The authors would like to acknowledge the Utah Science Technology and Research fund for support of YML and the Korea National Research Foundation grants (2009-0069679 and 2010-0010154) for support of SIY. This research was supported by the Utah Agricultural Experiment Station, Utah State University, and approved as journal paper number UAES #8753. Also, the authors thank Dr. Deborah McClellan for editorial assistance.

The authors have declared that they have no competing financial interests.

O protocolo corrente foi utilizado com sucesso para gerar full-length clones de ADNc infecciosos de duas estirpes diferentes (CNU / LP2 27 e 14 SA -14-2 28) do JEV, um flavivírus cujo ADNc funcional demonstrou ser inerentemente difícil de construir e propagar por causa da toxicidade da célula hospedeira e a instabilidade genética do ADNc clonado 8,74-76 Este protocolo envolve três componentes principais:. em primeiro lugar, maximizando a síntese / amplificação de uma cópia fiel ADNc do ARN viral de alta fidelidade utilizando transcriptase reversa / ADN-polimerase; Em segundo lugar, a clonagem da região prM-E viral contendo sequências de codificação tóxicos (dados não publicados) 74,77,78 em um nível muito baixo número de cópias do vector BAC de cDNA inicial de subclonagem para os passos de comprimento completo de ADNc de montagem final; e em terceiro lugar, utilizando um vector de clonagem BAC que pode acomodar um ADN estranho com uma dimensão média de 120-350 kb, que, aparentemente, 19-21 tolera maiores ADN InSerts do que os outros vectores de clonagem. Esta abordagem de clonagem será geralmente aplicável a muitos outros vírus de ARN de cadeia positiva, particularmente aqueles com um grande genoma de ARN de ~ 10 a 32 kb. Geração de um ADNc de clone infeccioso é um passo chave no desenvolvimento de um sistema de genética inversa de vírus de ARN, especialmente para vírus de ARN de cadeia positiva, porque o seu genoma actua como ARNm viral que é traduzido em proteínas por ribossomas da célula hospedeira. Assim, a replicação virai pode ser iniciada pela introdução de um genoma de comprimento molécula de ARN derivado de ADNc numa célula hospedeiro susceptível. A disponibilidade de um clone infeccioso de cDNA JEV, quando combinado com a tecnologia de ADN recombinante, tem aumentado a compreensão dos vários aspectos do ciclo de vida virai, a nível molecular, tais como a expressão de genes e replicação do genoma 73,79. 63,64 Além disso, uma de comprimento completo JEV clone de ADNc tem provado ser uma ferramenta valiosa para o desenvolvimento de vacinas antivirais 28 e vectores de entrega de genes. &lt;sup&gt; 80,81 Tal como acontece com todos os vírus de ARN de cadeia positiva, existem vários passos críticos na construção de um ADNc funcional de confiança para o JEV a partir do qual os ARN altamente infecciosas podem ser sintetizados in vitro. Idealmente, a sequência dos ARN transcritos sintéticos a partir de um clone do ADNc de comprimento completo deve ser idêntico ao do ARN genómico viral, particularmente os 5&#39;- e 3&#39;-terminal de sequências que são necessárias para a iniciação da replicação de ARN viral . 60-62 No protocolo actual, o autêntico 5&#39;- e 3&#39;- extremidades foram assegurada colocando a sequência de promotor SP6 a montante do primeiro nucleótido adenina do genoma viral e o posicionamento de um local de restrição único artificial Xbal a jusante do último timina nucleótidos do genoma virai, respectivamente. Tampado RNAs sintéticos com o autêntico 5 &#39;e 3&#39; foram produzidos por transcrição de um Xba I-linearizado e tratou-MBN cDNA te run-offmplate utilizando polimerase SP6 ARN preparado com o m 7 G (5 &#39;) ppp (5&#39;) Um análogo de tampão. Este protocolo pode ser modificado de várias maneiras. Para transcrição in vitro, uma outra polimerase de ARN do bacteriófago (por exemplo, T3 ou T7) pode ser utilizado em conjunto com a sua sequência promotora bem definida. 27 Como um local de escoamento, um local de restrição diferente pode ser utilizada se não está presente em do genoma viral e de ARN sintética se a partir do ADNc linearizado termina com o autêntico extremidade 3 &#39;. A importância da sequência de nucleótidos da extremidade 3 &#39;foi demonstrado por uma diminuição ~ 10 vezes na infectividade de ARN, quando uma ARN sintético contém três ou quatro nucleótidos de vírus não relacionados, na sua extremidade 3&#39;. 27 Em uma reacção de transcrição in vitro, tanto o m 7 G (5 &#39;) ppp (5&#39;) A e m 7 G (5 &#39;) ppp (5&#39;) G tampa analógico podem ser utilizados igualmente bem, embora o último lugares um não relacionado nucleótido G adicional a montante do viral 5 &#39;-end, mas issodisso não altera a capacidade de infecção ou replicação de RNA sintético. 27 Além disso, a remoção do molde de ADNc a partir dos transcritos de ARN por digestão com DNase I não é necessário para testes de ARN de infecciosidade, porque o modelo de cDNA em si não é infecciosa. 27 A tecnologia BAC foi agora aplicada à construção de clones de cDNA infecciosos para um punhado de vírus ARN de cadeia positiva, ou seja, dois JEVs, CNU / LP2 27 e SA 14 -14-2 28 (tamanho do genoma, ~ 11 kb); dois vírus da dengue, BR / 90 26 e NGC 29 (~ 11 kb); o vírus da diarréia viral bovina, SD1 (~ 12 kb); 25 dois vírus da peste suína clássica, C e Paderborn (~ 12 kb); 24 o vírus da doença da fronteira, Gifhorn (~ 12 kb); 24 o vírus suíno síndrome reprodutiva e respiratória , PL97-1 / LP1 (~ 15 kb); 30 o vírus da gastroenterite transmissível, PUR46-MAD (~ 29 kb); 16 o felino vírus da peritonite infecciosa,DF-2 (~ 29 kb); 32 a grave coronavírus Síndrome Respiratória Aguda, Urbani (~ 30 kb); 9 do Oriente Médio respiratória síndrome coronavírus, a EMC / 2012 (~ 30 kb); 17 eo coronavírus humano, OC43 (~ 31 kb) 31 A principal vantagem da utilização de BACs para a construção de cDNA é a elevada estabilidade genética das grandes, 1- ou 2-cópia BAC plasmídeos.; No entanto, a natureza intrínseca da sua número extremamente baixo número de cópias é também uma grande desvantagem, devido a rendimentos muito baixos de DNA de BAC e a consequente redução na pureza do DNA de BAC com respeito à sede de ADN cromossómico. No protocolo atual, o rendimento de DNA BAC é maximizada pela crescente E. coli DH10B transformada com o pBAC BAC infecciosa / SA 14 -14-2 em um meio rico em nutrientes, 2xYT. Apesar deste esforço, o rendimento médio é de apenas ~ 15 ug de DNA BAC a partir de 500 ml de caldo de 2xYT. Além disso, a pureza do DNA de BAC é melhor conseguido através da utilização de CsCl-EtBr centrifugação de gradiente de densidade para a purificação, Em vez do plasmídeo de isolamento à base de coluna utilizada. No entanto, é importante ter em mente que a E. transformado BAC- coli não deve crescer demais porque pode pôr em perigo a estabilidade genética do cDNA clonado, e um crescimento mais elevado não conduz necessariamente a maiores rendimentos ou DNA BAC maior pureza. O protocolo descrito aqui é um, e método aerodinâmico eficiente otimizada para a construção e propagação de um full-length cDNA infeccioso clone geneticamente estável como um BAC para JEV, um procedimento que se pensava praticamente impossível. Esta mesma estratégia de clonagem pode também ser aplicado a muitos outros vírus de ARN de cadeia positiva. Em geral, os clones de ADNc infecciosos permitir-nos introduzir uma variedade de mutações (por exemplo, deleções, inserções e mutações pontuais) num genoma de ARN viral para estudar as suas funções biológicas na replicação virai e patogénese. Este sistema de genética inversa à base de ADNc faz com que seja possível desenvolver e TESt vacina e candidatos terapêuticos que visam um factor de virulência (s) de um vírus de ARN de cadeia positiva de interesse particular. Além disso, esta tecnologia de cDNA infeccioso pode também ser utilizado como um vector virai, capaz de expressar um gene estranho (s) de interesse para muitas aplicações na investigação biomédica.

