Bu araştırma için Roger Cone USDA-NIFA Ödülü 2015-67015-23488 tarafından finanse edildi. Yazarlar Dr. Ronald Phelps damızlık stok seçim ölçütü video açıklaması için teşekkür ederiz. Ahmed Elaswad ve Karim Khalil Mısır kültür ve eğitim büro Washington DC'de doktora araştırma finansmanı için teşekkür etmek istiyorum.

Bu yapılan balık genetik araştırma birimi, E. W. kabuk balıkçılık Araştırma Merkezi, Auburn Üniversitesi, AL. Deneme başlatılmadan önceki bu deneyde kullanılan tüm deneysel protokoller Auburn Üniversitesi Kurumsal hayvan bakım ve kullanım Komitesi (AU-IACUC) tarafından kabul edildi. Bir liste bu deneyde kullanılan malzemeleri ve Ekipmanları Malzemeleri tablosunda bulunabilir. Aşağıdaki adımlar ve yordamlar için hazırlık ve mikroenjeksiyon kanal yayın balığı tek hücreli embriyo şekil 1' de gösterildiği gibi vardır.
1. kara kara hisse senedi seçimi ve yumurtlama
<ol><li>Sağlıklı kanal yayın balığı damızlık stok zorlanma veya ilgi genetik satır'ı seçin. Kanal yayın balığı ve erkeklerde iyi ikincil cinsiyet özellikleri göstermelidir.</li>
	<li>Bedenlerini iyi gelişmiş genital papilla ile geri kalanı daha geniş geniş bir kas kafa var erkek seçin. Koyu renk, yara izi ve bölgesel mücadele üzerinden yaralar da cinsel hazırlık belirtileridir. Vücutlarını geri kalanından daha dar kafaları kadın seçin ve yumuşak, elle tutulur, çok yönlü karın var. Doğruluk ve balık ilk işleme sırasında stres önlemek için kadın 2-3 gün önce yumurtlama için hazır inceleyerek beslemekten.</li>
	<li>Balık hızlı bir şekilde, ama dikkatli bir şekilde işleme gerçekleştirin. İşleme stresi azaltmak için işleme kadın çantaları (32 mm boyut mesh) yumurtlama içinde balık tutarken gerektiren tüm yordamları gerçekleştirin.</li>
	<li>Yumurtlama ikna etmek için sadece hormon enjeksiyonu daha önce kadın vücut ağırlığını ölçmek.</li>
	<li>Yumurtlama çanta içinde dişi tank ile sürekli su akışı ve yeterli havalandırma bir akış içinde asmak.</li>
	<li>Aseptik, 14 G iğne Lüteinizan hormon analog (LHRHa) implant bırakmadan 85 µg/kg olan implanter yükleyin. Enjeksiyon yeri (sırt kas) enjeksiyon önce % 0,9 steril serum fizyolojik solüsyonu ile yıkayın. İmplanter 45 ° açıyla yerleştirin ve implant bırakın. İğne ve kuvvetli darbe enjeksiyon yeri daha önce % 70 etanol ıslatılmış bir pamuk ile geri alıyorum.</li>
	<li>15-20 cm su yüzeyinin altında su böylece balık tamamen içinde batık yeri tankı yumurtlama çantada. Yeterli havalandırma (yukarıda 5 ppm çözünmüş oksijen) ve iyi su kalitesi yüksek kaliteli yumurta yumurtlama için önemlidir.</li>
	<li>Derecesi-saat (h) ilişki35kullanarak su sıcaklığı dayalı yumurtlama zamanı tahmin. Derecesi-h tepki süresi hormonu enjeksiyon ve yumurtlama (h) arasındaki süre = * su sıcaklığı (° C). Örneğin, 900-1000, derece-h tepki süresi için bir erkek hormonu enjeksiyon zaman 25 ° C'de 36-40 h spawn bekleniyor Genellikle, yumurta için ilk onay 36 h hormonu enjeksiyon sonra ve daha sonra 4 h aralıklarla yapılır.</li>
	<li>Yumurtlama için kontrol etmek için yumurtlama çantanın içine eklenen yumurta için arıyoruz iken su yüzeyi üzerinde yumurtlama çanta yavaşça kaldır. En az 10 yumurta görmek bu dişinin yumurtlama ve el sıyırma için hazır olduğunu gösterir.</li>
</ol>2. sperm hazırlama
Not: Sperm bir kaç saat önce beklenen yumurtlama zaman hazır olun.
<ol><li>Anestezi sperm motilitesi üzerinde olumsuz bir etkisi olabilir beri anestezi, başsız bir vurmalı darbe tarafından erkekler ötenazi.</li>
	<li>Testisler küçük bir tartı tavada toplamak, herhangi bir dokuyu ve gerekirse 50-mL % 0,9 serum fizyolojik kan, kaldırmak için ile yıkayın. İyi gelişmiş testis birçok villiform projeksiyonlar ( Şekil 2) ile beyazdır.</li>
	<li>Testis ağırlığını belirlemek.</li>
	<li>Sperm çözüm yumurta döllenme için hazırlamak için testis forseps kullanarak bir 100 cm2 100 µm kafes Center'a aktarın. Testis testis içinde ezmek ile mesh katlayın ve sperm 50 mL toplama tüp içine filtre. Bu testisler başparmak ile toplama tüp kenarında karşı kafes içinde basınç uygulayarak yapılabilir. % 0,9 serum fizyolojik çözüm kafes toplama tüp içine sperm yıkama için kullanın. Tuzlu çözüm 10 mL/g testis eklenebilir.</li>
	<li>Sperm konsantrasyonu belirlemek, canlılık ve hareket kontrol et. Not: Bir hemasitometre kullanarak milt bilinen seyreltilmiş hacmi sperm hücrelerinde sayarak konsantrasyon belirlenebilir. Alternatif olarak, sperm yoğunluğu bir Spektrofotometre kullanarak milt optik yoğunluk değerlendirerek tahmin edilebilir. Bu yöntemde, 505 nm dalga boyu emme önceden sperm36farklı konsantrasyonlarda emilimi için hazırlanmış bir kontrol listesi karşılaştırılır. Sperm motilitesi mikroskop altında sperm aktive edilene kadar sperm hareketi (hareketliliği süresi olarak da adlandırılır)37kesilmesi zaman olarak kontrol edilebilir. Sperm canlılığı birikmiş sperm günahı kalır iken hangi tek uygun sperm hücresi, leke sperm trypan mavi, gibi seçici boyalar ile boyama tarafından belirlenebilir. Ancak, bu mikroenjeksiyon işlemleri için bu testisler iyi gelişmiştir eğer gerekli değildir.</li>
