Biz F. Benfenati (Istituto Italiano di teknoloji, IIT) destek ve Carmela Vitale için gösteri ile yardımcı olduğunuz için teşekkür ederiz. Bu eser IIT ve Compagnia San Paolo (hibe No 9734 LAC) tarafından finanse edildi.

<ol>
	<li>Lam, J. K., Chow, M. Y., Zhang, Y., Leung, S. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=siRNA+Versus+miRNA+as+Therapeutics+for+Gene+Silencing.">siRNA Versus miRNA as Therapeutics for Gene Silencing.</a> Mol Ther-Nucl Acids. 4, e252 (2015).</li><li>Kohl, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemisphere-specific+optogenetic+stimulation+reveals+left-right+asymmetry+of+hippocampal+plasticity.">Hemisphere-specific optogenetic stimulation reveals left-right asymmetry of hippocampal plasticity.</a> Nat Neurosci. 14 (11), 1413-1415 (2011).</li><li>Maejima, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Postnatal+loss+of+P/Q-type+channels+confined+to+rhombic-lip-derived+neurons+alters+synaptic+transmission+at+the+parallel+fiber+to+purkinje+cell+synapse+and+replicates+genomic+Cacna1a+mutation+phenotype+of+ataxia+and+seizures+in+mice.">Postnatal loss of P/Q-type channels confined to rhombic-lip-derived neurons alters synaptic transmission at the parallel fiber to purkinje cell synapse and replicates genomic Cacna1a mutation phenotype of ataxia and seizures in mice.</a> J Neurosci. 33 (12), 5162-5174 (2013).</li><li>Mark, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delayed+postnatal+loss+of+P/Q-type+calcium+channels+recapitulates+the+absence+epilepsy,+dyskinesia,+and+ataxia+phenotypes+of+genomic+Cacna1a+mutations.">Delayed postnatal loss of P/Q-type calcium channels recapitulates the absence epilepsy, dyskinesia, and ataxia phenotypes of genomic Cacna1a mutations.</a> J Neurosci. 31 (11), 4311-4326 (2011).</li><li>Thalhammer, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+Splicing+of+P/Q-Type+Ca2++Channels+Shapes+Presynaptic+Plasticity.">Alternative Splicing of P/Q-Type Ca2+ Channels Shapes Presynaptic Plasticity.</a> Cell Rep. 20 (2), 333-343 (2017).</li><li>Sambrook, J., Russell, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium-phosphate-mediated+Transfection+of+Eukaryotic+Cells+with+Plasmid+DNAs.">Calcium-phosphate-mediated Transfection of Eukaryotic Cells with Plasmid DNAs.</a> CSH Protoc. 2006 (1), (2006).</li><li>Chung, K. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polycistronic+RNA+polymerase+II+expression+vectors+for+RNA+interference+based+on+BIC/miR-155.">Polycistronic RNA polymerase II expression vectors for RNA interference based on BIC/miR-155.</a> Nucleic Acids Res. 34 (7), e53 (2006).</li><li>McClure, C., Cole, K. L., Wulff, P., Klugmann, M., Murray, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+and+titering+of+recombinant+adeno-associated+viral+vectors.">Production and titering of recombinant adeno-associated viral vectors.</a> J Vis Exp. (57), e3348 (2011).</li><li>Cingolani, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activity-dependent+regulation+of+synaptic+AMPA+receptor+composition+and+abundance+by+beta3+integrins.">Activity-dependent regulation of synaptic AMPA receptor composition and abundance by beta3 integrins.</a> Neuron. 58 (5), 749-762 (2008).</li><li>Huang, H., Xu, Y., Cheng, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+alternative+splicing+during+epithelial-mesenchymal+transition.">Detection of alternative splicing during epithelial-mesenchymal transition.</a> J Vis Exp. (92), e51845 (2014).