Name: combining optogenetics with artificial micrornas to characterize the effects of gene knockdown on presynaptic function within intact neuronal circuits
Uploaded: 2018-03-14T14:30:00.000+00:00
Duration: 9 min 17 s
Description: Watch this Scientific Journal Video about Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits at JoVE

Biz F. Benfenati (Istituto Italiano di teknoloji, IIT) destek ve Carmela Vitale için gösteri ile yardımcı olduğunuz için teşekkür ederiz. Bu eser IIT ve Compagnia San Paolo (hibe No 9734 LAC) tarafından finanse edildi.

<ol>
	<li>Lam, J. K., Chow, M. Y., Zhang, Y., Leung, S. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=siRNA+Versus+miRNA+as+Therapeutics+for+Gene+Silencing.">siRNA Versus miRNA as Therapeutics for Gene Silencing.</a> Mol Ther-Nucl Acids. 4, e252 (2015).</li><li>Kohl, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemisphere-specific+optogenetic+stimulation+reveals+left-right+asymmetry+of+hippocampal+plasticity.">Hemisphere-specific optogenetic stimulation reveals left-right asymmetry of hippocampal plasticity.</a> Nat Neurosci. 14 (11), 1413-1415 (2011).</li><li>Maejima, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Postnatal+loss+of+P/Q-type+channels+confined+to+rhombic-lip-derived+neurons+alters+synaptic+transmission+at+the+parallel+fiber+to+purkinje+cell+synapse+and+replicates+genomic+Cacna1a+mutation+phenotype+of+ataxia+and+seizures+in+mice.">Postnatal loss of P/Q-type channels confined to rhombic-lip-derived neurons alters synaptic transmission at the parallel fiber to purkinje cell synapse and replicates genomic Cacna1a mutation phenotype of ataxia and seizures in mice.</a> J Neurosci. 33 (12), 5162-5174 (2013).</li><li>Mark, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delayed+postnatal+loss+of+P/Q-type+calcium+channels+recapitulates+the+absence+epilepsy,+dyskinesia,+and+ataxia+phenotypes+of+genomic+Cacna1a+mutations.">Delayed postnatal loss of P/Q-type calcium channels recapitulates the absence epilepsy, dyskinesia, and ataxia phenotypes of genomic Cacna1a mutations.</a> J Neurosci. 31 (11), 4311-4326 (2011).</li><li>Thalhammer, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+Splicing+of+P/Q-Type+Ca2++Channels+Shapes+Presynaptic+Plasticity.">Alternative Splicing of P/Q-Type Ca2+ Channels Shapes Presynaptic Plasticity.</a> Cell Rep. 20 (2), 333-343 (2017).</li><li>Sambrook, J., Russell, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium-phosphate-mediated+Transfection+of+Eukaryotic+Cells+with+Plasmid+DNAs.">Calcium-phosphate-mediated Transfection of Eukaryotic Cells with Plasmid DNAs.</a> CSH Protoc. 2006 (1), (2006).</li><li>Chung, K. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polycistronic+RNA+polymerase+II+expression+vectors+for+RNA+interference+based+on+BIC/miR-155.">Polycistronic RNA polymerase II expression vectors for RNA interference based on BIC/miR-155.</a> Nucleic Acids Res. 34 (7), e53 (2006).</li><li>McClure, C., Cole, K. L., Wulff, P., Klugmann, M., Murray, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+and+titering+of+recombinant+adeno-associated+viral+vectors.">Production and titering of recombinant adeno-associated viral vectors.</a> J Vis Exp. (57), e3348 (2011).</li><li>Cingolani, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activity-dependent+regulation+of+synaptic+AMPA+receptor+composition+and+abundance+by+beta3+integrins.">Activity-dependent regulation of synaptic AMPA receptor composition and abundance by beta3 integrins.</a> Neuron. 58 (5), 749-762 (2008).</li><li>Huang, H., Xu, Y., Cheng, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+alternative+splicing+during+epithelial-mesenchymal+transition.">Detection of alternative splicing during epithelial-mesenchymal transition.</a> J Vis Exp. (92), e51845 (2014).</li><li>Vandesompele, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accurate+normalization+of+real-time+quantitative+RT-PCR+data+by+geometric+averaging+of+multiple+internal+control+genes.">Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes.</a> Genome Biol. 3 (7), (2002).</li><li>Cetin, A., Komai, S., Eliava, M., Seeburg, P. H., Osten, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stereotaxic+gene+delivery+in+the+rodent+brain.">Stereotaxic gene delivery in the rodent brain.</a> Nat Protoc. 1 (6), 3166-3173 (2006).</li><li>Paxinos, G., Franklin, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Mouse Brain in Stereotaxic Coordinates. , (2012).</li><li>Paxinos, G., Watson, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Rat Brain in Stereotaxic Coordinates. , (2013).</li><li>Gunaydin, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrafast+optogenetic+control.">Ultrafast optogenetic control.</a> Nat Neurosci. 13 (3), 387-392 (2010).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Splicing+of+alpha+1A+subunit+gene+generates+phenotypic+variants+of+P-+and+Q-type+calcium+channels.">Splicing of alpha 1A subunit gene generates phenotypic variants of P- and Q-type calcium channels.</a> Nat Neurosci. 2 (5), 407-415 (1999).</li><li>Chaudhuri, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+splicing+as+a+molecular+switch+for+Ca2+/calmodulin-dependent+facilitation+of+P/Q-type+Ca2++channels.">Alternative splicing as a molecular switch for Ca2+/calmodulin-dependent facilitation of P/Q-type Ca2+ channels.</a> J Neurosci. 24 (28), 6334-6342 (2004).</li><li>Soong, T. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+splice+variants+in+human+P/Q-type+channel+alpha1(2.1)+subunits:+implications+for+current+density+and+Ca2+-dependent+inactivation.">Systematic identification of splice variants in human P/Q-type channel alpha1(2.1) subunits: implications for current density and Ca2+-dependent inactivation.</a> J Neurosci. 22 (23), 10142-10152 (2002).</li><li>Berndt, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+channelrhodopsins+for+fast+neuronal+stimulation+at+low+light+levels.">High-efficiency channelrhodopsins for fast neuronal stimulation at low light levels.</a> P Natl Acad Sci USA. 108 (18), 7595-7600 (2011).</li><li>Klapoetke, N. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Independent+optical+excitation+of+distinct+neural+populations.">Independent optical excitation of distinct neural populations.</a> Nat Methods. 11 (3), 338-346 (2014).</li><li>Lin, J. Y., Lin, M. Z., Steinbach, P., Tsien, R. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+engineered+channelrhodopsin+variants+with+improved+properties+and+kinetics.">Characterization of engineered channelrhodopsin variants with improved properties and kinetics.</a> Biophys J. 96 (5), 1803-1814 (2009).</li><li>Zhang, Y. P., Oertner, T. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+induction+of+synaptic+plasticity+using+a+light-sensitive+channel.">Optical induction of synaptic plasticity using a light-sensitive channel.</a> Nat Methods. 4 (2), 139-141 (2007).</li><li>Fowler, D. K., Williams, C., Gerritsen, A. T., Washbourne, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+knockdown+from+artificial+microRNAs+in+an+enhanced+miR-155+backbone:+a+designer's+guide+to+potent+multi-target+RNAi.">Improved knockdown from artificial microRNAs in an enhanced miR-155 backbone: a designer's guide to potent multi-target RNAi.</a> Nucleic Acids Res. 44 (5), e48 (2016).</li></ol>