	<li>Sperm % 0,9 serum adım 2,5 4 ° C'de depolayın ve hazırlık sonra 24 saat içinde kullanın.</li>
</ol>3. yumurta toplama ve gübreleme
<ol><li>Sebze kısalma bir 20 cm çapında pan yumurtlama temiz kuru çok ince bir tabaka uygulayın.</li>
	<li>Arabelleğe alınan tricaine metan Sülfonat sodyum bikarbonat ile 100 ppm içeren anestezik çözüm dişi koyun (nihai çözüm pH 7,0 olmalıdır) Balık tamamen imzalat38olana. Uyarı: Tricaine metan Sülfonat Eğer inhale, hafızanın veya deri yoluyla emilir rahatsız edici olabilir.</li>
	<li>Dikkatle, Balık yumurtlama çantasından çıkartın ve o anestezik çözüm yıkamak için % 0,9 serum içinde eğim. Balık tamamen temiz bir havlu, Balık vücut yüzeyi mukus tabakasının kaldırılması kaçınarak kullanarak kapalı kuru.</li>
	<li>Sebze kısalma yüzgeçleri pelvik el sıyırma sırasında ek yumurta önlemek için de dahil olmak üzere havalandırma, çevresini uygulanır.</li>
	<li>El şerit yumurtaları yumurtlama yağlanmış tavaya yumurtalık için hafif basınç uygulayarak. İyi yumurta serbestçe akışı, altın sarısı renkte olmalı ve çok az var veya yok kümeleri veya kan pıhtılaşması (Şekil 2). Su micropyle kapatma teşvik ettiği gibi arasında yumurta ve gübreleme önce su temasından kaçının.</li>
	<li>Mikroenjeksiyon için yumurtaları döllemek için yumurtlama pan yağlanmış bir 200 – 300 yumurta aktarın. Yağlanmış plastik bitki Etiketler bir kaşık yumurta için yumurtlama pan yağlanmış aktarmak için kullanılabilir. 1-2 mL (Kimden adım 2.5) sperm çözüm yumurtalara ekleyin ve karışımı yavaşça. Sperm yumurta oranı yaklaşık 11.000 sperm/yumurta olmalıdır.</li>
	<li>Yumurtalara sperm ve yumurta etkinleştirmek için tatlı su ekleyin. Biraz yumurta karşılamak için yeterli su ekleyin. 30 s. gübreleme 1-2 dk içinde oluşması için yavaşça yumurta girdap. Tek bir katmanda düzenlenmiş olan yumurtaları döllemek önemlidir. Yayın balığı yumurta her embriyo çoklu katmanlar microinject önlemek üzere diğer uygun.</li>
	<li>Döllenmiş yumurta daha tatlı su ekleyin ve yumurta için 10-15 dk sertleşmesine.</li>
	<li>Bir kaç saat içinde döller ve kurutma önlemek için ıslak bir havlu tarafından kalan döllenmemiş yumurta içeren yumurtlama tava kapağı. Fertilizasyon kademeli bir şekilde yapılabilir, örneğin embriyo sürekli bir tedarik mikroenjeksiyon ve sigara enjekte denetim embriyolar için bir hücre aşamada emin olmak için her 30-60 dk 200 – 300 yumurta olabilir, bir dizi döllenmiş. Yumurta bunları kaldırmak üzere ıslak havlu uygun gibi ıslak havlu ve yumurtalar arasında temas kaçının. Bu iletişim kuralı, sıyırma sonra 2-3 saat içinde döllenmiş yumurta verimli bir şekilde microinjected ve yumurta olarak benzer başarı hemen sıyırma sonra döllenmiş vardı.</li>
</ol>4. iğne çekerek ve yükleme
<ol><li>1.0 mm OD borosilikat cam kapiller 2 iğneler (şekil 3) çek. İğneler çeşitli kesiler yapılmış sünger parçası ile bir kağıt kutusu saklayın. İğne bozulmaması için sünger çapını iğne kök uzunluğundan daha küçük olmalıdır.</li>
	<li>İğne ucu keskin bir nesne kullanarak ibre en ince bölgenin küçük bir parça kırarak açın. Alternatif olarak, iğne mikroskop altında Forseps ile uç bölgesi en ince pinching tarafından açın.</li>
	<li>Enjeksiyon çözüm gRNA(s) Cas9 protein ile karıştırarak hazırlayın. Diğer türlü RNA ya da protein aynı yordamı ile enjekte edilir. Bu protokol için gRNAs hedef kanal yayın balığı bağışıklık ilgili genlerin, geçiş ücreti/İnterlökin 1 reseptör etki alanını içeren bağdaştırıcı molekül (TICAM1) gen ve rhamnose bağlayıcı lektin (RBL) gen için iki tasarlanmış ve Şah ve arkgöre hazırlanmış. yüksek sadakat Taq polimeraz32,39kullanımı ile. EXoN 1 RBL gen protospacer bitişik motifi (PAM) sıra için altı çizili (şekil 6) 5' GGA GGT GAA GCA CGT CGA GGA 3' TICAM 1 gen (şekil 4) ve 5' GGA CTT TGA GTC GGA GAA GTG G 3' gRNAs için genomik hedefi oldu.<ol>
<li>PATLAMA Kılavuzu RNA hedeflerine karşı kanal yayın balığı genom sıra ve bu potansiyel hedef kapalı site ile seçin.</li>
		<li>Fenol kırmızı renk gRNA/Cas9 protein Toplam hacim üçte biri kadar karıştırın ekleyin.</li>
		<li>Her embriyo 50 ile enjekte edilir nükleaz boş su ile gRNA/Cas9 protein karışımı nihai toplama ayarlamak yaklaşık 2.5 ng gRNA ve 7,5 ng Cas9 protein içeren nL. Karışımı 10 dakika buz kullanmadan önce kuluçkaya.</li>
	</ol>
</li>
	<li>Bir microloader ile 5-10 µL gRNA/Cas9 karışımı microloader iğne kök yerleştirip karışımı yavaş yavaş microloader ucu (şekil 3) geri çeker iken kovma enjeksiyon iğne yükleyin. İçinde hava kabarcıkları yakalama kaçının.</li>