</li><li>Vandesompele, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accurate+normalization+of+real-time+quantitative+RT-PCR+data+by+geometric+averaging+of+multiple+internal+control+genes.">Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes.</a> Genome Biol. 3 (7), (2002).</li><li>Cetin, A., Komai, S., Eliava, M., Seeburg, P. H., Osten, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stereotaxic+gene+delivery+in+the+rodent+brain.">Stereotaxic gene delivery in the rodent brain.</a> Nat Protoc. 1 (6), 3166-3173 (2006).</li><li>Paxinos, G., Franklin, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Mouse Brain in Stereotaxic Coordinates. , (2012).</li><li>Paxinos, G., Watson, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Rat Brain in Stereotaxic Coordinates. , (2013).</li><li>Gunaydin, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrafast+optogenetic+control.">Ultrafast optogenetic control.</a> Nat Neurosci. 13 (3), 387-392 (2010).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Splicing+of+alpha+1A+subunit+gene+generates+phenotypic+variants+of+P-+and+Q-type+calcium+channels.">Splicing of alpha 1A subunit gene generates phenotypic variants of P- and Q-type calcium channels.</a> Nat Neurosci. 2 (5), 407-415 (1999).</li><li>Chaudhuri, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+splicing+as+a+molecular+switch+for+Ca2+/calmodulin-dependent+facilitation+of+P/Q-type+Ca2++channels.">Alternative splicing as a molecular switch for Ca2+/calmodulin-dependent facilitation of P/Q-type Ca2+ channels.</a> J Neurosci. 24 (28), 6334-6342 (2004).</li><li>Soong, T. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+splice+variants+in+human+P/Q-type+channel+alpha1(2.1)+subunits:+implications+for+current+density+and+Ca2+-dependent+inactivation.">Systematic identification of splice variants in human P/Q-type channel alpha1(2.1) subunits: implications for current density and Ca2+-dependent inactivation.</a> J Neurosci. 22 (23), 10142-10152 (2002).</li><li>Berndt, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+channelrhodopsins+for+fast+neuronal+stimulation+at+low+light+levels.">High-efficiency channelrhodopsins for fast neuronal stimulation at low light levels.</a> P Natl Acad Sci USA. 108 (18), 7595-7600 (2011).</li><li>Klapoetke, N. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Independent+optical+excitation+of+distinct+neural+populations.">Independent optical excitation of distinct neural populations.</a> Nat Methods. 11 (3), 338-346 (2014).</li><li>Lin, J. Y., Lin, M. Z., Steinbach, P., Tsien, R. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+engineered+channelrhodopsin+variants+with+improved+properties+and+kinetics.">Characterization of engineered channelrhodopsin variants with improved properties and kinetics.</a> Biophys J. 96 (5), 1803-1814 (2009).</li><li>Zhang, Y. P., Oertner, T. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+induction+of+synaptic+plasticity+using+a+light-sensitive+channel.">Optical induction of synaptic plasticity using a light-sensitive channel.</a> Nat Methods. 4 (2), 139-141 (2007).</li><li>Fowler, D. K., Williams, C., Gerritsen, A. T., Washbourne, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+knockdown+from+artificial+microRNAs+in+an+enhanced+miR-155+backbone:+a+designer's+guide+to+potent+multi-target+RNAi.">Improved knockdown from artificial microRNAs in an enhanced miR-155 backbone: a designer's guide to potent multi-target RNAi.</a> Nucleic Acids Res. 44 (5), e48 (2016).</li></ol>

