Complementary technical information can be found in reference 7. Shear stress values presented here were chosen based on our previous experience1 and to represent values found in the literature. The protocol should be applicable to a wide range of pathogens with specific adjustments depending on the objectives of the study.

During the infection process, a key step is the adhesion of pathogens with host cells. In most instances this adhesion step occurs in the presence of mechanical stress generated by flowing liquid. We describe a technique that introduces shear stress as an important parameter in the study of bacterial adhesion.

L&#39;introduzione di shear stress nello studio di adesione batterica

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the ...

Isolation and Genome Analysis of Single Virions using 'Single Virus Genomics'

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which are ubiquitous and the most numerous entities on our planet 4 and important in all environments 5, have yet to be revealed via similar approaches. Here we describe an approach for isolating and characterizing the genomes of single virions called 'Single Virus Genomics' (SVG). SVG utilizes flow cytometry to isolate individual viruses and whole genome amplification to obtain high molecular weight genomic DNA (gDNA) that can be used in subsequent sequencing reactions.

Isolation and Genome Analysis of Single Virions using &#039;Single Virus Genomics&#039;

Single Virus Genomics (SVG) is a method to isolate and amplify the genomes of single virons. Viral suspensions of a mixed assemblage are sorted using flow cytometry onto a microscope slide with discrete wells containing agarose, thereby capturing the virion and reducing genome shearing during downstream processing. Whole genome amplification is achieved using multiple displacement amplification (MDA) resulting in genomic material that is suitable for sequencing.

Isolamento e analisi del genoma di virioni singole utilizzando &quot;Genomica singolo virus &#39;

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

Creazione di un liquido coperto Cultura polarizzata Airway epiteliali umane Calu-3 celle per studio cellulare risposta dell&#39;ospite agli agenti patogeni delle vie respiratorie<em&gt; In vitro</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Following in Real Time the Impact of Pneumococcal Virulence Factors in an Acute Mouse Pneumonia Model Using Bioluminescent Bacteria

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. Despite advances in knowledge of this illness, the availability of intensive care units (ICU), and the use of potent antimicrobial agents and effective vaccines, the mortality rates remain high1. Streptococcus pneumoniae is the leading pathogen of community-acquired pneumonia (CAP) and one of the most common causes of bacteremia in humans. This pathogen is equipped with an armamentarium of surface-exposed adhesins and virulence factors contributing to pneumonia and invasive pneumococcal disease (IPD). The assessment of the in vivo role of bacterial fitness or virulence factors is of utmost importance to unravel S. pneumoniae pathogenicity mechanisms. Murine models of pneumonia, bacteremia, and meningitis are being used to determine the impact of pneumococcal factors at different stages of the infection. Here we describe a protocol to monitor in real-time pneumococcal dissemination in mice after intranasal or intraperitoneal infections with bioluminescent bacteria. The results show the multiplication and dissemination of pneumococci in the lower respiratory tract and blood, which can be visualized and evaluated using an imaging system and the accompanying analysis software.

Streptococcus pneumoniae is the leading pathogen causing severe community-acquired pneumonia and responsible for over 2&#160;million deaths worldwide. The impact of bacterial factors implicated in fitness or virulence can be monitored in real-time in an acute mouse pneumonia or bacteremia model using bioluminescent bacteria.

A seguito in tempo reale l&#39;impatto dei fattori di virulenza pneumococco in un acuto mouse Polmonite modello tramite batteri bioluminescenti

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat because of increased worldwide exchanges and human populations penetrating more and more natural ecosystems. A good example of such an emerging situation is chikungunya virus epidemics of 2005-2006 in the Indian Ocean. Recent progresses in our understanding of cellular pathways controlling viral replication suggest that compounds targeting host cell functions, rather than the virus itself, could inhibit a large panel of RNA viruses. Some broad-spectrum antiviral compounds have been identified with host target-oriented assays. However, measuring the inhibition of viral replication in cell cultures using reduction of cytopathic effects as a readout still represents a paramount screening strategy. Such functional screens have been greatly improved by the development of recombinant viruses expressing reporter enzymes capable of bioluminescence such as luciferase. In the present report, we detail a high-throughput screening pipeline, which combines recombinant measles and chikungunya viruses with cellular viability assays, to identify compounds with a broad-spectrum antiviral profile.

In vitro assays to measure virus replication have been greatly improved by the development of recombinant RNA viruses expressing luciferase or other enzymes capable of bioluminescence. Here we detail a high-throughput screening pipeline that combines such recombinant strains of measles and chikungunya viruses to isolate broad-spectrum antivirals from chemical libraries.