	<li>İğne micropipette sahibine eklemek ve sıkı bir bağlantı sağlamak ve sahibi için micromanipulator ekleyebilirsiniz. Ücretsiz kararlı hareket emin olun. Basınç mikroenjeksiyon için azot silindir açılış ve basınç regülatörü yaparak uygulayın. Not: Enjeksiyon hacmi etkilenebilir basınç, iğne diyafram çapı ve enjeksiyon süresi tarafından. Enjekte, bir damla mineral yağı enjekte için birim belirlemek için bir hemasitometre yerleştirilir. Gerekirse, basınç, iğne ve iğne çapı süresi enjeksiyon hacmi azaltmak veya artırmak için ayarlanabilir. Birden çok kez tutarlı cilt sağlamak için mineral yağ enjekte.</li>
</ol>5. Yayın balığı embriyo mikroenjeksiyon
<ol><li>Sebze kısalma 100 mm temiz Petri kabına için çok ince bir tabaka uygulayın.</li>
	<li>Yağlanmış plastik bitki etiket kullanma, 50-100 yumurta döllenme tava Petri kabına aktarmak ve onları Holtfreter'ın çözüm (malzemeler tablo) ile kaplayın. Birbirlerine karşı yumurta tek bir katmanda hizalayın. Bu hizalama yumurtaların mikroenjeksiyon işlemi sırasında yerde tutmak gerekir.</li>
	<li>Petri kabına yumurta ile mikroskop sahnesinde yerini ve tek elle tutun. Bir tek düzgün hareket koryon ve sarısını deliyor dek Öte yandan (şekil 3) iğneyle indirin. İğne ucu enjeksiyon malzeme teslim etmeden önce blastodisc için mümkün olduğunca yakın olmalıdır.<ol>
<li>Sarısı enjeksiyon malzeme sunmak için pedal düşürmek. Blastodisc açıkça görünür değilse, enjeksiyon malzemesi sarısı, farklı konumlarda içine yayılmış. Bunu yapmak için iğne kadar sarısı sonuna eklenir, sonra pedal iç karartıcı ve iğne çekilmesi aynı anda yumurtalı farklı alanları ile enjeksiyon malzeme yaymak için yapılır. 50 nanoliters kadar kanal yayın balığı sarısı embriyo, ancak enjekte edilebilir, gRNA/Cas9 protein miktarı her gen mutasyon oranı ve embriyo hayatta kalma32için en iyi sonuçları elde etmek için optimize edilmiş olması gerekiyor.</li>
	</ol>
</li>
	<li>İğne sorunsuz geri çek yumurta zarar için. Başka bir yumurta ile aynı yordamı enjekte Petri kabına taşıyın. Bu yumurta zarar verebilir veya iğne kırabilir Petri kabına hareketi enjeksiyon işlemi sırasında önlemek. Yırtıldı veya mikroenjeksiyon nedeniyle zarar yumurta kaldırın. Enjeksiyon 15-20 dk sonra gübreleme başlatılabilir ve embriyo (kadar yaklaşık 60-90 dakika sonra fertilizasyon) hala bir hücre aşamasında olduğu sürece devam etmek.</li>
	<li>Enjekte embriyo Holtfreter'ın çözüm doksisiklin ve40çıkım kadar 6-7 gün boyunca sürekli nazik havalandırma 10 ppm ile geri koyun. Çözüm her gün değiştirin ve ölü embriyo kaldırın.</li>
</ol>6. mutasyon algılama
<ol><li>Rastgele, birkaç enjekte embriyo 72 h sonrası döllenme, toplamak, sarısı kaldırmak ve genomik DNA ayıklayın. 3-5 sigara enjekte embriyo bir denetim içerir. Not: Genomik DNA embriyo yumurta kabukları ve sarısı malzeme İndinavir K sindirim ve etanol yağış32kullanarak çıkarıldıktan sonra elde edilebilir.</li>
	<li>GRNA nerede mutasyonlar yüksek sadakat Taq polimeraz32kullanarak gerçekleşmesi beklenen her gen için genomik hedefler kanat bir DNA kesimi yükseltmek. TICAM 1, astar 5' GCTGCTGAATGTCTGATTATG için 3' (İleri) ve 5' GTCCTCCACACTCCTGAAG 3' (ters) bir 750 yükseltmek için kullanılan bp RBL iken, astar 5' TCATTATTTCCTGGTACTCAGTA için 3' (İleri) ve 5' AGAGATTAGTCACACATCATTATT 3' (tersi) için kullanılan RBL gen 375 bp segmentten yükseltmek.<ol>
<li>Aşağıdaki PCR reaksiyon kullanın: 20 µL PCR sınıf su; 1 x yüksek sadakat Taq enzim reaksiyon arabellek MgCl2, 0.2 mM dNTP ile karıştırın, her biri aynı, 100-300 ng genomik DNA ve yüksek sadakat Taq enzim karışımı 1,25 birimleri ileriye ve geriye doğru astar için 0.4 µM. PCR bisiklet koşullarını gerçekleştirmek: ilk denatürasyon 94 ° c 3 dakika; denatürasyon 94 ° C'de 35 döngüleri için 30 55 60 ° C'de tavlama s, s TICAM için ve 40 s için RBL, uzantısı 72 ° c için 1 dk/kb; ve 10 dk 72 ° C'de son uzantısı.</li>
	</ol>
</li>
	<li>Sıralama arıtılmış PCR ürünleri, surveyor mutasyon algılama tahlil, heteroduplex hareketlilik tahlil, restriksiyon enzimi tanıma sitesi kaybı gibi bir mutasyon algılama yöntem veya herhangi bir diğer mutasyon algılama yöntemi kullanarak mutant embriyo tespit hedef için uygun. Bu protokol için mutant embriyo TICAM 1 ve sıralama RBL gen için saflaştırılmış PCR ürünlerinin yanı sıra restriksiyon enzimi sapı site kesmek kaybı için arazi mutasyon algılama tahlil kullanarak bulmak.</li>
	<li>Mutant gen tanımlamak için PCR ürünleri ve sıra vektörel çizimler bireysel kolonilerden klonu. Şekil 4 ve şekil 6 ' da sunulan mutant gen enjekte embriyo geldi. PCR ürünleri altı microinjected ve her gen için 3 kontrol embriyo iki ayrı tüp, bir microinjected embriyo ve 86 vektörel çizimler ve diğer denetim embriyolar, hızla klonlanmış için içinde TICAM 1 ve 8 de dahil olmak üzere sıralı, RBL gen için 48 vektörel çizimler için havuza alınmış Her gen için 3 kontrol sigara enjekte embriyo reaksiyonlardan sıralanıyor.</li>
	<li>Farklı mutant gen tanımlamak için mutant embriyo gelen dizileri patlama veya T-kahve gibi herhangi bir DNA dizisi hizalama araç kullanarak vahşi tipi kol için karşılaştırın.</li>
</ol>