Yazarlar ifşa gerek yok.

Bir optogenetic sonda ve miR ilgi presynaptic bir gen karşı ortak ifadesi gen nakavt etkisi presynaptic işlev içinde sağlam nöronal devreler karakterize etmek için güçlü bir yaklaşım sunmaktadır. Bu deneysel yaklaşım için tanımlamak ve son derece verimli ve yerel sistemler ilgi gen aşağı knocking seçici miRs karakterize önemlidir. Mümkünse, iki veya daha fazla bağımsız miRs ilgi aynı mRNA karşı kontrol etmek için nihai hedef kapalı efektleri kullanılmalıdır. Kurtarma deneyler, hangi miR dayanıklı bir gen sisteminde yeniden ortaya çıkar bir denetim olarak özgüllük için kullanılabilir.
Bir optogenetic ifade etmek için aynı yapıyı kullanarak sonda ve bir miR sağlar optik manipüle sadece presynaptic nöronlar uyarıcı için. Bu nedenle karışık ve seyreltilmiş sonuçlar üreten bulaşmış ve sigara enfekte nöronlar arasında ayrım yapmamak için bu elektrik elektrodlar ile mümkün değildir. Optik elektrodlar birden çok aksiyon potansiyelleri15neden olabilir çünkü bir genişleyen paleti15,19,20,21arasında sadece en hızlı optogenetic sondalar seçmek önemlidir. Buna ek olarak, optik stimülasyon presynaptic boutons doğrudan bir depolarizasyon teşvik değil, sinaptik iletimi adımlardan bazıları atlayarak önlemek için bir22araştırmak dilek sağlamak için önemlidir.
Biz burada, tarif deneysel yaklaşım paralel olarak sınırlı sürede (4-6 ay) birden çok presynaptic genler ilgi fizyolojik uygunluğunu değerlendirmek mümkün kılar. Ancak, nakavtlar nadiren % 100 ulaşmak aklınızda tutmanız önemlidir. Dahası, rAAVs maksimal devirme ve tam ifade bir süre sınırlaması ne zaman erken gelişimsel süreçleri soruşturma temsil edebilir optogenetic soruşturma için izin vermek en az iki hafta boyunca ifade edilmesi gerekir. Genellikle daha fazla zaman alıcı, koşullu nakavt fareler presynaptic nöronlar için sınırlı sonuçlanır rağmen faiz gen kaldırmayı tamamlamak ve bu nedenle geçerli tamamlayıcı bir yaklaşım sunuyoruz.
Birden fazla miRs aynı organizatörü üzerinden ifade sağlar miR teknolojinin belirli bir avantaj sağlıyor. Bu özellik, birden çok kopyasını aynı miR veya farklı miRs karşı aynı hedef gen ekleyerek devirme verimliliğini artırmak için esas olarak kullanılmıştır. Ancak olabilir karşı farklı hedef genlerin7,23miRs ifade ederek nakavt için birden çok gen kullanılıyor. Bu özellik presynaptic sinyal yolları incelemek için birden çok presynaptic proteinler susturmak için kullanılabilir olur.
Burada, akut Hipokampal dilimler presynaptic işlevinde gen nakavt etkilerini karakterize etmek için yapay miRs ile optogenetics birleştirdik. Benzer bir yaklaşım, değiştirmek ve nöronal devreler vivo içindeyoklama için de kullanılabilir. Buna ek olarak, yapay miRs chemogenetic ile birleştirerek yaklaşımlar bir uzun zaman ölçeklerde nöronal devreler sorgulamaya sağlayacak.