Yazarlar ifşa gerek yok.

Bir optogenetic sonda ve miR ilgi presynaptic bir gen karşı ortak ifadesi gen nakavt etkisi presynaptic işlev içinde sağlam nöronal devreler karakterize etmek için güçlü bir yaklaşım sunmaktadır. Bu deneysel yaklaşım için tanımlamak ve son derece verimli ve yerel sistemler ilgi gen aşağı knocking seçici miRs karakterize önemlidir. Mümkünse, iki veya daha fazla bağımsız miRs ilgi aynı mRNA karşı kontrol etmek için nihai hedef kapalı efektleri kullanılmalıdır. Kurtarma deneyler, hangi miR dayanıklı bir gen sisteminde yeniden ortaya çıkar bir denetim olarak özgüllük için kullanılabilir.
Bir optogenetic ifade etmek için aynı yapıyı kullanarak sonda ve bir miR sağlar optik manipüle sadece presynaptic nöronlar uyarıcı için. Bu nedenle karışık ve seyreltilmiş sonuçlar üreten bulaşmış ve sigara enfekte nöronlar arasında ayrım yapmamak için bu elektrik elektrodlar ile mümkün değildir. Optik elektrodlar birden çok aksiyon potansiyelleri15neden olabilir çünkü bir genişleyen paleti15,19,20,21arasında sadece en hızlı optogenetic sondalar seçmek önemlidir. Buna ek olarak, optik stimülasyon presynaptic boutons doğrudan bir depolarizasyon teşvik değil, sinaptik iletimi adımlardan bazıları atlayarak önlemek için bir22araştırmak dilek sağlamak için önemlidir.
Biz burada, tarif deneysel yaklaşım paralel olarak sınırlı sürede (4-6 ay) birden çok presynaptic genler ilgi fizyolojik uygunluğunu değerlendirmek mümkün kılar. Ancak, nakavtlar nadiren % 100 ulaşmak aklınızda tutmanız önemlidir. Dahası, rAAVs maksimal devirme ve tam ifade bir süre sınırlaması ne zaman erken gelişimsel süreçleri soruşturma temsil edebilir optogenetic soruşturma için izin vermek en az iki hafta boyunca ifade edilmesi gerekir. Genellikle daha fazla zaman alıcı, koşullu nakavt fareler presynaptic nöronlar için sınırlı sonuçlanır rağmen faiz gen kaldırmayı tamamlamak ve bu nedenle geçerli tamamlayıcı bir yaklaşım sunuyoruz.
Birden fazla miRs aynı organizatörü üzerinden ifade sağlar miR teknolojinin belirli bir avantaj sağlıyor. Bu özellik, birden çok kopyasını aynı miR veya farklı miRs karşı aynı hedef gen ekleyerek devirme verimliliğini artırmak için esas olarak kullanılmıştır. Ancak olabilir karşı farklı hedef genlerin7,23miRs ifade ederek nakavt için birden çok gen kullanılıyor. Bu özellik presynaptic sinyal yolları incelemek için birden çok presynaptic proteinler susturmak için kullanılabilir olur.
Burada, akut Hipokampal dilimler presynaptic işlevinde gen nakavt etkilerini karakterize etmek için yapay miRs ile optogenetics birleştirdik. Benzer bir yaklaşım, değiştirmek ve nöronal devreler vivo içindeyoklama için de kullanılabilir. Buna ek olarak, yapay miRs chemogenetic ile birleştirerek yaklaşımlar bir uzun zaman ölçeklerde nöronal devreler sorgulamaya sağlayacak.