Yazarlar onlar hiçbir çıkar çatışması var bildirin.

Mikroenjeksiyon gen nakavt elde etmek için kanal yayın balığı embriyolar için detaylı bir protokol sunuldu. Enjeksiyon CRISPR/Cas9 proteinin sarısı çok daha kolaydır zaman kazandırır ve does değil istemek en gen transferi ve gen balıkla düzenleme için ortak teknik tek hücreli embriyo blastodisc microinjecting için karşılaştırıldığında kapsamlı eğitim 30 , 42. Geçerli protokol kanal yayın balığı TICAM 1 ile RBL gen indels inducing...

Mikroenjeksiyon, DNA, RNA, protein ve oluştururlar gibi bir madde küçük bir miktar hücreler veya embriyo ile cam kapiller1teslim etmek için kullanılan ortak bir laboratuvar tekniktir. Mikroenjeksiyon bir microinjector, micromanipulator ve mikroskop2de dahil olmak üzere özel ekipman Kurulumu kullanılarak gerçekleştirilir. Teknik genetik transgenics, gen Renkleri çakıştırmama ve gen terapisi, nesil hücre içi bileşenleri3,4 dinamiklerini anlamak amacıyla aracılığıyla birçok organizmalar değiştirmek için araştırmacılar tarafından kullanılan , 5.
Kanal yayın balığı (Ictalurus punctatus) su ürünleri en popüler yayın balığı türler ve eğlence balıkçılık faaliyetleri Amerika Birleşik Devletleri olduğunu. İşlevsel genomik kanal yayın balığı eğitim için artan bir ihtiyaç ve kanal yayın balığı tam genomunun sıralama genom düzenleme araçları6,7son gelişmeler yarar artırır. Gen işlevini anlama sadece yayın balığı üzerinde yürütülen araştırma zenginleştirmek istiyorsunuz değil, ama aynı zamanda daha etkili genetik geliştirme programları için yayın balığı sanayi geliştirmek için neden olabilir. İlgi belirli bir özellik için kritik gen tanımlandıktan sonra onlar genetik olarak yararlı allelleri oluşturmak için genom düzenlemeyi kullanarak yayın balığı üretimi seçimi için zararlı gen aktarımı, bastırmak bu gen artırmak için kullanılabilir transgenesis veya bu seçeneklerin bir bileşimini yararlı gen. Bir balık farklı türlerden farklı ticari olarak yararlı özellikleri için en iyi genler birleştirerek büyük ölçüde verimlilik ve karlılık balık üretim işlemleri8artıracak.
Gene nakavt gen fonksiyonları içinde vivoçalışmaya doğrudan bir yöntemdir. Mutasyonlar DNA düzeyinde etkileri çalışmanın farklı generations kolaylaştıracaktır gelecek nesiller tarafından devralınır. Farklı genom düzenleme araçları gelişmiş dahil olmak üzere çinko parmak enzimler (ZFNs), transkripsiyon harekete geçirmek gibi efektör enzimler (TALENs) edilmiş ve düzenli olarak interspaced kısa palindromik tekrarlar/CRISPR-ilişkili protein 9 (CRISPR/Cas9 kümelenmiş ) sistem9,10,11,12.
CRISPR/Cas9 sistem genomik DNA dizileri gene nakavt balık RNA güdümlü siteye özgü DNA bölünme5,13arası da dahil olmak üzere düzenlemek için kullanılan güçlü ve etkili bir araçtır. Genom ve bir DNA endonükleaz enzimi, Cas9 hedeflenen sırayla belirleyen bir Kılavuzu RNA (gRNA), sistem oluşur. CRISPR/Cas9 sistem genom herhangi bir sırayla ZFNs ve TALENs çeşitli avantajlar ile hedef için tasarlanmış olması: (1) daha düşük (2) kolay (3) daha özel bağlayıcı Guide RNA hedef sıra için mühendislik maliyet ve hedef kapalı mutasyonlar (4) azaltılmış birden çok dizileri aynı time (5) yüksek mutagenesis oranda TALENs ve (6) geliştirilmiş germline iletim hızıyla mutasyonlar için ilâ 6-fold ZFNs TALENs ve14içinkarşılaştırıldığında mutasyona uğramış değil genlerdeki farklı gRNA ile hedef alınabilmesi, 15,16,17,18.
Ana alternatif mikroenjeksiyon için çoğalmasıyla, elektrik darbeleri embriyo veya hücre membran geçirgenliği ve biyolojik moleküllerin19,20alımını artırmak için uygulanan bir yöntemdir. Birkaç transgenik balık çoğalmasıyla medaka (Oryzias latipes), Zebra balığı (Danio rerio), chinook somon (Oncorhynchus tshawytscha), kanal yayın balığı, çipura (Sparus sarba) gibi kullanarak oluşturulan ve ortak sazan (Cyprinus carpio)21,22,23,24,25,26.
Elektroporasyon plazmid DNA, RNA ve Cas9 protein gen nakavt için teslim etmek için kullanılmıştır. Memeli hücrelerinde, Cas9/gRNA plazmid DNA, Cas9 mRNA/gRNA ve Cas9 protein/gRNA kompleksleri elektroporasyon kullanarak teslim edildi ve mutagenesis gore Cas9 protein/gRNA kompleksleri çoğu elektroporasyon test koşulları27için kullanarak en yüksek. Ascidian Kordalılar (Ciona intestinalis), electroporated birden çok gen28nakavt ikna etmek için döllenmiş yumurta içine TALENs yapıları ifade edildi. Plazmid yapıları ifade ZFNs electroporated Lüteinizan kanal yayın balığı29nakavt olduğunu. Ancak, bir kez hücre içine tanıttı, plazmid yapıları için RNA transkripsiyonu ve büyük olasılıkla için RNA'ın mikroenjeksiyon göre mutagenesis zaman erteleyecek istenen DNA dizisi hedefleyebilirsiniz önce işlevsel proteinler için tercüme gerekir / protein. Bir embriyo geliştiriyor, gecikmeli mutagenesis enjekte kurucuları mozaizm artar. Buna ek olarak, transgenik ifade mutagenesis verimliliği düşürücü mikroenjeksiyon ile mümkün ifade seviyesine ulaşmak mümkün değildir.
Hücrelere genom düzenleme araçları tanıtmak için bir araç olarak mikroenjeksiyon çoğalmasıyla birçok avantajı vardır. Molekülleri düzenleme genom güvenilir bir şekilde hücreleri veya mikroenjeksiyon30ile embriyo içine tanıttı olabilir. Daha az enjeksiyon malzeme gereklidir. Enjekte malzeme miktarlarını belirlemek kolaydır. Daha yüksek mutasyon oranları düşük mozaizm kurucusu balık ile olabilir hangi-cekti geliştirmek germline iletim F1mutasyonların elde. Daha az kurucusu balık daha yüksek mutasyon oranı nedeniyle ilk nesil üretmek için çözümlenmesi gerekir. Elektroporasyon içinde daha fazla kurucusu balık analiz edilecek olan maliyeti artacak gerekir. Ancak, bu daha fazla embriyo31,32enjekte edilerek üstesinden gelebilir rağmen kanal yayın balığı microinjected embriyo yaşama electroporated olanlar, düşüktür. Kanal yayın balığı, yumurta sarısı microinjected embriyo 16'dan bağlı olarak hedef genlerin % 55 arasında değişiyordu yaşama ve gRNA/Cas9 protein32doz.
Yayın balığı embriyo düzenli mikroenjeksiyon teknik olarak talep ediyor ve zaman alıcı ancak, hızlı ve verimli CRISPR/Cas9 protein mikroenjeksiyon protokolü için kanal yayın balığı embriyo sunulur. CRISPR/Cas9 protein çözüm bir hücre embriyo sarısı enjekte edilir beri bu iletişim kuralı daha az zaman ve uzmanlık gerektirir. Döllenmiş yumurta yüzlerce 1 h (yaklaşık zaman gerçekleşmesi ilk hücre bölünmesi gerekli) enjekte edilir. Protokol doğrulamak için iki hastalığı duyarlılık ile ilgili gen kanal yayın balığı, geçiş ücreti/İnterlökin 1 reseptör etki alanını içeren bağdaştırıcı molekül (TICAM1) gen ve rhamnose bağlayıcı lektin (RBL) gen nakavt. TICAM 1 toll benzeri reseptör (TLR) 3 tarafından başlatılan sinyal yolu ilgilenmektedir. Kanal catfish TICAM 1 önemli ölçüde downregulated mavi kedi balığı, bir tür dirençli E. ictaluri33içinde iken bakteriyel meydan okuma ile Edwardsiella ictaluri, takip upregulated oldu. RBL oynar önemli bir rol ile Flavobacterium columnare, columnaris hastalığı, hastalığının erken enfeksiyon akut nerede ve sağlam upregulation göre columnaris duyarlı kanal yayın balığı gerginlik kaydedildi bir columnaris dirençli34.