High-throughput screening per largo spettro chimico inibitori di RNA virus

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

Detecting Glycogen in Peripheral Blood Mononuclear Cells with Periodic Acid Schiff Staining

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. Polysaccharides such as glycogen, glycoproteins, and glycolipids stain bright magenta making it easy to enumerate positive and negative cells within the tissue. In muscle cells PAS staining is used to determine the glycogen content in different types of muscle cells, while in blood cell samples PAS staining has been explored as a diagnostic tool for a variety of conditions. Blood contains a proportion of white blood cells that belong to the immune system. The notion that cells of the immune system possess glycogen and use it as an energy source has not been widely explored. Here, we describe an adapted version of the PAS staining protocol that can be applied on peripheral blood mononuclear immune cells from human venous blood. Small cells with PAS-positive granules and larger cells with diffuse PAS staining were observed. Treatment of samples with amylase abrogates these patterns confirming the specificity of the stain. An alternate technique based on enzymatic digestion confirmed the presence and amount of glycogen in the samples. This protocol is useful for hematologists or immunologists studying polysaccharide content in blood-derived lymphocytes.

Periodic acid Schiff staining is a technique that visualizes the polysaccharide content of tissues. This article demonstrates periodic acid Schiff staining protocol adapted for use on peripheral blood mononuclear cells purified from human venous blood. Such samples are enriched for lymphocytes and other white blood cells of the immune system.

Rilevamento glicogeno in cellule periferiche mononucleate del sangue con Periodic Acid Schiff colorazione

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. ...

Electroporation of Functional Bacterial Effectors into Mammalian Cells

The study of protein interactions in the context of living cells can generate critical information about localization, dynamics, and interacting partners. This information is particularly valuable in the context of host-pathogen interactions. Many pathogen proteins function within host cells in a variety of way such as, enabling evasion of the host immune system and survival within the intracellular environment. To study these pathogen-protein host-cell interactions, several approaches are commonly used, including: in vivo infection with a strain expressing a tagged or mutant protein, or introduction of pathogen genes via transfection or transduction. Each of these approaches has advantages and disadvantages. We sought a means to directly introduce exogenous proteins into cells. Electroporation is commonly used to introduce nucleic acids into cells, but has been more rarely applied to proteins although the biophysical basis is exactly the same. A standard electroporator was used to introduce affinity-tagged bacterial effectors into mammalian cells. Human epithelial and mouse macrophage cells were cultured by traditional methods, detached, and placed in 0.4 cm gap electroporation cuvettes with an exogenous bacterial pathogen protein of interest (e.g. Salmonella Typhimurium GtgE). After electroporation (0.3 kV) and a short (4 hr) recovery period, intracellular protein was verified by fluorescently labeling the protein via its affinity tag and examining spatial and temporal distribution by confocal microscopy. The electroporated protein was also shown to be functional inside the cell and capable of correct subcellular trafficking and protein-protein interaction. While the exogenous proteins tended to accumulate on the surface of the cells, the electroporated samples had large increases in intracellular effector concentration relative to incubation alone. The protocol is simple and fast enough to be done in a parallel fashion, allowing for high-throughput characterization of pathogen proteins in host cells including subcellular targeting and function of virulence proteins.

Electroporation was used to insert purified bacterial virulence effector proteins directly into living eukaryotic cells. Protein localization was monitored by confocal immunofluorescence microscopy. This method allows for studies on trafficking, function, and protein-protein interactions using active exogenous proteins, avoiding the need for heterologous expression in eukaryotic cells.

Elettroporazione di effettori batterici funzionali in cellule di mammifero

The study of protein interactions in the context of living cells can generate critical information about localization, dynamics, and interacting partners. ...

Intranasal Administration of Recombinant Influenza Vaccines in Chimeric Mouse Models to Study Mucosal Immunity

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the physiological mechanisms that mediate immune responses to vaccines perhaps due to the overall success of vaccination, which has reduced interest into the molecular and physiological mechanisms of vaccine immunity. However, several important human pathogens including influenza virus still pose a challenge for vaccination, and may benefit from immune-based strategies. 
Although influenza reverse genetics has been successfully applied to the generation of live-attenuated influenza vaccines (LAIVs), the addition of molecular tools in vaccine preparations such as tracer components to follow up the kinetics of vaccination in vivo, has not been addressed. In addition, the recent generation of mouse models that allow specific depletion of leukocytes during kinetic studies has opened a window of opportunity to understand the basic immune mechanisms underlying vaccine-elicited protection. Here, we describe how the combination of reverse genetics and chimeric mouse models may help to provide new insights into how vaccines work at physiological and molecular levels, using as example a recombinant, cold-adapted, live-attenuated influenza vaccine (LAIV). We utilized laboratory-generated LAIVs harboring cell tracers as well as competitive bone marrow chimeras (BMCs) to determine the early kinetics of vaccine immunity and the main physiological mechanisms responsible for the initiation of vaccine-specific adaptive immunity. In addition, we show how this technique may facilitate gene function studies in single animals during immune responses to vaccines. We propose that this technique can be applied to improve current prophylactic strategies against pathogens for which urgent medical countermeasures are needed, for example influenza, HIV, Plasmodium, and hemorrhagic fever viruses such as Ebola virus.

There is an overall lack of knowledge about how vaccines work. Here we propose the combined use of reverse genetics and bone marrow chimeric mice to gain insight into the early host immune responses to vaccines with a special focus on dendritic cells and T cell immunity.

Intranasale somministrazione di ricombinante Influenza vaccini nei modelli chimerico topo per studiare immunità delle mucose

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the ...