Bu iletişim kuralı gen nakavt etkisi presynaptic işlev içinde sağlam nöronal devreler karakterize etmek için yeni bir yaklaşım açıklar. Presynaptic işlevinde olduğu gibi nöronal devreler araştıran pek çok presynaptic boutons çok küçük olduğundan ve uzak kombine moleküler ve Elektrofizyolojik müdahaleler izin vermek için soma meydan okuyor. RNA müdahale devirme sinaptik proteinler1için güçlü ve esnek bir araç içerse bu yaklaşım idareli giriþi özelliðini kullanarak nakavt etkileri tespit etmek zordur çünkü presynaptic işlevi araştırmak için kullanılmıştır arasında ayrım yapmamak elektrik elektrodlar manipüle ve saf presynaptic boutons2. Burada, biz nasıl yapay mikroRNA (miR) birleştirmek açıklayın-akut beyin dilimleri içinde işlenmiş presynaptic boutons seçici uyarılması elde etmek için son zamanlarda geliştirilen optogenetic teknolojisi ile RNA müdahale aracılı.
Koşullu nakavt fareler Elektrofizyoloji ile birlikte aynı zamanda presynaptic proteinler3,4işlevi araştırmak için kullanılabilir gibi görünse, bizim strateji geliştirme ve bakım genetik olarak gerektirmez fare satırları değiştirilmiş ve aynı zamanda kolayca belirli bir gen izoformlarının vurmak için istihdam edilebilir. Göreli daha yaygın olarak kullanılan kısa saç tokası RNA'ların (shRNAs), biz burada istihdam, yapay miRs nöronlar içinde nakavt için önemli avantajlar sunuyoruz. ShRNAs, onlar bir polimeraz II organizatörü1kontrol altında ifade edilebilir. Böylece, tek bir organizatörü miR ve floresan bir muhabir ile birlikte bir optogenetic sonda ifadesi sürücü için kullanılabilir. Bu şekilde, yapı boyutu rekombinant adeno ilişkili virüs (rAAV, şekil 1A) ambalaj sınırları içinde tutulabilir. Ayrıca, miR, optogenetic sonda ve sabit bir oranda floresan muhabir ifadesi izin veren bir yayın için tek bir yapı ve tek bir organizatörü kullanımı deneysel değişkenliği azaltır.
Son zamanlarda presynaptic kalsiyum kanal Hipokampus5alternatif olarak spliced izoformlarının rolünü incelemek için bu teknolojiyi başvurdum. Bu tür bir strateji genellikle fizyolojik alaka ilgi herhangi bir beyin devre presynaptically ifade diğer proteinlerin eğitim için geçerlidir.

<table><tbody><tr><td>Acrylamide</td><td>Sigma</td><td>Acrylamide/Bis-acrylamide, 30% solution</td><td>Toxic</td></tr><tr><td>Animal Temperature Controller with heat pad</td><td>WPI</td><td>ATC2000</td><td></td></tr><tr><td>BCA protein assay kit</td><td>ThermoFisher Scientific</td><td>23225</td><td></td></tr><tr><td>BLOCK-iT Pol II miR RNAi Expression Vector kit</td><td>ThermoFisher Scientific</td><td>K4936-00</td><td></td></tr><tr><td>Brain slices Prechamber</td><td>Harvard Apparatus</td><td>BSC-PC</td><td></td></tr><tr><td>CCD camera-based imager</td><td>Bio-Rad</td><td>ChemiDoc&amp;trade; MP</td><td></td></tr><tr><td>Cell Culture reagents</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Chemiluminescent substrate</td><td>GE Helthcare</td><td>ECL Western Blotting Reagents, RPN2106</td><td></td></tr><tr><td>Chloroform</td><td>Sigma</td><td>C2432</td><td>Toxic</td></tr><tr><td>Cytosine &amp;beta;-D-arabinofuranoside</td><td>Sigma</td><td>C6645</td><td></td></tr><tr><td>Drill</td><td>Foredom</td><td>K.1030</td><td></td></tr><tr><td>EGTA</td><td>Sigma</td><td>E4378</td><td></td></tr><tr><td>Gentamicin ointment</td><td>Local pharmacy</td><td></td><td></td></tr><tr><td>Glucose</td><td>Sigma</td><td>G7021</td><td></td></tr><tr><td>Hepes</td><td>Sigma</td><td>54459</td><td></td></tr><tr><td>Injection micropipettes</td><td>Narishige</td><td>GD1</td><td></td></tr><tr><td>Inorganic salts &amp;amp; detergents</td><td>Sigma</td><td></td><td></td></tr><tr><td>K&lt;sub&gt;2&lt;/sub&gt;-creatine phosphate</td><td>Calbiochem</td><td>237911</td><td></td></tr><tr><td>KGluconate</td><td>Fluka</td><td>60245</td><td></td></tr><tr><td>Laser</td><td>Laserglow Technologies</td><td>LRS-0473-GFM-00100-03</td><td></td></tr><tr><td>Membrane</td><td>Amersham</td><td>Protran&amp;trade; 0.2 &amp;micro;m NC</td><td></td></tr><tr><td>MgATP</td><td>Sigma</td><td>A9187</td><td></td></tr><tr><td>Micropipette holder</td><td>Narishige</td><td>IM-H1</td><td></td></tr><tr><td>Micropipette puller</td><td>Narishige</td><td>PC-100</td><td></td></tr><tr><td>Na&lt;sub&gt;3&lt;/sub&gt;GTP</td><td>Sigma</td><td>G8877</td><td></td></tr><tr><td>NaPyruvate</td><td>Sigma</td><td>P5280</td><td></td></tr><tr><td>Ocular lubricant</td><td>Local pharmacy</td><td>Lacrigel</td><td></td></tr><tr><td>Phosphate inhibitors</td><td>Sigma</td><td>P0044, P5726</td><td></td></tr><tr><td>Protease inhibitors</td><td>Sigma</td><td>cOmplete&amp;trade;, EDTA-free Protease Inhibitor Cocktail</td><td></td></tr><tr><td>Protein gel electrophoresis and blotting devices</td><td>Bio-Rad</td><td>Mini-Protean III Cell</td><td></td></tr><tr><td>Providone iodine</td><td>Local pharmacy</td><td>Betadine</td><td></td></tr><tr><td>Qiazol Lysis Reagent</td><td>Qiagen</td><td>79306</td><td>Toxic</td></tr><tr><td>QuantiTect Reverse&lt;br/&gt; Transcription Kit</td><td>Qiagen</td><td>205311</td><td></td></tr><tr><td>RNeasy Micro Kit</td><td>Qiagen</td><td>74004</td><td></td></tr><tr><td>Spectrophotometer</td><td>ThermoFisher Scientific</td><td>Nanodrop 2000</td><td></td></tr><tr><td>Stereotactic apparatus</td><td>WPI</td><td></td><td></td></tr><tr><td>Tetrodotoxin</td><td>Tocris</td><td>1069</td><td>Toxic</td></tr><tr><td>Vibratome</td><td>Leica</td><td>VT1200S</td><td></td></tr></tbody></table>

combining optogenetics with artificial micrornas to characterize the effects of gene knockdown on presynaptic function within intact neuronal circuits