Para virologistas de ARN, o advento da tecnologia de DNA recombinante no final de 1970, foi possível converter os genomas virais de ARN em clones de ADNc, que pode então ser propagada como plasmídeos em bactérias para a manipulação genética de vírus de ARN. 1 O primeiro vírus de ARN ser molecularmente clonado foi Qp bacteriófago, um vírus de ARN de cadeia positiva que infecta Escherichia coli. Um plasmídeo contendo uma cópia de ADNc completa do ARN genómico Qp deu origem a Qp fagos infecciosos quando introduzido em E. coli. 2 Pouco tempo depois, esta técnica foi aplicada para poliovírus, um vírus de ARN de cadeia positiva de seres humanos e animais. Um plasmídeo que possui um ADNc de comprimento completo do ARN genómico poliovírus foi infecciosas quando transfectadas em células de mamífero e é capaz de produzir viriões infecciosos 3 Nesta abordagem &quot;lançou-ADN&quot;, os ADNc clonados deve ser transcrita intracelularmente para iniciar a replicação do ARN virai.;no entanto, não está claro como a transcrição é iniciada e como as transcrições são transformados com a sequência correcta viral. Esta preocupação tem levado ao desenvolvimento de uma alternativa &quot;lançou-ARN&quot; abordagem, em que uma cópia de cDNA do genoma completo de RNA viral é clonado sob um promotor reconhecido por uma E. coli ou ARN polimerase do fago para a produção de ARN sintéticos in vitro com definido 5 &#39;e 3&#39;, que se submetem a um ciclo completo de replicação virai quando introduzidos em células hospedeiras. 4,5 O primeiro sucesso com esta abordagem foi relatado para brome vírus do mosaico , 6,7 um vírus de ARN de cadeia positiva de plantas. Desde então, a abordagem lançada ARN foi desenvolvido para uma grande variedade de vírus de ARN de cadeia positiva, incluindo calicivírus, alfavírus, flavivírus, coronavírus, e arterivï¿½us. 1,4,5,8 Em ambos o ADN e ARN-lançado sistemas de genética inversa, a construção de um full-clone de ADNc de comprimento é a chave para a geração de ADN ou ARN infecciosos de vus de ARN de cadeia positiva, mas torna-se um considerável desafio técnico, conforme o tamanho do genoma viral aumenta. 9-17 Em particular, um grande genoma de ARN de ~ 10 -32 kb apresenta três principais obstáculos para a clonagem de um ADNc de comprimento completo funcional. 18 A primeira dificuldade é a síntese de um cDNA cópia fiel, uma vez que a fidelidade da RT-PCR é inversamente proporcional ao comprimento do RNA viral. O segundo obstáculo é a presença de sequências potencialmente tóxicos, uma vez que as moléculas de RNA longas são mais prováveis ​​de conter sequências inesperadas capazes de fazer o fragmento de cDNA em plasmídeos instáveis ​​em E. coli. O terceiro e mais importante causa é a disponibilidade de um vector adequado, uma vez que é difícil encontrar um vector de clonagem que pode alojar um inserto de cDNA viral de&gt; 10 kb. Ao longo das últimas três décadas, essas barreiras foram superadas por vários avanços na enzimologia, metodologia, umad vectorology. 1,4,5,8 Destes, o desenvolvimento mais promissor e inovador é a clonagem de grandes vírus de ARN de cadeia positiva cromossomas artificiais bacterianos (BACs como infecciosas). O vector BAC é um plasmídeo de baixo número de cópias de clonagem (1-2 cópias / célula), com base na E. coli factor de fertilidade, com um tamanho médio de inserção de ADN de 19-21 kb ~ 120-350 Um fragmento de DNA é inserida no vector BAC de uma forma semelhante à clonagem em vectores de clonagem gerais.; os clones BAC resultantes são estáveis ​​ao longo de muitas gerações, em E. coli. 22,23 Até à data, a tecnologia BAC foi usado para criar clones de ADNc infecciosos para&gt; 10 membros de três famílias de vírus ARN de cadeia positiva, isto é, Flaviviridae, 24-29 Arteriviridae, 30 e Coronaviridae. 9,16,17 , 31,32 Usando vírus da encefalite japonesa (JEV) como um exemplo, o presente trabalho relata os procedimentos detalhados que podem serutilizado para construir um de comprimento completo de BAC infeccioso geneticamente estável para uma variedade de vírus de ARN de cadeia positiva. JEV é um flavivírus zoonótica 33 que é transmitida em natureza entre aves, porcos e outros hospedeiros vertebrados por vectores de mosquito. 34,35 Nos seres humanos, a infecção pode causar o JEV grave doença neurológica encefalite japonesa frequentemente fatal (JE), 36 que ocorre na Ásia e partes do Pacífico Ocidental, 37,38 com uma incidência anual estimada de ~ 50,000-175,000 casos clínicos. 39,40 O genoma do JEV é uma ~ 11 kb,, molécula de RNA de cadeia simples de sentido positivo e consiste em uma única estrutura de leitura aberta (ORF) flanqueada por duas regiões não codificantes (NCRs) nas extremidades 5 &#39;e 3&#39;. A ORF codifica 41,42 uma poliproteína que é clivada por proteases do hospedeiro e virais para produzir as proteínas individuais 10, designado C, prM, E, NS1, NS2a, NS2B, NS3, NS4A, NS4B e NS5 na direcção N- para C-terminal. 34,43,44 Além disso, uma mensagemXtended forma de NS1 (NS1 &quot;) é expresso por -1 frameshifting ribossomal nos codões 8-9 da NS2a. 45,46 Destes 11 proteínas, as três proteínas estruturais (C, prM e E) são essenciais para a formação de infeccioso viriões, 47,48 e os restantes oito proteínas não estruturais (NS1 a NS5, e NS1 &quot;), são essenciais para a replicação viral de ARN, a montagem de partícula 49-51, 52-56 e 57-59 a imunidade inata evasão. Tanto a 5 &#39;e 3 &#39;NCRs contêm sequências conservadas estruturas primárias e secundárias de ARN forma terciária / 60-62, que são importantes para modular a replicação do ARN virai 63,64. Este protocolo descreve as ferramentas, métodos e estratégias para a geração de um de comprimento completo de BAC infeccioso do JEV SA 14 -14-2. 28 Este clone de BAC funcional contém uma cópia de cDNA completa do ARN genómico JEV, 65, que é abarcado por um promotor para a polimerase de ARN de SP6 a montantedo vírus da extremidade 5 &#39;e um local de restrição Xbal único a jusante da extremidade 3&#39; viral para a transcrição in vitro run-off. Esta tecnologia BAC é aplicável à construção de um clone molecular de cDNA totalmente funcional para uma variedade de vírus de ARN de cadeia positiva.