<table border="0" cellpadding="0" cellspacing="0" width="520">
	<tbody>
		<tr height="100">
			<td height="100" style="height:100px;width:136px;">Reproboost implant</td>
			<td style="width:115px;">Center of Marine Biotechnology</td>
			<td style="width:99px;"></td>
			<td style="width:171px;">Luteinizing hormone releasing hormone analog (LHRHa) for induction of ovulation in channel catfish females</td>
		</tr>
		<tr height="80">
			<td height="80" style="height:80px;width:136px;">TRICAINE-S</td>
			<td style="width:115px;">Western Chemical. Inc.</td>
			<td style="width:99px;"></td>
			<td style="width:171px;">For sedation of brood stock fish during hormone injection and egg stripping.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:136px;">Phenol red</td>
			<td style="width:115px;">Sigma-Aldrich</td>
			<td style="width:99px;">P0290</td>
			<td style="width:171px;">0.5%, sterile filtered</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:136px;">Stereo microscope</td>
			<td style="width:115px;">Olympus</td>
			<td style="width:99px;">213709</td>
			<td style="width:171px;">For visualizing the eggs during microinjection</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:136px;">Microinjector</td>
			<td style="width:115px;">ASI-Applied Scientific Instrumentation&#160;</td>
			<td style="width:99px;">Model MPPI-3</td>
			<td style="width:171px;">For the delivery of the injection material into the embryos</td>
		</tr>
		<tr height="80">
			<td height="80" style="height:80px;width:136px;">Micromanipulator</td>
			<td style="width:115px;">ASI-Applied Scientific Instrumentation&#160;</td>
			<td style="width:99px;">Model MM33&#160;</td>
			<td style="width:171px;">For holding and controlling the movement of the injection needle.&#160;</td>
		</tr>
		<tr height="60">
			<td height="60" style="height:60px;width:136px;">Eppendorf Microloader</td>
			<td style="width:115px;">Eppendorf</td>
			<td style="width:99px;">5242956.003</td>
			<td style="width:171px;">For loading injection solution into microinjection needles.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:136px;">Vertical needle puller</td>
			<td style="width:115px;">David Kopf Instruments</td>
			<td style="width:99px;">Model 720</td>
			<td style="width:171px;">For pulling microinjection needles</td>
		</tr>
		<tr height="60">
			<td height="60" style="height:60px;width:136px;">Cas9 protein</td>
			<td style="width:115px;">PNA Bio Inc.&#160;</td>
			<td style="width:99px;">CP01</td>
			<td style="width:171px;">Recombinant Cas9 protein from Streptococcus pyrogenes.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:136px;">Expand High FidelityPLUS PCR System</td>
			<td style="width:115px;">&#160;Roche Diagnostics, USA</td>
			<td style="width:99px;"></td>
			<td style="width:171px;">For PCR and amplification of DNA templates to be used in gRNA preparation</td>
		</tr>
		<tr height="60">
			<td height="60" style="height:60px;width:136px;">Borosilicate glass capillaries</td>
			<td style="width:115px;">Fisher Scientific</td>
			<td style="width:99px;"></td>
			<td style="width:171px;">1 mm outer diameter (OD), for making microinjection needles.</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:136px;">Petri dish</td>
			<td style="width:115px;">VWR</td>
			<td style="width:99px;">25384-302</td>
			<td style="width:171px;">For holding the embryos during the microinjection.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:136px;">Crisco</td>
			<td style="width:115px;">The J.M. Smucker Company</td>
			<td style="width:99px;"></td>
			<td style="width:171px;">Vegetable shortening for coating spawning pans and petri dishes.&#160;</td>
		</tr>
		<tr height="120">
			<td height="120" style="height:120px;width:136px;">Holtfreter`s solution</td>
			<td style="width:115px;">Home Made</td>
			<td style="width:99px;"></td>
			<td style="width:171px;">59 mM NaCl, 0.67 mM KCl, 2.4 mM NaHCO3, 0.76 mM CaCl2, 1.67 mM MgSO4 to incubate the microinjected embryos till hatch.&#160;</td>
		</tr>
		<tr height="80">
			<td height="80" style="height:80px;width:136px;">Doxycycline hyclate USP (monohydrate)</td>
			<td style="width:115px;">Letco Medical</td>
			<td style="width:99px;">690904</td>
			<td style="width:171px;">Antibiotic added to Holtfreter&#39;s solution to 10 ppm to prevent bacterial infections.</td>
		</tr>
	</tbody>
</table>

microinjection of crispr/cas9 protein into channel catfish, ictalurus punctatus, embryos for gene editing

Kanal yayın balığı, Ictalurus yılan, Komple genom, kanal yayın balığı gen işlev eğitim için daha büyük fırsatlar için önde gelen Sıralı. Gene nakavt bu gen fonksiyonları içinde vivoçalışmada kullanılmaya başlanmıştır. Kümelenmiş düzenli olarak kısa palindromik tekrarlar/ilişkili CRISPR protein 9 (CRISPR/Cas9) interspaced güçlü bir araç genomik DNA dizileri gene işlevi değiştirmek için düzenlemek için kullanılan bir sistemdir. Geleneksel bir yaklaşım içine tek hücreli embriyo mikroenjeksiyon ile CRISPR/Cas9 mRNA tanıtmak olmuştur iken, bu yayın balığı yavaş ve verimsiz bir işlemde olabilir. Burada, mikroenjeksiyon kanal yayın balığı embriyo CRISPR/Cas9 protein ile detaylı bir protokol açıklanmıştır. Kısaca, yumurta ve sperm toplanan ve daha sonra suni döllenme gerçekleştirilen vardı. Döllenmiş yumurta Holtfreter'ın solüsyon içeren bir petri için transfer edildi. Enjeksiyon hacmi kalibre edilmiş ve daha sonra geçiş ücreti/İnterlökin 1 reseptör etki alanını içeren bağdaştırıcı molekül (TICAM 1) gen ve rhamnose bağlayıcı lektin (RBL) gen tek hücreli embriyo sarısı microinjected RNA'ların / Cas9 hedefleme rehberlik. Gen nakavt başarılı olduğu indels DNA sıralama tarafından teyit edildi. Tahmin edilen protein sıra değişiklikler nedeniyle bu mutasyonlar frameshift dahil ve protein erken kodon nedeniyle kesildi.