Bu iletişim kuralı gen nakavt etkisi presynaptic işlev içinde sağlam nöronal devreler karakterize amacıdır. Biz nasıl yapay mikroRNA (miR) birleştirmek için bir iş akışı tarif-RNA müdahale ile optogenetics akut beyin dilimleri içinde işlenmiş presynaptic boutons seçici uyarılması ulaşmak için aracılık. Deneysel bir tek viral yapı ve bir optogenetic sonda ve yapay miR(s) presynaptic gene(s) karşı ifade sürücü için tek bir nöron özel organizatörü kullanımını gerektirir. Stereotactically faiz beyin bölgesi enjekte edildiğinde ifade yapısı ışıkla sadece nöronlar gene(s) soruşturma altında azaltılmış ifade ile teşvik olanak sağlar. Bu strateji geliştirme ve genetiği değiştirilmiş fare satırlarının Bakım gerektirmez ve diğer organizmalar ve nöronal herhangi bir gen seçim için prensip olarak uygulanabilir. Biz son zamanlarda nasıl CA3 adlı kısa vadeli sinaptik plastisite CA1 eksitatör sinapslarda akut Hipokampal dilimleri içinde için alternatif splice izoformlarının presynaptic P/Q-tipi voltaj kalsiyum kanal (VGCCs) nakavt düzenleyen araştırmak için başvurdum. Benzer bir yaklaşım, değiştirmek ve nöronal devresi içinde vivoyoklama için de kullanılabilir.