Bu iletişim kuralı gen nakavt etkisi presynaptic işlev içinde sağlam nöronal devreler karakterize etmek için yeni bir yaklaşım açıklar. Presynaptic işlevinde olduğu gibi nöronal devreler araştıran pek çok presynaptic boutons çok küçük olduğundan ve uzak kombine moleküler ve Elektrofizyolojik müdahaleler izin vermek için soma meydan okuyor. RNA müdahale devirme sinaptik proteinler1için güçlü ve esnek bir araç içerse bu yaklaşım idareli giriþi özelliðini kullanarak nakavt etkileri tespit etmek zordur çünkü presynaptic işlevi araştırmak için kullanılmıştır arasında ayrım yapmamak elektrik elektrodlar manipüle ve saf presynaptic boutons2. Burada, biz nasıl yapay mikroRNA (miR) birleştirmek açıklayın-akut beyin dilimleri içinde işlenmiş presynaptic boutons seçici uyarılması elde etmek için son zamanlarda geliştirilen optogenetic teknolojisi ile RNA müdahale aracılı.
Koşullu nakavt fareler Elektrofizyoloji ile birlikte aynı zamanda presynaptic proteinler3,4işlevi araştırmak için kullanılabilir gibi görünse, bizim strateji geliştirme ve bakım genetik olarak gerektirmez fare satırları değiştirilmiş ve aynı zamanda kolayca belirli bir gen izoformlarının vurmak için istihdam edilebilir. Göreli daha yaygın olarak kullanılan kısa saç tokası RNA'ların (shRNAs), biz burada istihdam, yapay miRs nöronlar içinde nakavt için önemli avantajlar sunuyoruz. ShRNAs, onlar bir polimeraz II organizatörü1kontrol altında ifade edilebilir. Böylece, tek bir organizatörü miR ve floresan bir muhabir ile birlikte bir optogenetic sonda ifadesi sürücü için kullanılabilir. Bu şekilde, yapı boyutu rekombinant adeno ilişkili virüs (rAAV, şekil 1A) ambalaj sınırları içinde tutulabilir. Ayrıca, miR, optogenetic sonda ve sabit bir oranda floresan muhabir ifadesi izin veren bir yayın için tek bir yapı ve tek bir organizatörü kullanımı deneysel değişkenliği azaltır.
Son zamanlarda presynaptic kalsiyum kanal Hipokampus5alternatif olarak spliced izoformlarının rolünü incelemek için bu teknolojiyi başvurdum. Bu tür bir strateji genellikle fizyolojik alaka ilgi herhangi bir beyin devre presynaptically ifade diğer proteinlerin eğitim için geçerlidir.