<table border="0" cellpadding="0" cellspacing="0" width="1054">
	<tbody>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">1. Molecular Cloning</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td style="width:235px;"></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">2xYT Broth</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">Y2377</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">[3H]UTP</td>
			<td style="width:275px;">PerkinElmer</td>
			<td style="width:243px;">NET380250UC</td>
			<td>Radioactive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">50-mL Tube</td>
			<td style="width:275px;">Thermo Scientific (Nalgene)</td>
			<td style="width:243px;">3114-0050</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">250-mL Bottle</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">356011</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose</td>
			<td style="width:275px;">Lonza</td>
			<td style="width:243px;">50004</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose (Low Melting Point)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">16520-100</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">AvaI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0152S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">AvrII</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0174S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BamHI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0136S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BsiWI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0553S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BsrGI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0575S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Butanol</td>
			<td style="width:275px;">Fisher Scientific</td>
			<td style="width:243px;">A399-1&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cap Analog [m7G(5&#697;)ppp(5&#697;)A]</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">S1405S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cesium Chloride</td>
			<td style="width:275px;">Fisher Scientific</td>
			<td style="width:243px;">BP1595-1</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Chloramphenicol</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C0378</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Chloroform</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C2432</td>
			<td>Carcinogenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">DE-81 Filter Paper</td>
			<td style="width:275px;">GE Healthcare Life Sciences</td>
			<td style="width:243px;">3658-023</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">dNTP mix</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18427-088</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">E. coli DH10B&#160;</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18297-010</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">EDTA</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E5134</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Ethanol&#160;</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E7023</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Ethidium Bromide</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E7637</td>
			<td>Toxic and highly mutagenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Filter Column (Plasmid Maxiprep Kit)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">K2100-26</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glacial Acetic Acid</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">A6283</td>
			<td>Irritating</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glucose</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">G5400</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glycogen&#160;</td>
			<td style="width:275px;">Roche</td>
			<td style="width:243px;">10901393001</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">High-Fidelity DNA Polymerase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0491S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Isoamyl Alcohol</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">I9392</td>
			<td>Flammable</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Isopropanol&#160;</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0918</td>
			<td>Flammable</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">LB Broth</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">12795-027</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Lithium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">L9650</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Lysozyme</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0663</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Magnesium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">M8266</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">M-MLV Reverse Transcriptase</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18080-044</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Mung Bean Nuclease</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0250S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Needle (18G, 20G)</td>
			<td style="width:275px;">BD</td>
			<td style="width:243px;">305196, 305175</td>
			<td>Biohazardous (Sharps waste)</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">NotI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0189S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Oligonucleotide</td>
			<td style="width:275px;">Integrated DNA Technologies</td>
			<td style="width:243px;">Custom Oligonucleotide Synthesis</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">PacI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0547S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">pBeloBAC11</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">ER2420S (E4154S)</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol (Buffer-Saturated)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15513-039</td>
			<td>Toxic and highly corrosive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol:Chloroform:Isoamyl Alcohol</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15593-031</td>
			<td>Toxic and highly corrosive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol:Guanidine Isothiocyanate</td>
			<td style="width:275px;">Life Technologies (Ambion)</td>
			<td style="width:243px;">10296-010</td>
			<td>Toxic, corrosive, and irritating</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Pme I</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0560S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Acetate</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0698</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">RNase Inhibitor</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">10777-019</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">rNTP Set</td>
			<td style="width:275px;">GE Healthcare Life Sciences</td>
			<td style="width:243px;">27-2025-01</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sealable Polypropylene Tube (16 &#215; 76 mm)&#160;</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">342413</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">SfiI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0123S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sma I</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0141S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Acetate</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S2889</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Dodecyl Sulfate</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0227</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Hydroxide</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S5881</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">SP6 RNA Polymerase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0207S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Spin Column (Plasmid Miniprep Kit)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">K2100-11</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Syringe</td>
			<td style="width:275px;">HSW NORM-JECT</td>
			<td style="width:243px;">4200.000V0</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">T4 DNA Ligase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0202S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Tris</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0826</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">tRNA (yeast)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15401-011</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">XbaI&#160;</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0145S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Name</td>
			<td style="width:275px;">Company</td>
			<td style="width:243px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">2. Cell Culture</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Alpha Minimal Essential Medium</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">12561-049</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Conical Tube (50 mL)</td>
			<td style="width:275px;">VWR</td>
			<td style="width:243px;">21008-242</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Crystal Violet&#160;</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C0775</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Culture Dish (150 mm)&#160;</td>
			<td style="width:275px;">TPP</td>
			<td style="width:243px;">93150&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cuvette (2-mm Gap)</td>
			<td style="width:275px;">Harvard Apparatus</td>
			<td style="width:243px;">450125&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Fetal Bovine Serum&#160;</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">16000-044</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Formaldehyde</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">F1635</td>
			<td>Toxic and carcinogenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glutamine</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">25030-081</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Minimal Essential Medium</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">61100-061</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Penicillin/Streptomycin</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">15070-063</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">P3911</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Phosphate Monobasic</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">P9791</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Six-Well Plate</td>
			<td style="width:275px;">TPP</td>
			<td style="width:243px;">92006</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S3014</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Phosphate Dibasic</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S3264</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Trypsin-EDTA (0.25%)</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">25200-056</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Vitamins</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">M6895</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Name</td>
			<td style="width:275px;">Company</td>
			<td style="width:243px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">3. Equipment</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose Gel Electrophoresis System</td>
			<td style="width:275px;">Mupid</td>
			<td style="width:243px;">MPDEXU-01</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">CO2 Incubator</td>
			<td style="width:275px;">Thermo Scientific</td>
			<td style="width:243px;">Heracell 150i</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Desktop Centrifuge&#160;</td>
			<td style="width:275px;">Thermo Scientific</td>
			<td style="width:243px;">ST16R</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Electroporator</td>
			<td style="width:275px;">Harvard Apparatus</td>
			<td style="width:243px;">ECM 830</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Longwave Ultraviolet Lamps (Handheld)</td>
			<td style="width:275px;">UVP</td>
			<td style="width:243px;">UVGL-58</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Tabletop Centrifuge</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">368826</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Thermocycler</td>
			<td style="width:275px;">Life Technologies (Applied Biosystems)</td>
			<td style="width:243px;">GeneAmp PCR System 9700</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Vortexer</td>
			<td style="width:275px;">Scientific Industries</td>
			<td style="width:243px;">G-560</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Water Bath</td>
			<td style="width:275px;">Jeio Tech</td>
			<td style="width:243px;">WB-10E</td>
			<td></td>
		</tr>
	</tbody>
</table>

bacterial artificial chromosomes: a functional genomics tool for the study of positive-strand rna viruses