Yukarıda açıklanan yordamlar nasıl sinaptik iletimi değerlendirmek için sağlam bir yöntem presynaptic nöronlar sinaptik proteinlerin nakavt etkiler sağlar. Nasıl alternatif nakavt splice izoformlarının presynaptic Cav2.1 temsilcisi sonuçlarında (P/Q-tipi) VGCCs CA3 CA1 eksitatör sinapslarda örnek olarak aşağıda verilmiştir için kısa vadeli sinaptik plastisite düzenlemektedir.
CAv2.1 (P/S-type) kanallar vardır, merkezi sinir sistemi içinde en hızlı sinapslarda baskın presynaptic VGCCs. Alternatif Uçbirleştirme dışlayan ekzonlar 37a ve 37b bir gözenek oluşturan α1 alt Cav2.1 (α1A) birimi üreten iki ana çeşidi, Cav2.1 [EFa] ve Cav2.1 [EFb]16,17 ,18. CAv2.1 [EFa] ve Cav2.1 [EFb] differentially sinaptik iletimi ve sıçan Hipokampal piramidal nöronların plastisite düzenleyen olup olmadığını belirlemek için ilk izoformu özgü miRs nakavt için seçmeli olarak geliştirdiğimiz Cav 2.1 [EFa] veya Cav2.1 [EFb]5. Kısa boyutuna karşın (97 bp) ve yüksek benzerliği (%61.86 kimlik nükleotit düzeyinde) arasında ekzonlar 37a 37b, biz tasarım ve üç miR dizileri karşı Cav2.1 [EFa] fare (miR EFa1: TCCTTATAGTGAATGCGGCCG; miR EFa2: ATGTCCTTATAGTGAATGCGG; miR EFa3: TTGCAAGCAACCCTATGAGGA) ve iki fare Cav2.1 [EFb] karşı (miR EFb1: ATACATGTCCGGGTAAGGCAT; miR EFb2: ATCTGATACATGTCCGGGTAA) öngörülen yüksek devirme verimlilik ile. (MiR denetim) negatif kontrol bilinen herhangi bir omurgalı gen hedef değil bir sıra içeren pcDNA6.2-GW/EmGFP-miR-negatif plazmid kullandık. İlk ekran Contegra kanalları karşı HEK 293 hücrelerdeki bağlı olarak, seçili miR EFa1, miR EFa3 ve miR EFb2 ve içine 3' UTR rAAVs üretimi için tasarlanmış vektör pAAV-Syn-ChETA-TdT-miR-X, onların ifade kaset klonlanmış ve nerede synapsin organizatörü ultrafast channelrhodopsin ChETA, kırmızı floresan protein TdTomato ve eklenen miR (şekil 1) ifade ediyor. Biz de miR bu miR devirme verimliliğini artırmak için EFb2 ve ifade kaset çoğaltılamaz.
Ardından, rAAV1/2 yukarıdaki dört yapıları için hazırlanan ve devirme etkinlik ve seçicilik izoformu özgü qRT-PCR kullanarak birincil fare nöronal kültürlerde sayılabilir. miR EFb mRNA yerel Cav2.1 [EFb] ~ 60 oranında ama bu Cav2.1 [EFa] (Şekil 2) azaltılmış iken miR EFa1 ve miR EFa3 mRNA yerel Cav%2.1 ~ 70 [EFa] ama bu Cav2.1 [EFb], azaltılmış.
Biz daha sonra stereotactically her biri dört rAAV1/2 P18 fareler (şekil 3A-C), Hipokampus CA3 alanına (A-P/M-L/D-V Bregma gelen) −2.6 koordinatları ile enjekte / ± 2.9 / −2.9. On beş yirmi dört gün sonrası enjeksiyon, akut Hipokampal dilimler rAAV1/2-Injected sıçanlarından emir hazırlanmış ve TdTomato floresan ifade ve rAAVs (3B rakam) lokalizasyonu onaylamak için kullanılan. Presynaptic nakavt [EFb] Cav2.1 [EFa] veya Cav2.1 CA3 adlı kısa vadeli sinaptik plastisite CA1 sinapslarda için etkilenen olup olmadığını araştırmak için biz seçmeli olarak enfekte CA3 nöronlar kısa 473 nm lazer ışık darbeleri (2 ms-uzun ile uyarılmış ; Şekil 3 c) ve piramidal nöronların proksimal medial yolu CA1 bölgesinin (şekil 3 c) için yama tarafından elde edilen EPSCs kaydedildi. Cav2.1 splice izoformlarının nakavt yanıt için eşleştirilmiş-nabız stimülasyon ters yönde etkilenen bulduk: nakavt [EFa] (miR EFa1 veya miR EFa3) Cav2.1 artırdığını eşleştirilmiş-nabız kolaylaştırma (PPF) ise Ca'nın devirme v2.1 [EFb] (miR EFb2) o (şekil 3D, E) kaldırıldı.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57223/57223fig1.jpg"> Resim 1: Şeması yapıları ultrafast optogenetic sonda ChETA ve izoformu özgü miRs Cav2.1 [EFa] ve Cav2.1 [EFb] karşı kombine ifade için. (A) rAAV haritası oluşturmak pAAV-Syn-ChETA-TdT-miR-X, synapsin organizatörü (Syn) içeren, TdTomato ve içinde proksimal 3' UTR, bir Cav2.1 splice izoformu özgü miR ChETA ultrafast channelrhodopsin erimiş. Kısıtlama gösterilen tek kesiciler enzimlerdir. (B) en iyi, düzeni ifade kaset. Synapsin düzenleyici ChETA-TdTomato ve bir izoformu özgü miR ifade ediyor. Alt, miR kaset parçası 21-nükleotit hedef sıralarının geriye doğru tamamlayıcı. MiR EFb2 için iki özdeş miR kaset birbiri ardına bir tandem ifade edildi. <a href="//cloudflare.jove.com/files/ftp_upload/57223/57223fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57223/57223fig2.jpg"> Şekil 2. Devirme verimliliği ve izoformu özgü miRs Cav2.1 [EFa] ve Cav2.1 [EFb] selectivity değerlendirilmesi. 17-18 DIV birincil kültürler 6 DIV ya Cav2.1 [EFa] (miR EFa1 ve miR EFa3) hedefleme miRs ifade rAAVs ile enfekte izole RNA izoformu özgü qRT-PCR analiz veya Cav2.1 [EFb] (miR EFb2). Veri negatif kontrol (miR denetim) normalleştirilmiş. miR EFa1 miR EFa3 önemli ölçüde ve seçmeli olarak azaltmak ve mRNA Cav2.1 [EFa] (n = 8 ve 7 kültürleri, sırasıyla), miR EFb önemli ölçüde ve seçmeli olarak azaltır [EFb] mRNA Cav2.1 iken (n 4 kültürler; = *** p < 0,001; tek yönlü analizi Varyans testi) Tukey Kramer sonrası test tarafından takip. Veri ± SEM demek olarak sunulan Bu rakam Thalhammer, A. ve ark. adapte edilmiş 5. <a href="//cloudflare.jove.com/files/ftp_upload/57223/57223fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57223/57223fig3.jpg"> Şekil 3. Rolü Cav2.1 [EFa] ve Cav2.1 [EFb] tarafından yerel Hipokampus değerlendirirken hedef çaldı aşağı nöronlar optogenetics ile uyarılması. Vivo enfeksiyonu için kullanılan rAAV yapıları ve ifade kaset (A) şeması. ((B)) Hipokampal bölümünde gösterilen TdTomato floresan CA3 bölge ve onun projeksiyonlar ile sınırlıdır. (C) deneysel yapılandırma: lazer ışını CA3 somata Yönetmen: ve yama kelepçe kayıtları CA1 piramidal nöronların gerçekleştirilen. (D) 2 ms-uzun mavi (473 nm) lazer ışık darbeleri 20 Hz parlıyordu uyandırmak kimin PPF Cav2.1 [EFa] hedefleme miRs tarafından arttı ve miR Cav2.1 [EFb] tarafından kaldırılmış EPSCs. (E) gösterilen bir artış miR denetim göreli PPF miR EFa1 ve miR EFa3 ve bir düşüş miR EFb2, için için özetini eşleştirilmiş-nabız oranı (D), olduğu gibi deneyler için (n = 9-11 kayıtları; * p 0,02; = ** p = 0,01; *** p < 0.0004; Kovaryans analizi). Veri ± SEM demek olarak sunulan Bu rakam Thalhammer, A. ve ark. adapte edilmiş 5. <a href="//cloudflare.jove.com/files/ftp_upload/57223/57223fig3large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>

Watch this Scientific Journal Video about Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits at JoVE

Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits

Bu iletişim kuralı, yapay mikroRNA aracılı RNA müdahale optogenetics özellikle presynaptic boutons selektif gene(s) sağlam nöronal devreler içinde azaltılmış ifade ile uyarmak için birleştirmek bir iş akışı sağlar.

Optogenetics gen nakavt etkileri olduğu gibi nöronal devreler içinde Presynaptic işlevi karakterize etmek için yapay mikroRNA'lar birleştirme

The purpose of this protocol is to characterize the effect of gene knockdown on presynaptic function within intact neuronal circuits. We describe a ...

combining-optogenetics-with-artificial-micrornas-to-characterize

Nanyang Technological University

Research

JoVE Journal

Neuroscience

10.1K Görüntüleme.  Istituto Italiano di Tecnologia. Bu iletişim kuralı, yapay mikroRNA aracılı RNA müdahale optogenetics özellikle presynaptic boutons selektif gene(s) sağlam nöronal devreler içinde azaltılmış ifade ile uyarmak için birleştirmek bir iş akışı sağlar.