<table>
	<tbody>
		<tr>
			<td>Acrylamide</td>
			<td>Sigma</td>
			<td>Acrylamide/Bis-acrylamide, 30% solution</td>
			<td>Toxic</td>
		</tr>
		<tr>
			<td>Animal Temperature Controller with heat pad</td>
			<td>WPI</td>
			<td>ATC2000</td>
			<td></td>
		</tr>
		<tr>
			<td>BCA protein assay kit</td>
			<td>ThermoFisher Scientific</td>
			<td>23225</td>
			<td></td>
		</tr>
		<tr>
			<td>BLOCK-iT Pol II miR RNAi Expression Vector kit</td>
			<td>ThermoFisher Scientific</td>
			<td>K4936-00</td>
			<td></td>
		</tr>
		<tr>
			<td>Brain slices Prechamber</td>
			<td>Harvard Apparatus</td>
			<td>BSC-PC</td>
			<td></td>
		</tr>
		<tr>
			<td>CCD camera-based imager</td>
			<td>Bio-Rad</td>
			<td>ChemiDoc&#8482; MP</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell Culture reagents</td>
			<td>Life Technologies</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Chemiluminescent substrate</td>
			<td>GE Helthcare</td>
			<td>ECL Western Blotting Reagents, RPN2106</td>
			<td></td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>Sigma</td>
			<td>C2432</td>
			<td>Toxic</td>
		</tr>
		<tr>
			<td>Cytosine &#946;-D-arabinofuranoside</td>
			<td>Sigma</td>
			<td>C6645</td>
			<td></td>
		</tr>
		<tr>
			<td>Drill</td>
			<td>Foredom</td>
			<td>K.1030</td>
			<td></td>
		</tr>
		<tr>
			<td>EGTA</td>
			<td>Sigma</td>
			<td>E4378</td>
			<td></td>
		</tr>
		<tr>
			<td>Gentamicin ointment</td>
			<td>Local pharmacy</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Glucose</td>
			<td>Sigma</td>
			<td>G7021</td>
			<td></td>
		</tr>
		<tr>
			<td>Hepes</td>
			<td>Sigma</td>
			<td>54459</td>
			<td></td>
		</tr>
		<tr>
			<td>Injection micropipettes</td>
			<td>Narishige</td>
			<td>GD1</td>
			<td></td>
		</tr>
		<tr>
			<td>Inorganic salts &#38; detergents</td>
			<td>Sigma</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>K2-creatine phosphate</td>
			<td>Calbiochem</td>
			<td>237911</td>
			<td></td>
		</tr>
		<tr>
			<td>KGluconate</td>
			<td>Fluka</td>
			<td>60245</td>
			<td></td>
		</tr>
		<tr>
			<td>Laser</td>
			<td>Laserglow Technologies</td>
			<td>LRS-0473-GFM-00100-03</td>
			<td></td>
		</tr>
		<tr>
			<td>Membrane</td>
			<td>Amersham</td>
			<td>Protran&#8482; 0.2 &#181;m NC</td>
			<td></td>
		</tr>
		<tr>
			<td>MgATP</td>
			<td>Sigma</td>
			<td>A9187</td>
			<td></td>
		</tr>
		<tr>
			<td>Micropipette holder</td>
			<td>Narishige</td>
			<td>IM-H1</td>
			<td></td>
		</tr>
		<tr>
			<td>Micropipette puller</td>
			<td>Narishige</td>
			<td>PC-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Na3GTP</td>
			<td>Sigma</td>
			<td>G8877</td>
			<td></td>
		</tr>
		<tr>
			<td>NaPyruvate</td>
			<td>Sigma</td>
			<td>P5280</td>
			<td></td>
		</tr>
		<tr>
			<td>Ocular lubricant</td>
			<td>Local pharmacy</td>
			<td>Lacrigel</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate inhibitors</td>
			<td>Sigma</td>
			<td>P0044, P5726</td>
			<td></td>
		</tr>
		<tr>
			<td>Protease inhibitors</td>
			<td>Sigma</td>
			<td>cOmplete&#8482;, EDTA-free Protease Inhibitor Cocktail</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein gel electrophoresis and blotting devices</td>
			<td>Bio-Rad</td>
			<td>Mini-Protean III Cell</td>
			<td></td>
		</tr>
		<tr>
			<td>Providone iodine</td>
			<td>Local pharmacy</td>
			<td>Betadine</td>
			<td></td>
		</tr>
		<tr>
			<td>Qiazol Lysis Reagent</td>
			<td>Qiagen</td>
			<td>79306</td>
			<td>Toxic</td>
		</tr>
		<tr>
			<td>QuantiTect Reverse 
			Transcription Kit</td>
			<td>Qiagen</td>
			<td>205311</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Micro Kit</td>
			<td>Qiagen</td>
			<td>74004</td>
			<td></td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>ThermoFisher Scientific</td>
			<td>Nanodrop 2000</td>
			<td></td>
		</tr>
		<tr>
			<td>Stereotactic apparatus</td>
			<td>WPI</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Tetrodotoxin</td>
			<td>Tocris</td>
			<td>1069</td>
			<td>Toxic</td>
		</tr>
		<tr>
			<td>Vibratome</td>
			<td>Leica</td>
			<td>VT1200S</td>
			<td></td>
		</tr>
	</tbody>
</table>

combining optogenetics with artificial micrornas to characterize the effects of gene knockdown on presynaptic function within intact neuronal circuits

Bu iletişim kuralı gen nakavt etkisi presynaptic işlev içinde sağlam nöronal devreler karakterize amacıdır. Biz nasıl yapay mikroRNA (miR) birleştirmek için bir iş akışı tarif-RNA müdahale ile optogenetics akut beyin dilimleri içinde işlenmiş presynaptic boutons seçici uyarılması ulaşmak için aracılık. Deneysel bir tek viral yapı ve bir optogenetic sonda ve yapay miR(s) presynaptic gene(s) karşı ifade sürücü için tek bir nöron özel organizatörü kullanımını gerektirir. Stereotactically faiz beyin bölgesi enjekte edildiğinde ifade yapısı ışıkla sadece nöronlar gene(s) soruşturma altında azaltılmış ifade ile teşvik olanak sağlar. Bu strateji geliştirme ve genetiği değiştirilmiş fare satırlarının Bakım gerektirmez ve diğer organizmalar ve nöronal herhangi bir gen seçim için prensip olarak uygulanabilir. Biz son zamanlarda nasıl CA3 adlı kısa vadeli sinaptik plastisite CA1 eksitatör sinapslarda akut Hipokampal dilimleri içinde için alternatif splice izoformlarının presynaptic P/Q-tipi voltaj kalsiyum kanal (VGCCs) nakavt düzenleyen araştırmak için başvurdum. Benzer bir yaklaşım, değiştirmek ve nöronal devresi içinde vivoyoklama için de kullanılabilir.