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose genomes have the same polarity as cellular mRNA. The cDNA-based reverse genetics system is a seminal method that enables direct manipulation of the viral genomic RNA, thereby generating recombinant viruses for molecular and genetic studies of both viral RNA elements and gene products in viral replication and pathogenesis. It also provides a valuable platform that allows the development of genetically defined vaccines and viral vectors for the delivery of foreign genes. For many positive-strand RNA viruses such as Japanese encephalitis virus (JEV), however, the cloned cDNAs are unstable, posing a major obstacle to the construction and propagation of the functional cDNA. Here, the present report describes the strategic considerations in creating and amplifying a genetically stable full-length infectious JEV cDNA as a bacterial artificial chromosome (BAC) using the following general experimental procedures: viral RNA isolation, cDNA synthesis, cDNA subcloning and modification, assembly of a full-length cDNA, cDNA linearization, in vitro RNA synthesis, and virus recovery. This protocol provides a general methodology applicable to cloning full-length cDNA for a range of positive-strand RNA viruses, particularly those with a genome of &gt;10 kb in length, into a BAC vector, from which infectious RNAs can be transcribed in vitro with a bacteriophage RNA polymerase.

Para todos os vírus de ARN de cadeia positiva, a fiabilidade e eficiência de um sistema de genética inversa dependerá da estabilidade genética de um ADNc de comprimento completo clonado, cuja sequência é equivalente à sequência de consenso do ARN genómico virai. 27 A Figura 1 mostra uma de cinco passo estratégia para a construção de um cDNA infeccioso de comprimento completo como um BAC para o JEV SA -14-2 14 28: Passo 1, a purificação do RNA virai a partir do sobrenadante de cultura de células de JEV-infectadas células BHK-21 (Figura 1A); Passo 2, a síntese de quatro fragmentos amplificados de ADNc que se sobrepõem (F1 a F4) abrangendo todo o genoma viral (Figura 1B); Passo 3, subclonagem de cada um dos quatro fragmentos de ADNc contíguos num vector BAC, criando pBAC / F1 para pBAC / F4 (Figura 1C); Passo 4, a modificação de ADNc clonados para transcrição in vitro run-off com a ARN-polimerase SP6, isto é, colocando um SP6sequência de promotor imediatamente a montante da extremidade 5 &#39;virais (pBAC / F1 SP6), eliminação de uma pré-existente sítio interno Xba I no nucleótido 9131 através da introdução de uma mutação pontual silenciosa, 9134 Um → T (pBAC / F3 KO), e inserindo um local de run-off novo artificial Xbal imediatamente a jusante da extremidade 3 &#39;viral (pBAC / F4 RO) (Figura 1D); 28 e Passo 5, um conjunto de comprimento completo SA-14 -14-2 ADNc BAC, pBAC / SA 14 -14-2 (Figura 1E). A Tabela 1 lista os oligonucleótidos utilizados neste procedimento de clonagem. Para a construção de um JEV ADNc funcional, o primeiro passo importante é a síntese de quatro fragmentos de ADNc sobrepostos usando o RNA viral purificado como um molde para a RT-PCR. A Figura 2 proporciona um resultado representativo para os quatro produtos de RT-PCR que eram a electroforese em 0,8%em gel de agarose. Este gel demonstra claramente que um de comprimento completo JEV ADNc é amplificado em quatro fragmentos de ADNc que se sobrepõem. Ocasionalmente, as reacções de RT-PCR pode produzir um ou mais produtos adicionais específicos do vírus ou não específicos que são principalmente menor do que o produto esperado, porque o recozimento de inespecífica de iniciadores durante a síntese de cDNA / amplificação. Por outro lado, pouco ou nenhum produto esperado de RT-PCR será amplificado por causa da contaminação com RNase acidental durante o isolamento de ARN viral ou desempenho inadequado do RT-PCR. O próximo passo chave é a clonagem e modificação de um comprimento total de ADNc parcial ou JEV em BAC, que é um procedimento relativamente simples que utiliza técnicas de ADN recombinante convencionais. 69 A Figura 3 apresenta um resultado representativo para a purificação do clone de BAC contendo um cDNA de comprimento total de JEV SA 14 -14-2 por faixas em um gradiente de CsCl-EtBr.Nesta experiência, após a centrifugação durante 16 horas a 401.700 × g, duas bandas distintas, ou seja, a E. coli ADN cromossómico de cima e o ADN super-enrolado plasmídeo BAC abaixo, são visíveis no meio do tubo sob luz ultravioleta de onda longa. Um volume mínimo (~ 400 mL) a banda de DNA de BAC inferior foi cuidadosamente recolhido por abrir um furo com uma seringa, no lado do tubo. Subsequentemente, o EtBr foi extraída a partir do DNA de BAC por extracção com butanol, e o DNA de BAC livre de EtBr foi concentrado por precipitação com etanol. O passo final é a determinação da infecciosidade específica dos ARN transcritos sintéticos in vitro a partir de comprimento completo SA 14 -14-2 BAC (pBAC / SA -14-2 14) após transfecção de ARN em células permissivas (Figura 4). Este passo envolve três passos sequenciais: 1, Passo de linearização de comprimento completo SA 14 -14-2 cDNA no extremo 3 &#39;-end do genoma viral (Figura 4A); Passo 2, a produção de RNAs sintéticos a partir do cDNA linear, através do escoamento de transcrição (Figura 4B); e Passo 3, salvamento dos vírus recombinantes em células BHK-21 transfectadas com os ARN sintéticos (Figura 4C). Experimentalmente, dois clones independentes de pBAC / SA 14 -14-2 foram linearizado com Xbal e tratado com digestão NBM para remover a quatro bases 5 &#39;saliência gerada pela digestão com Xbal. Os BACs linearizados foram limpos por extracção com fenol-clorofórmio, seguido de precipitação com etanol. A linearização dos dois BACs purificados foi demonstrada em um gel de agarose a 0,8% (Figura 5A). A extracção com fenol-clorofórmio deve ser feito com cuidado para assegurar que os BACs linearizados são isentos de RNase. Cada um dos dois BACs linearizados serviu como molde cDNA para a transcrição run-off com a ARN-polimerase SP6 em presença do m 7 G (5 &#39;) ppp (5&#39;) Um análogo cap. A integridade dos RNAs sintéticos foi mostrado através da execução aliquotas das duas misturas de reacção de transcrição em um gel de agarose a 0,6%, juntamente com uma referência de 1 kb escada de ADN (Figura 5B). Neste ensaio simples, a principal banda de ARN proeminente sempre migrado apenas abaixo dos 3 kb referência banda de DNA e parecia estar afiado. No entanto, o RNA degradado teria uma aparência manchada no mesmo gel. Um ensaio centro infecciosa é o padrão ouro para determinar a infecciosidade específica dos RNAs sintéticos. Este ensaio foi realizado por electroporating células BHK-21 com amostras de ARN, semeando alíquotas iguais de 10 vezes de células electroporadas diluídos em série em placas de 6 poços contendo naive células BHK-21 (3 x 10 5 células / poço), e da sobreposição de agarose sobre as monocamadas de células. Após incubação durante 4 dias, as células sobreviventes foram fixadas com formol e coradas com violeta de cristal um solution para quantificar o número de centros infecciosos (placas), que corresponde ao número de moléculas de ARN infecciosos entregues nas células (Figura 6A). Uma vez que o molde de ADNc utilizada para a transcrição in vitro foi demonstrado ser não-infeccioso, 27 de um alíquota da mistura de reacção de transcrição foi utilizado directamente para a electroporação. A electroporação é o método preferido para a transfecção de ARN; Alternativamente, os ARN podem ser transfectadas por outros métodos que utilizam lipossomas de DEAE-dextrano e catiónicos. ARN electroporação é muito eficaz, mas &quot;formação de arco&quot; do impulso eléctrico ocorre raramente se sais estão presentes na reacção de electroporação ou, se o cuvete de electroporação é reutilizado. A expressão de proteínas virais em células transf ectadas com ARN foi analisada por ensaios de imunofluorescência, utilizando um anti-soro de coelho anti-NS1 (Figura 6B). A produção de partículas virais acumulados nos sobrenadantes de células transfectadas com ARN foi umalyzed por ensaios de placas (Figura 6C). Os resultados destas experiências mostram claramente que os RNAs sintéticos derivados de ADNc infeccioso são permissivas em células