Video: Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits

Stereotactic Injection of MicroRNA-expressing Lentiviruses to the Mouse Hippocampus CA1 Region and Assessment of the Behavioral Outcome

MicroRNAs (miRNAs) are small regulatory single-stranded RNA molecules around 22 nucleotides long that may each target numerous mRNA transcripts and dim an entire gene expression pathway by inducing destruction and/or inhibiting translation of these targets. Several miRNAs play key roles in maintaining neuronal structure and function and in higher-level brain functions, and methods are sought for manipulating their levels for exploring these functions. Here, we present a direct in vivo method for examining the cognitive consequences of enforced miRNAs excess in mice by stereotactic injection of miRNA-encoding virus particles. Specifically, the current protocol involves injection into the hippocampal CA1 region, which contributes to mammalian memory consolidation, learning, and stress responses, and offers a convenient injection site. The coordinates are measured according to the mouse bregma and virus perfusion is digitally controlled and kept very slow. After injection, the surgery wound is sealed and the animals recover. Lentiviruses encoding silencers of the corresponding mRNA targets serve to implicate the specific miRNA/target interaction responsible for the observed effect, with na&iuml;ve mice, mice injected with saline and mice injected with "empty" lentivirus vectors as controls. One month post-injection, the animals are examined in the Morris Water Maze (MWM) for assessing their navigation learning and memory abilities. The MWM is a round tank filled with colored water with a small platform submerged 1 cm below the water surface. Steady visual cues around the tank allow for spatial navigation (sound and the earth's magnetic field may also assist the animals in navigating). Video camera monitoring enables measuring the route of swim and the time to find and amount the platform. The mouse is first taught that mounting the hidden platform offers an escape from the enforced swimming; it is then tested for using this escape and finally, the platform is removed and probe tests examine if the mouse remembers its previous location. Repeated tests over several consecutive days highlight improved performance of tested mice at shorter latencies to find and mount the platform, and as more direct routes to reach the platform or its location. Failure to show such improvement represents impaired learning and memory and/or anxiety, which may then be tested specifically (e.g. in the elevated plus maze). This approach enables validation of specific miRNAs and target transcripts in the studied cognitive and/or stress-related processes.

MicroRNAs have significant roles in brain structure and function. Here we describe a method to enforce hippocampal miRNA over-expression using stereotactic injection of an engineered miRNA-expressing lentivirus. This approach can serve as a relatively rapid way to assess the in vivo effects of over-expressed miRNAs in specific brain regions.

Bir Stereotaktik Enjeksiyon MicroRNA-ifade Fare Hippocampus CA1 Bölgesi Lentiviruses ve Davranış Sonuç Değerlendirilmesi

MicroRNAs (miRNAs) are small regulatory single-stranded RNA molecules around 22 nucleotides long that may each target numerous mRNA transcripts and dim an ...

Davranış

A Method for High Fidelity Optogenetic Control of Individual Pyramidal Neurons In vivo

Optogenetic methods have emerged as a powerful tool for elucidating neural circuit activity underlying a diverse set of behaviors across a broad range of species. Optogenetic tools of microbial origin consist of light-sensitive membrane proteins that are able to activate (e.g., channelrhodopsin-2, ChR2) or silence (e.g., halorhodopsin, NpHR) neural activity ingenetically-defined cell types over behaviorally-relevant timescales. We first demonstrate a simple approach for adeno-associated virus-mediated delivery of ChR2 and NpHR transgenes to the dorsal subiculum and prelimbic region of the prefrontal cortex in rat. Because ChR2 and NpHR are genetically targetable, we describe the use of this technology to control the electrical activity of specific populations of neurons (i.e., pyramidal neurons) embedded in heterogeneous tissue with high temporal precision. We describe herein the hardware, custom software user interface, and procedures that allow for simultaneous light delivery and electrical recording from transduced pyramidal neurons in an anesthetized in vivo preparation. These light-responsive tools provide the opportunity for identifying the causal contributions of different cell types to information processing and behavior.

A Method for High Fidelity Optogenetic Control of Individual Pyramidal Neurons In vivo

The recent development of neuroscience tools that combine genetics and optics, termed "optogenetics", enables control over neural circuit activity with an unprecedented level of spatial and temporal resolution. Here we provide a protocol for integrating in vivo recording with optogenetic manipulation of genetically-defined subsets of prefrontal cortical and subicular pyramidal neurons.

Bireysel piramidal nöronlar High Fidelity optogenetic Kontrolü için Bir Yöntem<em&gt; In vivo</em

Optogenetic methods  have emerged as a powerful tool for elucidating neural circuit activity  underlying a diverse set of behaviors across a broad range ...

Nörobilim

Laser-scanning Photostimulation of Optogenetically Targeted Forebrain Circuits

The sensory forebrain is composed of intricately connected cell types, of which functional properties have yet to be fully elucidated. Understanding the interactions of these forebrain circuits has been aided recently by the development of optogenetic methods for light-mediated modulation of neuronal activity. Here, we describe a protocol for examining the functional organization of forebrain circuits&#160;in vitro using laser-scanning photostimulation of channelrhodopsin, expressed optogenetically via viral-mediated transfection. This approach also exploits the utility of cre-lox recombination in transgenic mice to target expression in specific neuronal cell types. Following transfection, neurons are physiologically recorded in slice preparations using whole-cell patch clamp to measure their evoked responses to laser-scanning photostimulation of channelrhodopsin expressing fibers. This approach enables an assessment of functional topography and synaptic properties. Morphological correlates can be obtained by imaging the neuroanatomical expression of channelrhodopsin expressing fibers using confocal microscopy of the live slice or post-fixed tissue. These methods enable functional investigations of forebrain circuits that expand upon more conventional approaches.

We describe a method for characterizing the functional topography and synaptic properties of forebrain circuits using an optogenetic approach to photostimulate neuronal populations&#160;in vitro.

Optogenetically Hedeflenen Önbeyin Devreler Lazer tarama photostimulation

The sensory forebrain is composed of intricately connected cell types, of which functional properties have yet to be fully elucidated. Understanding the ...