Yukarıda açıklanan yordamlar nasıl sinaptik iletimi değerlendirmek için sağlam bir yöntem presynaptic nöronlar sinaptik proteinlerin nakavt etkiler sağlar. Nasıl alternatif nakavt splice izoformlarının presynaptic Cav2.1 temsilcisi sonuçlarında (P/Q-tipi) VGCCs CA3 CA1 eksitatör sinapslarda örnek olarak aşağıda verilmiştir için kısa vadeli sinaptik plastisite düzenlemektedir.
CAv2.1 (P/S-type) kanallar vardır, merkezi sinir sistemi içinde en hızlı sinapslarda baskın presynaptic VGCCs. Alternatif Uçbirleştirme dışlayan ekzonlar 37a ve 37b bir gözenek oluşturan α1 alt Cav2.1 (α1A) birimi üreten iki ana çeşidi, Cav2.1 [EFa] ve Cav2.1 [EFb]16,17 ,18. CAv2.1 [EFa] ve Cav2.1 [EFb] differentially sinaptik iletimi ve sıçan Hipokampal piramidal nöronların plastisite düzenleyen olup olmadığını belirlemek için ilk izoformu özgü miRs nakavt için seçmeli olarak geliştirdiğimiz Cav 2.1 [EFa] veya Cav2.1 [EFb]5. Kısa boyutuna karşın (97 bp) ve yüksek benzerliği (%61.86 kimlik nükleotit düzeyinde) arasında ekzonlar 37a 37b, biz tasarım ve üç miR dizileri karşı Cav2.1 [EFa] fare (miR EFa1: TCCTTATAGTGAATGCGGCCG; miR EFa2: ATGTCCTTATAGTGAATGCGG; miR EFa3: TTGCAAGCAACCCTATGAGGA) ve iki fare Cav2.1 [EFb] karşı (miR EFb1: ATACATGTCCGGGTAAGGCAT; miR EFb2: ATCTGATACATGTCCGGGTAA) öngörülen yüksek devirme verimlilik ile. (MiR denetim) negatif kontrol bilinen herhangi bir omurgalı gen hedef değil bir sıra içeren pcDNA6.2-GW/EmGFP-miR-negatif plazmid kullandık. İlk ekran Contegra kanalları karşı HEK 293 hücrelerdeki bağlı olarak, seçili miR EFa1, miR EFa3 ve miR EFb2 ve içine 3' UTR rAAVs üretimi için tasarlanmış vektör pAAV-Syn-ChETA-TdT-miR-X, onların ifade kaset klonlanmış ve nerede synapsin organizatörü ultrafast channelrhodopsin ChETA, kırmızı floresan protein TdTomato ve eklenen miR (şekil 1) ifade ediyor. Biz de miR bu miR devirme verimliliğini artırmak için EFb2 ve ifade kaset çoğaltılamaz.
Ardından, rAAV1/2 yukarıdaki dört yapıları için hazırlanan ve devirme etkinlik ve seçicilik izoformu özgü qRT-PCR kullanarak birincil fare nöronal kültürlerde sayılabilir. miR EFb mRNA yerel Cav2.1 [EFb] ~ 60 oranında ama bu Cav2.1 [EFa] (Şekil 2) azaltılmış iken miR EFa1 ve miR EFa3 mRNA yerel Cav%2.1 ~ 70 [EFa] ama bu Cav2.1 [EFb], azaltılmış.
Biz daha sonra stereotactically her biri dört rAAV1/2 P18 fareler (şekil 3A-C), Hipokampus CA3 alanına (A-P/M-L/D-V Bregma gelen) −2.6 koordinatları ile enjekte / ± 2.9 / −2.9. On beş yirmi dört gün sonrası enjeksiyon, akut Hipokampal dilimler rAAV1/2-Injected sıçanlarından emir hazırlanmış ve TdTomato floresan ifade ve rAAVs (3B rakam) lokalizasyonu onaylamak için kullanılan. Presynaptic nakavt [EFb] Cav2.1 [EFa] veya Cav2.1 CA3 adlı kısa vadeli sinaptik plastisite CA1 sinapslarda için etkilenen olup olmadığını araştırmak için biz seçmeli olarak enfekte CA3 nöronlar kısa 473 nm lazer ışık darbeleri (2 ms-uzun ile uyarılmış ; Şekil 3 c) ve piramidal nöronların proksimal medial yolu CA1 bölgesinin (şekil 3 c) için yama tarafından elde edilen EPSCs kaydedildi. Cav2.1 splice izoformlarının nakavt yanıt için eşleştirilmiş-nabız stimülasyon ters yönde etkilenen bulduk: nakavt [EFa] (miR EFa1 veya miR EFa3) Cav2.1 artırdığını eşleştirilmiş-nabız kolaylaştırma (PPF) ise Ca'nın devirme v2.1 [EFb] (miR EFb2) o (şekil 3D, E) kaldırıldı.