BHK-21, gerando um título elevado de vírus recombinantes. <table fo:keep-together.within-page="1"><tbody><tr><td> Oligonucleotide </td><td> Sequência A (5 &#39;para 3&#39;) </td><td> Posição b </td><td> Polaridade </td></tr><tr><td> 1RT </td><td> TAGGGATCTGGGCGTTTCTG GCAAAT </td><td> 2578-2603 </td><td> Antisense </td></tr><tr><td> 1F </td><td> aatcccgggAGAAGTTTATC TGTGTGAACTT </td><td> 1-22 </td><td> Sentido </td></tr><tr><td> 1R </td><td> attgcggccgcCCACGTCGT TGTGCACGAAGAT </td><td> 2532-2553 </td><td> Antisense </td></tr><tr><td> 2RT </td><td> TTCTGCCTACTCTGCCCCTC CGTTGA </td><td> 5975-6000 </td><td> FormigaiSense </td></tr><tr><td> 2F </td><td> aatcccgggTCAAGCTCAGT GATGTTAACAT </td><td> 1800-1821 </td><td> Sentido </td></tr><tr><td> 2R </td><td> attgcggccgcGATGGGTTT CCGAGGATGACTC </td><td> 5929-5950 </td><td> Antisense </td></tr><tr><td> 3RT </td><td> ACGGTCTTTCCTTCTGCTGC AGGTCT </td><td> 9426-9451 </td><td> Antisense </td></tr><tr><td> 3F </td><td> aatcccgggGAGGATACATT GCTACCAAGGT </td><td> 5500-5521 </td><td> Sentido </td></tr><tr><td> 3R </td><td> attgcggccgcGTAAGTCAG TTCAATTATGGCT </td><td> 9380-9401 </td><td> Antisense </td></tr><tr><td> 4RT </td><td> AGATCCTGTGTTCTTCCTCA CCACCA </td><td> 10.952-10.977 </td><td> Antisense </td></tr><tr><td> 4F </td><td> aatcccgggAGTGGAAGGCT CAGGCGTCCAA </td><td> 9200-9221 </td><td> Sentido </td></tr><tr><td> 4R </td><td> attgcggccgcAGATCCTGT GTTCTTCCTCACC </td><td> 10.956-10.977 </td><td> Antisense </td></tr><tr><td> SP6F </td><td> cataccccgcgtattcccac ta </td><td></td><td> Sentido </td></tr><tr><td> SP6R </td><td> ACAGATAAACTTCTctatag tgtcccctaaa </td><td> 1-14 </td><td> Antisense </td></tr><tr><td> F1F </td><td> aggggacactatagAGAAGT TTATCTGTGTG </td><td> 1-17 </td><td> Sentido </td></tr><tr><td> F1R </td><td> TGGATCATTGCCCATGGTAA GCTTA </td><td> 638-662 </td><td> Antisense </td></tr><tr><td> X1F </td><td> CGAATGGATCGCACAGTGTG GAGAG </td><td> 8403-8427 </td><td> Sentido </td></tr><tr><td> X1R </td><td> AAAGCTTCAAACTCAAGATA CCGTGCTCC </td><td> 9120-9148 </td><td> Antisense </td></tr><tr><td> X2F </td><td> GGAGCACGGTATCTTGAGTT TGAAGCTTT </td><td> 9120-9148 </td><td> Sentido </td></tr><tr><td> X2R </td><td> cacgtggacgagggcatgcc tgcag </td><td></td><td> Antisense </td></tr><tr><td> ROF </td><td> CCAGGAGGACTGGGTTACCA AAGCC </td><td> 10.670-10.694 </td><td> Sentido </td></tr><tr><td> ROR </td><td> agggcggccgctctagAGAT CCTGTGTTCTTCCTCACCAC </td><td> 10.954-10.977 </td><td> Antisense </td></tr><tr><td colspan="4"> uma sequência JEV são mostrados em letras maiúsculas, e as sequências BAC são indicados em letras minúsculas. posição b Nucleotide refere-se à sequência completa do genoma de JEV SA 14 -14-2 (número de acesso Genbank JN604986). </td></tr></tbody></table> Tabela 1: Os oligonucleótidos utilizados para a síntese de ADNc, amplificação por PCR, e mutagénese de BAC. <img alt="figura 1" src="/files/ftp_upload/53164/53164fig1.jpg" /> Figura 1.0; Estratégia para a construção de um ADNc de comprimento completo do JEV SA 14 -14-2 como um BAC (A) Isolamento de RNA viral a partir de partículas de JEV.. É mostrado um diagrama esquemático do ARN genómico de JEV SA 14 -14-2. (B) Síntese de quatro fragmentos de ADNc que se sobrepõem (F1 a F4) que cobre todo o genoma viral. (C) A subclonagem de fragmentos de ADNc que se sobrepõem quatro num vector BAC, criando pBAC / F1 para pBAC / F4. (D) A modificação dos cDNAs clonados para transcrição run-off in vitro. pBAC / F1 SP6 é um derivado de pBAC / F1 que contém a sequência do promotor SP6 a montante da extremidade 5 &#39;virai. pBAC / F3 KO é um derivado de pBAC / F3 que contém uma mutação silenciosa ponto (A 9134 → t, asterisco). pBAC / F4 RO é um derivado de pBAC / F4 que contém um local artificial Xbal de escoamento a jusante da extremidade 3 &#39;virai. (E </<html> strong&gt;) O conjunto inclui um full-length SA 14 -14-2 BAC (pBAC / SA 14 -14-2). <a href="https://www.jove.com/files/ftp_upload/53164/53164fig1large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 2" src="/files/ftp_upload/53164/53164fig2.jpg" /> Figura 2. Síntese de quatro fragmentos de cDNA sobrepostas (F1 a F4) que mede o RNA genómico de tamanho completo de JEV SA 14 -14-2. Os quatro produtos de RT-PCR são avaliados por electroforese em gel de agarose a 0,8%. H, 1 kb escada de DNA. Os tamanhos esperados dos quatro fragmentos de cDNA estão indicados na parte inferior da imagem do gel. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig2large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> /ftp_upload/53164/53164fig3.jpg &quot;/&gt; Figura 3. Purificação de BAC contendo um ADNc de comprimento completo do JEV SA 14 -14-2. O plasmídeo BAC é isolado a partir de E. coli DH10B pelo método de lise alcalina-SDS e ainda purificado por bandagem num gradiente de CsCl-EtBr. Apresentado é um exemplo do gradiente de CsCl-EtBr usando um 16 × 76 milímetros tubo de polipropileno selado. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig3large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 4" src="/files/ftp_upload/53164/53164fig4.jpg" /> Figura 4. Resumo da recuperação de vírus infecciosos a partir de um de comprimento completo JEV SA 14 -14-2 ADNc montado num BAC. (A) A linearização do modelo de cDNA. O full-length JEV BAC é cortado comXbal e tratado com NBM. (B) Síntese dos transcritos de ARN. O ADNc linear é transcrito pela ARN-polimerase SP6 em presença do m 7 G (5 &#39;) ppp (5&#39;) Um análogo de tampão. (C) A recuperação do JEVs sintético. Os RNAs transcritos in vitro são transfectados em células BHK-21 por eletroporação, que gera um elevado título de vírus sintético. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig4large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 5" src="/files/ftp_upload/53164/53164fig5.jpg" /> Figura 5. Síntese dos ARN por transcrição in vitro utilizando um de comprimento completo JEV BAC como um modelo de cDNA. (A) Produção do corpo inteiro linearizado JEV BAC, pBAC / SA 14 -14-2. Dois clones independentes de pBAC/ SA 14 -14-2 (Cl.1 e CL.2) são linearizados por digestão com Xba I e por tratamento subsequente com NBM. Os BACs linearizados são examinados por electroforese em gel de agarose a 0,8%. (B) A produção dos RNAs sintéticos por transcrição run-off. Cada um dos dois BACs linearizado é utilizado como um molde para a RNA-polimerase SP6 de transcrição run-off. Alíquotas das duas reacções de transcrição são corridos num gel de agarose a 0,6%. M, 1 kb DNA ladder. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig5large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 6" src="/files/ftp_upload/53164/53164fig6.jpg" /> Figura 6. infecciosidade específica dos ARN transcritos a partir de um sintéticos JEV BAC de comprimento completo e a recuperação do vírus sintético. Células BHK-21 electroporadas são falsamente (Mock) ou electroporadas com os transcritos de ARN derivados from cada um dos dois clones independentes de todo o comprimento do JEV BAC (Cl.1 e CL.2). (A) a infectividade de ARN. As células são cobertas com agarose e coradas com violeta de cristal a 4 dias após a transfecção. Infectividade de ARN é determinada por ensaios de centros infecciosos para estimar a quantidade de ARN infeccioso electroporada para dentro das células (painel esquerdo). Além disso, imagens representativas de centros infecciosos são mostradas (painel direito). (B) A expressão de proteína. As células são cultivadas em lâminas de câmara de 4 poços. A expressão de proteína virai em células electroporadas ARN a 20 horas após a transfecção (HPT) é analisada por ensaios de imunofluorescência, utilizando um anti-soro de coelho anti-NS1 e um primário de cabra conjugado com Cy3 secundário anti-IgG de coelho (vermelho). Os núcleos são contrastadas com 4 &#39;, 6-diamidino-2-fenilindole (azul). As imagens são sobrepostas em imunofluorescência as suas imagens de contraste de interferência diferencial correspondente. (C) o rendimento virai. As células são cultivadas em 150 pratos mm cultura. A produção de viriões infecciosos acumuladas nos sobrenadantes de cultura de células electroporado RNA em 22 e 40 hpt é examinado por ensaios de placa. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig6large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a>