Mikroenjeksiyon protokolünün etkinliği göstermek için kanal yayın balığı otoyol/İnterlökin 1 reseptör etki alanını içeren bağdaştırıcı molekül (TICAM1) gen ve rhamnose bağlayıcı lektin (RBL) gen hedeflemek için tasarlanmış gRNAs microinjected.
TICAM 1 DNA sıralama vektörlerin havuza alınan, klonlanmış PCR ürünleri bireysel kolonilerden TICAM 1 gen indüklenen Indel mutasyonla...

Watch this Scientific Journal Video about Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing at JoVE.com

Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing

Gen kanal yayın balığı embriyo CRISPR/Cas9 sistemini kullanarak düzenleme için basit ve etkili mikroenjeksiyon protokol sunulmuştur. Bu protokol için RNA'ların rehberlik ve Cas9 protein tek hücreli embriyo sarısı microinjected. Bu protokol iki kanal yayın balığı bağışıklık ile ilgili genlerin knocking tarafından doğrulandı.

CRISPR/Cas9 Protein gen düzenleme için mikroenjeksiyon kanal yayın balığı, Ictalurus yılan, embriyo içine

The complete genome of the channel catfish, Ictalurus punctatus, has been sequenced, leading to greater opportunities for studying channel catfish gene ...

microinjection-crisprcas9-protein-into-channel-catfish-ictalurus

Research

Education

JoVE Core

JoVE Journal

Statistics

Genetics

Unit 1

Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing

Control Charts

SCIENTISTS IN ACTION

14.7K Görüntüleme.  Auburn University. Gen kanal yayın balığı embriyo CRISPR/Cas9 sistemini kullanarak düzenleme için basit ve etkili mikroenjeksiyon protokol sunulmuştur. Bu protokol için RNA'ların rehberlik ve Cas9 protein tek hücreli embriyo sarısı microinjected. Bu protokol iki kanal yayın balığı bağışıklık ile ilgili genlerin knocking tarafından doğrulandı.

Video: Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the identification and verification of a drug resistance gene in the Apicomplexan parasite Toxoplasma gondii, the method of Quantitative Trait Locus (QTL) mapping using a Whole Genome Sequence (WGS) -based genetic map and the method of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 -based gene editing. The approach of QTL mapping allows one to test if there is a correlation between a genomic region(s) and a phenotype. Two datasets are required to run a QTL scan, a genetic map based on the progeny of a recombinant cross and a quantifiable phenotype assessed in each of the progeny of that cross. These datasets are then formatted to be compatible with R/qtl software that generates a QTL scan to identify significant loci correlated with the phenotype. Although this can greatly narrow the search window of possible candidates, QTLs span regions containing a number of genes from which the causal gene needs to be identified. Having WGS of the progeny was critical to identify the causal drug resistance mutation at the gene level. Once identified, the candidate mutation can be verified by genetic manipulation of drug sensitive parasites. The most facile and efficient method to genetically modify T. gondii is the CRISPR/Cas9 system. This system comprised of just 2 components both encoded on a single plasmid, a single guide RNA (gRNA) containing a 20 bp sequence complementary to the genomic target and the Cas9 endonuclease that generates a double-strand DNA break (DSB) at the target, repair of which allows for insertion or deletion of sequences around the break site. This article provides detailed protocols to use CRISPR/Cas9 based genome editing tools to verify the gene responsible for sinefungin resistance and to construct transgenic parasites.

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

Details are presented on how QTL mapping with a whole genome sequence based genetic map can be used to identify a drug resistance gene in Toxoplasma gondii and how this can be verified with the CRISPR/Cas9 system that efficiently edits a genomic target, in this case the drug resistance gene.

QTL Haritalama ve CRISPR / Cas9 Düzenlemesi, bir İlaç Direnç Geninin Belirlenmesi için<emToksoplasma gondii</em

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the ...

Genetik

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide RNA (sgRNA) that confers specificity, the Cas9 protein cleaves both DNA strands at the targeted locus. The DNA break can trigger either non-homologous end joining (NHEJ) or homology directed repair (HDR). NHEJ can introduce small deletions or insertions which lead to frame-shift mutations, while HDR allows for larger and more precise perturbations. Here, we present protocols for generating knockout cell lines by coupling established CRISPR/Cas9 methods with two options for downstream selection/screening. The NHEJ approach uses a single sgRNA cut site and selection-independent screening, where protein production is assessed by dot immunoblot in a high-throughput manner. The HDR approach uses two sgRNA cut sites that span the gene of interest. Together with a provided HDR template, this method can achieve deletion of tens of kb, aided by the inserted selectable resistance marker. The appropriate applications and advantages of each method are discussed.

Recent advances in the ability to genetically manipulate somatic cell lines hold great potential for basic and applied research. Here, we present two approaches for CRISPR/Cas9 generated knockout production and screening in mammalian cell lines, with and without the use of selectable markers.

Memeli Hücrelerinde CRISPR / Cas9 aracılı Gen Knockout&#39;larının Seçime Bağlı ve Bağımsız Üretimi

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point mutations, which often are responsible for a variety of human inherited disorders. Using a well-established cell-based model system, the point mutation of a single-copy mutant eGFP gene integrated into HCT116 cells has been repaired using this combinatorial approach. The analysis of corrected and uncorrected cells reveals both the precision of gene editing and the development of genetic lesions, when indels are created in uncorrected cells in the DNA sequence surrounding the target site. Here, the specific methodology used to analyze this combinatorial approach to the gene editing of a point mutation, coupled with a detailed experimental strategy to measuring indel formation at the target site, is outlined. This protocol outlines a foundational approach and workflow for investigations aimed at developing CRISPR/Cas9-based gene editing for human therapy. The conclusion of this work is that on-site mutagenesis takes place as a result of CRISPR/Cas9 activity during the process of point mutation repair. This work puts in place a standardized methodology to identify the degree of mutagenesis, which should be an important and critical aspect of any approach destined for clinical implementation.