Optogenetic Manipulation of Neuronal Activity to Modulate Behavior in Freely Moving Mice

Optogenetic modulation of neuronal circuits in freely moving mice affects acute and long-term behavior. This method is able to perform manipulations of single neurons and region-specific transmitter release, up to whole neuronal circuitries in the central nervous system, and allows the direct measurement of behavioral outcomes. Neurons express optogenetic tools via an injection of viral vectors carrying the DNA of choice, such as Channelrhodopsin2 (ChR2). Light is brought into specific brain regions via chronic optical implants that terminate directly above the target region. After two weeks of recovery and proper tool-expression, mice can be repeatedly used for behavioral tests with optogenetic stimulation of the neurons of interest.
Optogenetic modulation has a high temporal and spatial resolution that can be accomplished with high cell specificity, compared to the commonly used methods such as chemical or electrical stimulation. The light does not harm neuronal tissue and can therefore be used for long-term experiments as well as for multiple behavioral experiments in one mouse. The possibilities of optogenetic tools are nearly unlimited and enable the activation or silencing of whole neurons, or even the manipulation of a specific receptor type by light.
The results of such behavioral experiments with integrated optogenetic stimulation directly visualizes changes in behavior caused by the manipulation. The behavior of the same animal without light stimulation as a baseline is a good control for induced changes. This allows a detailed overview of neuronal types or neurotransmitter systems involved in specific behaviors, such as anxiety. The plasticity of neuronal networks can also be investigated in great detail through long-term stimulation or behavioral observations after optical stimulation. Optogenetics will help to enlighten neuronal signaling in several kinds of neurological diseases.

With optogenetic manipulation of specific neuronal populations or brain regions, behavior can be modified with high temporal and spatial resolution in freely moving animals. By using different optogenetic tools in combination with chronically implanted optical fibers, a variety of neuronal modulations and behavioral testing can be performed.

SerbestÇe Hareket Eden Farelerde Davranışı Modüle Etmek Için Nöronal Aktivitenin Optogenetik Manipülasyonu

Optogenetic modulation of neuronal circuits in freely moving mice affects acute and long-term behavior. This method is able to perform manipulations of ...

A Simple Alternative to Stereotactic Injection for Brain Specific Knockdown of miRNA

MicroRNAs (miRNAs) are key regulators of gene expression. In the brain, vital processes like neurodevelopment and neuronal functions depend on the correct expression of microRNAs. Perturbation of microRNAs in the brain can be used to model neurodegenerative diseases by modulating neuronal cell death. Currently, stereotactic injection is used to deliver miRNA knockdown agents to specific location in the brain. Here, we discuss strategies to design antagomirs against miRNA with locked nucleotide modifications (LNA). Subsequently describe a method for brain specific delivery of antagomirs, uniformly across different regions of the brain. This method is simple and widely applicable since it overcomes the surgery, associated injury and limitation of local delivery in stereotactic injections. We prepared a complex of neurotropic, cell-penetrating peptide Rabies Virus Glycoprotein (RVG) with antagomir against miRNA-29 and injected through tail vein, to specifically deliver in the brain. The antagomir design incorporated features that allow specific targeting of the miRNA and formation of non-covalent complexes with the peptide. The knock-down of the miRNA in neuronal cells, resulted in apoptotic cell death and associated behavioural defects. Thus, the method can be used for acute models of neuro-degeneration through the perturbation of miRNAs.

MicroRNAs play crucial roles in the brain and are potential targets for modeling neuro-degeneration. However, perturbing miRNA levels is challenging due to the short length of miRNA and inaccessibility of the brain tissue. This video presents a method for antagomir design and brain specific delivery using a neuropeptide in mice.

MiRNA Beyin Özgül demonte için Stereotaktik Injection Basit Alternatif

MicroRNAs (miRNAs) are key regulators of gene expression.  In the brain, vital processes like neurodevelopment and neuronal functions depend on the ...

Optogenetic Manipulation of Neural Circuits During Monitoring Sleep/wakefulness States in Mice

In recent years, optogenetics has been widely used in many fields of neuroscientific research. In many cases, an opsin, such as channel rhodopsin 2 (ChR2), is expressed by a virus vector in a particular type of neuronal cells in various Cre-driver mice. Activation of these opsins is triggered by application of light pulses which are delivered by laser or LED through optic cables, and the effect of activation is observed with very high time resolution. Experimenters are able to acutely stimulate neurons while monitoring behavior or another physiological outcome in mice. Optogenetics can enable useful strategies to evaluate function of neuronal circuits in the regulation of sleep/wakefulness states in mice. Here we describe a technique for examining the effect of optogenetic manipulation of neurons with a specific chemical identity during electroencephalogram (EEG) and electromyogram (EMG) monitoring to evaluate the sleep stage of mice. As an example, we describe manipulation of GABAergic neurons in the bed nucleus of the stria terminalis (BNST). Acute optogenetic excitation of these neurons triggers a rapid transition to wakefulness when applied during NREM sleep. Optogenetic manipulation along with EEG/EMG recording can be applied to decipher the neuronal circuits that regulate sleep/wakefulness states.

Here, we describe methods of optogenetic manipulation of particular types of neurons during monitoring of sleep/wakefulness states in mice, presenting our recent work on the bed nucleus of the stria terminalis as an example.

Farelerde uyku/uyanıklık durumları Izleme sırasında nöral devrelerin optogenetik manipülasyon

In recent years, optogenetics has been widely used in many fields of neuroscientific research. In many cases, an opsin, such as channel rhodopsin 2 ...

Assaying Circuit Specific Regulation of Adult Hippocampal Neural Precursor Cells

Adult neurogenesis is a dynamic process by which newly activated neural stem cells (NSCs) in the subgranular zone (SGZ) of the dentate gyrus (DG) generate new neurons, which integrate into an existing neural circuit and contribute to specific hippocampal functions. Importantly, adult neurogenesis is highly susceptible to environmental stimuli, which allows for activity-dependent regulation of various cognitive functions. A vast range of neural circuits from various brain regions orchestrates these complex cognitive functions. It is therefore important to understand how specific neural circuits regulate adult neurogenesis. Here, we describe a protocol to manipulate neural circuit activity using designer receptor exclusively activated by designer drugs (DREADDs) technology that regulates NSCs and newborn progeny in rodents. This comprehensive protocol includes stereotaxic injection of viral particles, chemogenetic stimulation of specific neural circuits, thymidine analog administration, tissue processing, immunofluorescence labeling, confocal imaging, and imaging analysis of various stages of neural precursor cells. This protocol provides detailed instructions on antigen retrieval techniques used to visualize NSCs and their progeny and describes a simple, yet effective way to modulate brain circuits using clozapine N-oxide (CNO) or CNO-containing drinking water and DREADDs-expressing viruses. The strength of this protocol lies in its adaptability to study a diverse range of neural circuits that influence adult neurogenesis derived from NSCs.