Watch this Scientific Journal Video about Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses at JoVE.com

Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

Bacteriana Artificial Chromosomes: Uma Ferramenta genómica funcional para o Estudo da Positivo-fio vírus RNA

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose ...

bacterial-artificial-chromosomes-functional-genomics-tool-for-study

Research

JoVE Journal

Immunology and Infection

21.2K visualizações.  Utah State University. Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

Vídeo: Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the generation of extreme population diversity that facilitates virus adaptation and evolution. Increasing evidence shows that the intrinsic error rates, and the resulting mutation frequencies, of RNA viruses can be modulated by subtle amino acid changes to the viral polymerase. Although biochemical assays exist for some viral RNA polymerases that permit quantitative measure of incorporation fidelity, here we describe a simple method of measuring mutation frequencies of RNA viruses that has proven to be as accurate as biochemical approaches in identifying fidelity altering mutations. The approach uses conventional virological and sequencing techniques that can be performed in most biology laboratories. Based on our experience with a number of different viruses, we have identified the key steps that must be optimized to increase the likelihood of isolating fidelity variants and generating data of statistical significance. The isolation and characterization of fidelity altering mutations can provide new insights into polymerase structure and function1-3. Furthermore, these fidelity variants can be useful tools in characterizing mechanisms of virus adaptation and evolution4-7.

The present article describes the steps required to isolate and characterize RNA polymerase fidelity variants of RNA viruses and how to use mutation frequency data to confirm fidelity changes in tissue culture.