This protocol outlines the workflow of a CRISPR/Cas9-based gene editing system for the repair of point mutations in mammalian cells. Here, we use a combinatorial approach to gene editing with a detailed follow-on experimental strategy for measuring indel formation at the target site&#8212;in essence, analyzing onsite mutagenesis.

Yerinde mutagenisitesinin CRISPR/Cas9 ve SsODN insan hücrelerinde tarafından katalize nokta mutasyon onarım bir fonksiyonu olarak incelemek için standart bir metodoloji

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. Complete gene ablation in HSCs required the generation of knockout mice from which HSCs could be isolated, and gene ablation in primary human HSCs was not possible. Viral transduction could be used for knock-down approaches, but these suffered from variable efficacy. In general, genetic manipulation of human and mouse hematopoietic cells was hampered by low efficiencies and extensive time and cost commitments. Recently, CRISPR/Cas9 has dramatically expanded the ability to engineer the DNA of mammalian cells. However, the application of CRISPR/Cas9 to hematopoietic cells has been challenging, mainly due to their low transfection efficiencies, the toxicity of plasmid-based approaches and the slow turnaround time of virus-based protocols.
A rapid method to perform CRISPR/Cas9-mediated gene editing in murine and human hematopoietic stem and progenitor cells with knockout efficiencies of up to 90% is provided in this article. This approach utilizes a ribonucleoprotein (RNP) delivery strategy with a streamlined three-day workflow. The use of Cas9-sgRNA RNP allows for a hit-and-run approach, introducing no exogenous DNA sequences in the genome of edited cells and reducing off-target effects. The RNP-based method is fast and straightforward: it does not require cloning of sgRNAs, virus preparation or specific sgRNA chemical modification. With this protocol, scientists should be able to successfully generate knockouts of a gene of interest in primary hematopoietic cells within a week, including downtimes for oligonucleotide synthesis. This approach will allow a much broader group of users to adapt this protocol for their needs.

A protocol for fast CRISPR/Cas9-mediated gene disruption in mouse and human primary hematopoietic cells is described in this article. Cas9-sgRNA ribonucleoproteins are introduced via electroporation with sgRNAs generated through in vitro transcription and commercial Cas9. High editing efficiencies are achieved with limited time and financial cost.

Fare ve insan hematopoetik progenitör hücre tarafından CRISPR/Cas9 yüksek verimli Gene bozulma

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

CRISPR/Cas9 Gene Editing to Make Conditional Mutants of Human Malaria Parasite P. falciparum

Malaria is a significant cause of morbidity and mortality worldwide. This disease, which primarily affects those living in tropical and subtropical regions, is caused by infection with Plasmodium parasites. The development of more effective drugs to combat malaria can be accelerated by improving our understanding of the biology of this complex parasite. Genetic manipulation of these parasites is key to understanding their biology; however, historically the genome of P. falciparum has been difficult to manipulate. Recently, CRISPR/Cas9 genome editing has been utilized in malaria parasites, allowing for easier protein tagging, generation of conditional protein knockdowns, and deletion of genes. CRISPR/Cas9 genome editing has proven to be a powerful tool for advancing the field of malaria research. Here, we describe a CRISPR/Cas9 method for generating glmS-based conditional knockdown mutants in P. falciparum. This method is highly adaptable to other types of genetic manipulations, including protein tagging and gene knockouts.

CRISPR/Cas9 Gene Editing to Make Conditional Mutants of Human Malaria Parasite P. falciparum

We describe a method for generating glmS-based conditional knockdown mutants in Plasmodium falciparum using CRISPR/Cas9 genome editing.

CRISPR/Cas9 gen düzenleme yapmak koşullu mutantlar, insan sıtma parazit P. falciparum için

Malaria is a significant cause of morbidity and mortality worldwide. This disease, which primarily affects those living in tropical and subtropical ...

Endogenous Protein Tagging in Human Induced Pluripotent Stem Cells Using CRISPR/Cas9

A protocol is presented for generating human induced pluripotent stem cells (hiPSCs) that express endogenous proteins fused to in-frame&#160;N- or C-terminal fluorescent tags. The prokaryotic CRISPR/Cas9 system (clustered regularly interspaced short palindromic repeats/CRISPR-associated 9) may be used to introduce large exogenous sequences into genomic loci via homology directed repair (HDR). To achieve the desired knock-in, this protocol employs the ribonucleoprotein (RNP)-based approach where wild type Streptococcus pyogenes Cas9 protein, synthetic 2-part guide RNA (gRNA), and a donor template plasmid are delivered to the cells via electroporation. Putatively edited cells expressing the fluorescently tagged proteins are enriched by fluorescence activated cell sorting (FACS). Clonal lines are then generated and can be analyzed for precise editing outcomes. By introducing the fluorescent tag at the genomic locus of the gene of interest, the resulting subcellular localization and dynamics of the fusion protein can be studied under endogenous regulatory control, a key improvement over conventional overexpression systems. The use of hiPSCs as a model system for gene tagging provides the opportunity to study the tagged proteins in diploid, nontransformed cells. Since hiPSCs can be differentiated into multiple cell types, this approach provides the opportunity to create and study tagged proteins in a variety of isogenic cellular contexts.

Described here is a protocol for tagging endogenously expressed proteins with fluorescent tags in human induced pluripotent stem cells using CRISPR/Cas9. Putatively edited cells are enriched by fluorescence activated cell sorting and clonal cell lines are generated.

Endojen Protein insan etiketleme Pluripotent kök hücre kullanarak CRISPR/Cas9 indüklenen

A protocol is presented for generating human induced pluripotent stem cells (hiPSCs) that express endogenous proteins fused to in-frame&#160;N- or ...

CRISPR/Cas9 Ribonucleoprotein-mediated Precise Gene Editing by Tube Electroporation

Gene editing nucleases, represented by CRISPR-associated protein 9 (Cas9), are becoming mainstream tools in biomedical research. Successful delivery of CRISPR/Cas9 elements into the target cells by transfection is a prerequisite for efficient gene editing. This protocol demonstrates that tube electroporation (TE) machine-mediated delivery of CRISPR/Cas9 ribonucleoprotein (RNP), along with single-stranded oligodeoxynucleotide (ssODN) donor templates to different types of mammalian cells, leads to robust precise gene editing events. First, TE was applied to deliver CRISPR/Cas9 RNP and ssODNs to induce disease-causing mutations in the interleukin 2 receptor subunit gamma (IL2RG) gene and sepiapterin reductase (SPR) gene in rabbit fibroblast cells. Precise mutation rates of 3.57%-20% were achieved as determined by bacterial TA cloning sequencing. The same strategy was then used in human iPSCs on several clinically relevant genes including epidermal growth factor receptor (EGFR), myosin binding protein C, cardiac (Mybpc3), and hemoglobin subunit beta (HBB). Consistently, highly precise mutation rates were achieved (11.65%-37.92%) as determined by deep sequencing (DeepSeq). The present work demonstrates that tube electroporation of CRISPR/Cas9 RNP represents an efficient transfection protocol for gene editing in mammalian cells.