The goal of this protocol is to describe an approach for analyzing behavior of adult neural stem/progenitor cells in response to chemogenetic manipulation of a specific local neural circuit.

Yetişkin hipokampal sinirsel precursor hücrelerinin devre spesifik Yönetmeliği

Adult neurogenesis is a dynamic process by which newly activated neural stem cells (NSCs) in the subgranular zone (SGZ) of the dentate gyrus (DG) generate ...

Ex Vivo Optogenetic Interrogation of Long-Range Synaptic Transmission and Plasticity from Medial Prefrontal Cortex to Lateral Entorhinal Cortex

Studying the physiological properties of specific synapses in the brain, and how they undergo plastic changes, is a key challenge in modern neuroscience. Traditional in vitro electrophysiological techniques use electrical stimulation to evoke synaptic transmission. A major drawback of this method is its nonspecific nature; all axons in the region of the stimulating electrode will be activated, making it difficult to attribute an effect to a particular afferent connection. This issue can be overcome by replacing electrical stimulation with optogenetic-based stimulation. We describe a method for combining optogenetics with in vitro patch-clamp recordings. This is a powerful tool for the study of both basal synaptic transmission and synaptic plasticity of precise anatomically defined synaptic connections and is applicable to almost any pathway in the brain. Here, we describe the preparation and handling of a viral vector encoding channelrhodopsin protein for surgical injection into a pre-synaptic region of interest (medial prefrontal cortex) in the rodent brain and making of acute slices of downstream target regions (lateral entorhinal cortex). A detailed procedure for combining patch-clamp recordings with synaptic activation by light stimulation to study short- and long-term synaptic plasticity is also presented. We discuss examples of experiments that achieve pathway- and cell-specificity by combining optogenetics and Cre-dependent cell labeling. Finally, histological confirmation of the pre-synaptic region of interest is described along with biocytin labeling of the post-synaptic cell, to allow further identification of the precise location and cell type.

Ex Vivo Optogenetic Interrogation of Long-Range Synaptic Transmission and Plasticity from Medial Prefrontal Cortex to Lateral Entorhinal Cortex

Here we present a protocol describing viral transduction of discrete brain regions with optogenetic constructs to permit synapse-specific electrophysiological characterization in acute rodent brain slices.

Eski Vivo Medial Prefrontal Korteksten Lateral Entorinal Kortekse Uzun Menzilli Sinaptik İletim ve Plastisitenin Optogenetik Sorgulanması

Studying the physiological properties of specific synapses in the brain, and how they undergo plastic changes, is a key challenge in modern neuroscience. ...

Using Optogenetics to Reverse Neuroplasticity and Inhibit Cocaine Seeking in Rats

This protocol demonstrates the steps needed to use optogenetic tools to reverse cocaine-induced plasticity at thalamo-amygdala circuits to reduce subsequent cocaine seeking behaviors in the rat. In our research, we had found that when rats self-administer intravenous cocaine paired with an audiovisual cue, synapses formed at inputs from the medial geniculate nucleus of the thalamus (MGN) onto principal neurons of the lateral amygdala (LA) become stronger as the cue-cocaine association is learned. We hypothesized that reversal of the cocaine-induced plasticity at these synapses would reduce cue-motivated cocaine seeking behavior. In order to accomplish this type of neuromodulation in vivo, we wanted to induce synaptic long-term depression (LTD), which decreases the strength of MGN-LA synapses. To this end, we used optogenetics, which allows neuromodulation of brain circuits using light. The excitatory opsin oChiEF was expressed on presynaptic MGN terminals in the LA by infusing an AAV containing oChiEF into the MGN. Optical fibers were then implanted in the LA and 473 nm laser light was pulsed at a frequency of 1 Hz for 15 minutes to induce LTD and reverse cocaine induced plasticity. This manipulation produces a long-lasting reduction in the ability of cues associated with cocaine to induce drug seeking actions.

The methods described here outline a procedure used to optogenetically reverse cocaine-induced plasticity in a behaviorally-relevant circuit in rats. Sustained low-frequency optical stimulation of thalamo-amygdala synapses induces long-term depression (LTD). In vivo optogenetically-induced LTD in cocaine-experienced rats resulted in the subsequent attenuation of cue-motivated drug seeking.

Sıçanlarda Nöroplastisiteyi Tersine Çevirmek ve Kokain Arayışını Engellemek için Optogenetiği Kullanmak

This protocol demonstrates the steps needed to use optogenetic tools to reverse cocaine-induced plasticity at thalamo-amygdala circuits to reduce ...

Drosophila Optogenetics: A Method to Manipulate Neuronal Circuits

Source: de Vries, S. E., Clandinin, T. <a href="https://www.jove.com/video/50192/" target="_blank">Optogenetic Stimulation of Escape Behavior in Drosophila melanogaster</a>. J. Vis. Exp. (2013).
Optogenetics enables the use of light to manipulate neurons that are genetically engineered to express specific opsins&#8211;light-sensitive proteins whose light activation triggers a change in the state of the neuron. Here we describe an optogenetic approach in Drosophila using the opsin Channelrhodopsin2. The example protocol features an optogenetics assay set to study the neuronal circuitry behind the fly&#39;s escape behavior.

Drosophila Optogenetik: Nöronal Devreleri Manipüle Etmek İçin Bir Yöntem

Source: de Vries, S. E., Clandinin, T. Optogenetic Stimulation of Escape Behavior in Drosophila melanogaster. J. Vis. Exp. (2013).
Optogenetics enables ...