Isolamento de variantes de vírus de RNA Fidelity e Caracterização de frequência de mutação de vírus

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

Imunologia e Infecção

Separation of Single-stranded DNA, Double-stranded DNA and RNA from an Environmental Viral Community Using Hydroxyapatite Chromatography

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2. Viruses modulate host cell abundance and diversity, contribute to the cycling of nutrients, alter host cell phenotype, and influence the evolution of both host cell and viral communities through the lateral transfer of genes 3. Numerous studies have highlighted the staggering genetic diversity of viruses and their functional potential in a variety of natural environments. 
Metagenomic techniques have been used to study the taxonomic diversity and functional potential of complex viral assemblages whose members contain single-stranded DNA (ssDNA), double-stranded DNA (dsDNA) and RNA genotypes 4-9. Current library construction protocols used to study environmental DNA-containing or RNA-containing viruses require an initial nuclease treatment in order to remove nontargeted templates 10. However, a comprehensive understanding of the collective gene complement of the virus community and virus diversity requires knowledge of all members regardless of genome composition. Fractionation of purified nucleic acid subtypes provides an effective mechanism by which to study viral assemblages without sacrificing a subset of the community&#x2019;s genetic signature. 
Hydroxyapatite, a crystalline form of calcium phosphate, has been employed in the separation of nucleic acids, as well as proteins and microbes, since the 1960s11. By exploiting the charge interaction between the positively-charged Ca2+ ions of the hydroxyapatite and the negatively charged phosphate backbone of the nucleic acid subtypes, it is possible to preferentially elute each nucleic acid subtype independent of the others. We recently employed this strategy to independently fractionate the genomes of ssDNA, dsDNA and RNA-containing viruses in preparation of DNA sequencing 12. Here, we present a method for the fractionation and recovery of ssDNA, dsDNA and RNA viral nucleic acids from mixed viral assemblages using hydroxyapatite chromotography.

We describe an efficient method to separate single-stranded DNA, double-stranded DNA and RNA molecules from environmental viral communities. Nucleic acids are fractionated using hydroxyapatite chromatography with increasing concentrations of phosphate-containing buffers. This method permits the isolation of all viral nucleic acid types from environmental samples.

Separação de Single-stranded DNA, Double-stranded DNA e RNA de uma Comunidade Ambiental Viral Usando Cromatografia hidroxiapatita

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2.  Viruses modulate host cell abundance and diversity, ...

Introducing Shear Stress in the Study of Bacterial Adhesion

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the initial and determining step of the pathogenesis. Although experimentally adhesion is mostly studied in static conditions adhesion actually takes place in the presence of flowing liquid. First encounters between bacteria and their host often occur at the mucosal level, mouth, lung, gut, eye, etc. where mucus flows along the surface of epithelial cells. Later in infection, pathogens occasionally access the blood circulation causing life-threatening illnesses such as septicemia, sepsis and meningitis. A defining feature of these infections is the ability of these pathogens to interact with endothelial cells in presence of circulating blood. The presence of flowing liquid, mucus or blood for instance, determines adhesion because it generates a mechanical force on the pathogen. To characterize the effect of flowing liquid one usually refers to the notion of shear stress, which is the tangential force exerted per unit area by a fluid moving near a stationary wall, expressed in dynes/cm2. Intensities of shear stress vary widely according to the different vessels type, size, organ, location etc. (0-100 dynes/cm2). Circulation in capillaries can reach very low shear stress values and even temporarily stop during periods ranging between a few seconds to several minutes 1. On the other end of the spectrum shear stress in arterioles can reach 100 dynes/cm2 2. The impact of shear stress on different biological processes has been clearly demonstrated as for instance during the interaction of leukocytes with the endothelium 3. To take into account this mechanical parameter in the process of bacterial adhesion we took advantage of an experimental procedure based on the use of a disposable flow chamber 4. Host cells are grown in the flow chamber and fluorescent bacteria are introduced in the flow controlled by a syringe pump. We initially focused our investigations on the bacterial pathogen Neisseria meningitidis, a Gram-negative bacterium responsible for septicemia and meningitis. The procedure described here allowed us to study the impact of shear stress on the ability of the bacteria to: adhere to cells 1, to proliferate on the cell surface 5and to detach to colonize new sites 6 (Figure 1). Complementary technical information can be found in reference 7. Shear stress values presented here were chosen based on our previous experience1 and to represent values found in the literature. The protocol should be applicable to a wide range of pathogens with specific adjustments depending on the objectives of the study.

During the infection process, a key step is the adhesion of pathogens with host cells. In most instances this adhesion step occurs in the presence of mechanical stress generated by flowing liquid. We describe a technique that introduces shear stress as an important parameter in the study of bacterial adhesion.

Apresentando tensão de cisalhamento em o Estudo da adesão bacteriana

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the ...

Isolation and Genome Analysis of Single Virions using 'Single Virus Genomics'

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which are ubiquitous and the most numerous entities on our planet 4 and important in all environments 5, have yet to be revealed via similar approaches. Here we describe an approach for isolating and characterizing the genomes of single virions called 'Single Virus Genomics' (SVG). SVG utilizes flow cytometry to isolate individual viruses and whole genome amplification to obtain high molecular weight genomic DNA (gDNA) that can be used in subsequent sequencing reactions.

Isolation and Genome Analysis of Single Virions using &#039;Single Virus Genomics&#039;

Single Virus Genomics (SVG) is a method to isolate and amplify the genomes of single virons. Viral suspensions of a mixed assemblage are sorted using flow cytometry onto a microscope slide with discrete wells containing agarose, thereby capturing the virion and reducing genome shearing during downstream processing. Whole genome amplification is achieved using multiple displacement amplification (MDA) resulting in genomic material that is suitable for sequencing.

Isolamento e Análise do Genoma do vírus da única usando &#39;Genomics vírus simples&#39;

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

Estabelecer uma cultura líquida, coberta de vias respiratórias humanas epiteliais Polarized Calu-3 células para estudar a resposta Cell Host para patógenos respiratórios<em&gt; In vitro</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Following in Real Time the Impact of Pneumococcal Virulence Factors in an Acute Mouse Pneumonia Model Using Bioluminescent Bacteria

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. Despite advances in knowledge of this illness, the availability of intensive care units (ICU), and the use of potent antimicrobial agents and effective vaccines, the mortality rates remain high1. Streptococcus pneumoniae is the leading pathogen of community-acquired pneumonia (CAP) and one of the most common causes of bacteremia in humans. This pathogen is equipped with an armamentarium of surface-exposed adhesins and virulence factors contributing to pneumonia and invasive pneumococcal disease (IPD). The assessment of the in vivo role of bacterial fitness or virulence factors is of utmost importance to unravel S. pneumoniae pathogenicity mechanisms. Murine models of pneumonia, bacteremia, and meningitis are being used to determine the impact of pneumococcal factors at different stages of the infection. Here we describe a protocol to monitor in real-time pneumococcal dissemination in mice after intranasal or intraperitoneal infections with bioluminescent bacteria. The results show the multiplication and dissemination of pneumococci in the lower respiratory tract and blood, which can be visualized and evaluated using an imaging system and the accompanying analysis software.

Streptococcus pneumoniae is the leading pathogen causing severe community-acquired pneumonia and responsible for over 2&#160;million deaths worldwide. The impact of bacterial factors implicated in fitness or virulence can be monitored in real-time in an acute mouse pneumonia or bacteremia model using bioluminescent bacteria.