Presented here is a protocol for efficient CRISPR/Cas9 ribonucleoprotein-mediated gene editing in mammalian cells using tube electroporation.

CRISPR/Cas9 ribonucleoprotein-boru Elektroporasyon tarafından aracılı hassas gen düzenleme

Gene editing nucleases, represented by CRISPR-associated protein 9 (Cas9), are becoming mainstream tools in biomedical research. Successful delivery of ...

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

Trypanosoma cruzi is a pathogenic protozoan parasite that causes Chagas&#8217; disease mainly in Latin America. In order to identify a novel drug target against T. cruzi, it is important to validate the essentiality of the target gene in the mammalian stage of the parasite, the amastigote. Amastigotes of T. cruzi replicate inside the host cell; thus, it is difficult to conduct a knockout experiment without going through other developmental stages. Recently, our group reported a growth condition in which the amastigote can replicate axenically for up to 10 days without losing its amastigote-like properties. By using this temporal axenic amastigote culture, we successfully introduced gRNAs directly into the Cas9-expressing amastigote to cause gene knockouts and analyzed their phenotypes exclusively in the amastigote stage. In this report, we describe a detailed protocol to produce in vitro derived extracellular amastigotes, and to utilize the axenic culture in a CRISPR/Cas9-mediated knockout experiment. The growth phenotype of knockout amastigotes can be evaluated either by cell counts of the axenic culture, or by replication of intracellular amastigote after host cell invasion. This method bypasses the parasite stage differentiation normally involved in producing a transgenic or a knockout amastigote. Utilization of the temporal axenic amastigote culture has the potential to expand the experimental freedom of stage-specific studies in T. cruzi.

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

Here, we describe a protocol to introduce a gene knockout into the extracellular amastigote of Trypanosoma cruzi, using the CRISPR/Cas9 system. The growth phenotype can be followed up either by cell counting of axenic amastigote culture or by proliferation of intracellular amastigotes after host cell invasion.

CRISPR/Cas9 sistemi kullanılarak Trypanosoma cruzi 'Nin Amastigote aşamasına doğrudan bir gene Knockout tanıtımı

Trypanosoma cruzi is a pathogenic protozoan parasite that causes Chagas&#8217; disease mainly in Latin America. In order to identify a novel drug target ...

CRISPR-Cas9-Mediated Genome Editing in the Filamentous Ascomycete Huntiella omanensis

The CRISPR-Cas9 genome editing system is a molecular tool that can be used to introduce precise changes into the genomes of model and non-model species alike. This technology can be used for a variety of genome editing approaches, from gene knockouts and knockins to more specific changes like the introduction of a few nucleotides at a targeted location. Genome editing can be used for a multitude of applications, including the partial functional characterization of genes, the production of transgenic organisms and the development of diagnostic tools. Compared to previously available gene editing strategies, the CRISPR-Cas9 system has been shown to be easy to establish in new species and boasts high efficiency and specificity. The primary reason for this is that the editing tool uses an RNA molecule to target the gene or sequence of interest, making target molecule design straightforward, given that standard base pairing rules can be exploited. Similar to other genome editing systems, CRISPR-Cas9-based methods also require efficient and effective transformation protocols as well as access to good quality sequence data for the design of the targeting RNA and DNA molecules. Since the introduction of this system in 2013, it has been used to genetically engineer a variety of model species, including Saccharomyces cerevisiae, Arabidopsis thaliana, Drosophila melanogaster and Mus musculus. Subsequently, researchers working on non-model species have taken advantage of the system and used it for the study of genes involved in processes as diverse as secondary metabolism in fungi, nematode growth and disease resistance in plants, among many others. This protocol detailed below describes the use of the CRISPR-Cas9 genome editing protocol for the truncation of a gene involved in the sexual cycle of Huntiella omanensis, a filamentous ascomycete fungus belonging to the Ceratocystidaceae family.

CRISPR-Cas9-Mediated Genome Editing in the Filamentous Ascomycete Huntiella omanensis

The CRISPR-Cas9 genome editing system is an easy-to-use genome editor that has been used in model and non-model species. Here we present a protein-based version of this system that was used to introduce a premature stop codon into a mating gene of a non-model filamentous ascomycete fungus.

Filamentöz Ascomycete Huntiella omanensis'te CRISPR-Cas9 Aracılı Genom Düzenleme

The CRISPR-Cas9 genome editing system is a molecular tool that can be used to introduce precise changes into the genomes of model and non-model species ...

Sand Fly (Phlebotomus papatasi) Embryo Microinjection for CRISPR/Cas9 Mutagenesis

Sand flies are the natural vectors for Leishmania species, protozoan parasites producing a broad spectrum of symptoms ranging from cutaneous lesions to visceral pathology. Deciphering the nature of the vector/parasite interactions is of primary importance for better understanding of Leishmania transmission to their hosts. Among the parameters controlling the sand fly vector competence (i.e. their ability to carry and transmit pathogens), parameters intrinsic to these insects were shown to play a key role. Insect immune response, for example, impacts sand fly vector competence to Leishmania. The study of such parameters has been limited by the lack of methods of gene expression modification adapted for use in these non-model organisms. Gene downregulation by small interfering RNA (siRNA) is possible, but in addition to being technically challenging, the silencing leads to only a partial loss of function, which cannot be transmitted from generation to generation. Targeted mutagenesis by CRISPR/Cas9 technology was recently adapted to the Phlebotomus papatasi sand fly. This technique leads to the generation of transmissible mutations in a specifically chosen locus, allowing to study the genes of interest. The CRISPR/Cas9 system relies on the induction of targeted double-strand DNA breaks, later repaired by either Non-Homologous End Joining (NHEJ) or by Homology Driven Repair (HDR). NHEJ consists of a simple closure of the break and frequently leads to small insertion/deletion events. In contrast, HDR uses the presence of a donor DNA molecule sharing homology with the target DNA as a template for repair. Here, we present a sand fly embryo microinjection method for targeted mutagenesis by CRISPR/Cas9 using NHEJ, which is the only genome modification technique adapted to sand fly vectors to date.

Sand Fly Phlebotomus papatasi Embryo Microinjection for CRISPR/Cas9 Mutagenesis

This protocol details the steps of CRISPR/Cas9 targeted mutagenesis in sand flies: embryo collection, injection, insect rearing, and identification as well as selection of mutations of interest.

CRISPR/Cas9 Mutagenesis için Kum Sineği (Phlebotomus papatasi) Embriyo Mikroenjeksiyonu

Sand flies are the natural vectors for Leishmania species, protozoan parasites producing a broad spectrum of symptoms ranging from cutaneous lesions to ...