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57223/57223fig1.jpg"> Resim 1: Şeması yapıları ultrafast optogenetic sonda ChETA ve izoformu özgü miRs Cav2.1 [EFa] ve Cav2.1 [EFb] karşı kombine ifade için. (A) rAAV haritası oluşturmak pAAV-Syn-ChETA-TdT-miR-X, synapsin organizatörü (Syn) içeren, TdTomato ve içinde proksimal 3' UTR, bir Cav2.1 splice izoformu özgü miR ChETA ultrafast channelrhodopsin erimiş. Kısıtlama gösterilen tek kesiciler enzimlerdir. (B) en iyi, düzeni ifade kaset. Synapsin düzenleyici ChETA-TdTomato ve bir izoformu özgü miR ifade ediyor. Alt, miR kaset parçası 21-nükleotit hedef sıralarının geriye doğru tamamlayıcı. MiR EFb2 için iki özdeş miR kaset birbiri ardına bir tandem ifade edildi. <a href="//cloudflare.jove.com/files/ftp_upload/57223/57223fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57223/57223fig2.jpg"> Şekil 2. Devirme verimliliği ve izoformu özgü miRs Cav2.1 [EFa] ve Cav2.1 [EFb] selectivity değerlendirilmesi. 17-18 DIV birincil kültürler 6 DIV ya Cav2.1 [EFa] (miR EFa1 ve miR EFa3) hedefleme miRs ifade rAAVs ile enfekte izole RNA izoformu özgü qRT-PCR analiz veya Cav2.1 [EFb] (miR EFb2). Veri negatif kontrol (miR denetim) normalleştirilmiş. miR EFa1 miR EFa3 önemli ölçüde ve seçmeli olarak azaltmak ve mRNA Cav2.1 [EFa] (n = 8 ve 7 kültürleri, sırasıyla), miR EFb önemli ölçüde ve seçmeli olarak azaltır [EFb] mRNA Cav2.1 iken (n 4 kültürler; = *** p < 0,001; tek yönlü analizi Varyans testi) Tukey Kramer sonrası test tarafından takip. Veri ± SEM demek olarak sunulan Bu rakam Thalhammer, A. ve ark. adapte edilmiş 5. <a href="//cloudflare.jove.com/files/ftp_upload/57223/57223fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57223/57223fig3.jpg"> Şekil 3. Rolü Cav2.1 [EFa] ve Cav2.1 [EFb] tarafından yerel Hipokampus değerlendirirken hedef çaldı aşağı nöronlar optogenetics ile uyarılması. Vivo enfeksiyonu için kullanılan rAAV yapıları ve ifade kaset (A) şeması. ((B)) Hipokampal bölümünde gösterilen TdTomato floresan CA3 bölge ve onun projeksiyonlar ile sınırlıdır. (C) deneysel yapılandırma: lazer ışını CA3 somata Yönetmen: ve yama kelepçe kayıtları CA1 piramidal nöronların gerçekleştirilen. (D) 2 ms-uzun mavi (473 nm) lazer ışık darbeleri 20 Hz parlıyordu uyandırmak kimin PPF Cav2.1 [EFa] hedefleme miRs tarafından arttı ve miR Cav2.1 [EFb] tarafından kaldırılmış EPSCs. (E) gösterilen bir artış miR denetim göreli PPF miR EFa1 ve miR EFa3 ve bir düşüş miR EFb2, için için özetini eşleştirilmiş-nabız oranı (D), olduğu gibi deneyler için (n = 9-11 kayıtları; * p 0,02; = ** p = 0,01; *** p < 0.0004; Kovaryans analizi). Veri ± SEM demek olarak sunulan Bu rakam Thalhammer, A. ve ark. adapte edilmiş 5. <a href="//cloudflare.jove.com/files/ftp_upload/57223/57223fig3large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>