A seguir em tempo real o impacto de fatores de virulência do pneumococo em um mouse Pneumonia aguda Modelo Usando bactérias bioluminescentes

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat because of increased worldwide exchanges and human populations penetrating more and more natural ecosystems. A good example of such an emerging situation is chikungunya virus epidemics of 2005-2006 in the Indian Ocean. Recent progresses in our understanding of cellular pathways controlling viral replication suggest that compounds targeting host cell functions, rather than the virus itself, could inhibit a large panel of RNA viruses. Some broad-spectrum antiviral compounds have been identified with host target-oriented assays. However, measuring the inhibition of viral replication in cell cultures using reduction of cytopathic effects as a readout still represents a paramount screening strategy. Such functional screens have been greatly improved by the development of recombinant viruses expressing reporter enzymes capable of bioluminescence such as luciferase. In the present report, we detail a high-throughput screening pipeline, which combines recombinant measles and chikungunya viruses with cellular viability assays, to identify compounds with a broad-spectrum antiviral profile.

In vitro assays to measure virus replication have been greatly improved by the development of recombinant RNA viruses expressing luciferase or other enzymes capable of bioluminescence. Here we detail a high-throughput screening pipeline that combines such recombinant strains of measles and chikungunya viruses to isolate broad-spectrum antivirals from chemical libraries.

Triagem de alta capacidade para amplo espectro químico Inibidores de Vírus RNA

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

Detecting Glycogen in Peripheral Blood Mononuclear Cells with Periodic Acid Schiff Staining

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. Polysaccharides such as glycogen, glycoproteins, and glycolipids stain bright magenta making it easy to enumerate positive and negative cells within the tissue. In muscle cells PAS staining is used to determine the glycogen content in different types of muscle cells, while in blood cell samples PAS staining has been explored as a diagnostic tool for a variety of conditions. Blood contains a proportion of white blood cells that belong to the immune system. The notion that cells of the immune system possess glycogen and use it as an energy source has not been widely explored. Here, we describe an adapted version of the PAS staining protocol that can be applied on peripheral blood mononuclear immune cells from human venous blood. Small cells with PAS-positive granules and larger cells with diffuse PAS staining were observed. Treatment of samples with amylase abrogates these patterns confirming the specificity of the stain. An alternate technique based on enzymatic digestion confirmed the presence and amount of glycogen in the samples. This protocol is useful for hematologists or immunologists studying polysaccharide content in blood-derived lymphocytes.

Periodic acid Schiff staining is a technique that visualizes the polysaccharide content of tissues. This article demonstrates periodic acid Schiff staining protocol adapted for use on peripheral blood mononuclear cells purified from human venous blood. Such samples are enriched for lymphocytes and other white blood cells of the immune system.

Detecção de glicogênio no sangue periférico células mononucleares com Periodic Acid Schiff Coloração

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. ...

Electroporation of Functional Bacterial Effectors into Mammalian Cells

The study of protein interactions in the context of living cells can generate critical information about localization, dynamics, and interacting partners. This information is particularly valuable in the context of host-pathogen interactions. Many pathogen proteins function within host cells in a variety of way such as, enabling evasion of the host immune system and survival within the intracellular environment. To study these pathogen-protein host-cell interactions, several approaches are commonly used, including: in vivo infection with a strain expressing a tagged or mutant protein, or introduction of pathogen genes via transfection or transduction. Each of these approaches has advantages and disadvantages. We sought a means to directly introduce exogenous proteins into cells. Electroporation is commonly used to introduce nucleic acids into cells, but has been more rarely applied to proteins although the biophysical basis is exactly the same. A standard electroporator was used to introduce affinity-tagged bacterial effectors into mammalian cells. Human epithelial and mouse macrophage cells were cultured by traditional methods, detached, and placed in 0.4 cm gap electroporation cuvettes with an exogenous bacterial pathogen protein of interest (e.g. Salmonella Typhimurium GtgE). After electroporation (0.3 kV) and a short (4 hr) recovery period, intracellular protein was verified by fluorescently labeling the protein via its affinity tag and examining spatial and temporal distribution by confocal microscopy. The electroporated protein was also shown to be functional inside the cell and capable of correct subcellular trafficking and protein-protein interaction. While the exogenous proteins tended to accumulate on the surface of the cells, the electroporated samples had large increases in intracellular effector concentration relative to incubation alone. The protocol is simple and fast enough to be done in a parallel fashion, allowing for high-throughput characterization of pathogen proteins in host cells including subcellular targeting and function of virulence proteins.

Electroporation was used to insert purified bacterial virulence effector proteins directly into living eukaryotic cells. Protein localization was monitored by confocal immunofluorescence microscopy. This method allows for studies on trafficking, function, and protein-protein interactions using active exogenous proteins, avoiding the need for heterologous expression in eukaryotic cells.

A electroporação de efectores bacterianos funcionais em células de mamíferos

The study of protein interactions in the context of living cells can generate critical information about localization, dynamics, and interacting partners. ...

Intranasal Administration of Recombinant Influenza Vaccines in Chimeric Mouse Models to Study Mucosal Immunity

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the physiological mechanisms that mediate immune responses to vaccines perhaps due to the overall success of vaccination, which has reduced interest into the molecular and physiological mechanisms of vaccine immunity. However, several important human pathogens including influenza virus still pose a challenge for vaccination, and may benefit from immune-based strategies. 
Although influenza reverse genetics has been successfully applied to the generation of live-attenuated influenza vaccines (LAIVs), the addition of molecular tools in vaccine preparations such as tracer components to follow up the kinetics of vaccination in vivo, has not been addressed. In addition, the recent generation of mouse models that allow specific depletion of leukocytes during kinetic studies has opened a window of opportunity to understand the basic immune mechanisms underlying vaccine-elicited protection. Here, we describe how the combination of reverse genetics and chimeric mouse models may help to provide new insights into how vaccines work at physiological and molecular levels, using as example a recombinant, cold-adapted, live-attenuated influenza vaccine (LAIV). We utilized laboratory-generated LAIVs harboring cell tracers as well as competitive bone marrow chimeras (BMCs) to determine the early kinetics of vaccine immunity and the main physiological mechanisms responsible for the initiation of vaccine-specific adaptive immunity. In addition, we show how this technique may facilitate gene function studies in single animals during immune responses to vaccines. We propose that this technique can be applied to improve current prophylactic strategies against pathogens for which urgent medical countermeasures are needed, for example influenza, HIV, Plasmodium, and hemorrhagic fever viruses such as Ebola virus.

There is an overall lack of knowledge about how vaccines work. Here we propose the combined use of reverse genetics and bone marrow chimeric mice to gain insight into the early host immune responses to vaccines with a special focus on dendritic cells and T cell immunity.

A administração intranasal de recombinantes Vacinas contra Influenza em quimérico rato Modelos para estudar a imunidade mucosal

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the ...