Watch this Scientific Journal Video about Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits at JoVE

Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits

Bu iletişim kuralı, yapay mikroRNA aracılı RNA müdahale optogenetics özellikle presynaptic boutons selektif gene(s) sağlam nöronal devreler içinde azaltılmış ifade ile uyarmak için birleştirmek bir iş akışı sağlar.

Optogenetics gen nakavt etkileri olduğu gibi nöronal devreler içinde Presynaptic işlevi karakterize etmek için yapay mikroRNA'lar birleştirme

The purpose of this protocol is to characterize the effect of gene knockdown on presynaptic function within intact neuronal circuits. We describe a ...

combining-optogenetics-with-artificial-micrornas-to-characterize

Research

JoVE Journal

Neuroscience

10.1K Görüntüleme.  Istituto Italiano di Tecnologia. Bu iletişim kuralı, yapay mikroRNA aracılı RNA müdahale optogenetics özellikle presynaptic boutons selektif gene(s) sağlam nöronal devreler içinde azaltılmış ifade ile uyarmak için birleştirmek bir iş akışı sağlar.

Video: Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits

Vibrodissociation of Neurons from Rodent Brain Slices to Study Synaptic Transmission and Image Presynaptic Terminals

Mechanical dissociation of neurons from the central nervous system has the advantage that presynaptic boutons remain attached to the isolated neuron of interest. This allows for examination of synaptic transmission under conditions where the extracellular and postsynaptic intracellular environments can be well controlled. A vibration-based technique without the use of proteases, known as vibrodissociation, is the most popular technique for mechanical isolation. A micropipette, with the tip fire-polished to the shape of a small ball, is placed into a brain slice made from a P1-P21 rodent. The micropipette is vibrated parallel to the slice surface and lowered through the slice thickness resulting in the liberation of isolated neurons. The isolated neurons are ready for study within a few minutes of vibrodissociation. This technique has advantages over the use of primary neuronal cultures, brain slices and enzymatically isolated neurons including: rapid production of viable, relatively mature neurons suitable for electrophysiological and imaging studies; superior control of the extracellular environment free from the influence of neighboring cells; suitability for well-controlled pharmacological experiments using rapid drug application and total cell superfusion; and improved space-clamp in whole-cell recordings relative to neurons in slice or cell culture preparations. This preparation can be used to examine synaptic physiology, pharmacology, modulation and plasticity. Real-time imaging of both pre- and postsynaptic elements in the living cells and boutons is also possible using vibrodissociated neurons. Characterization of the molecular constituents of pre- and postsynaptic elements can also be achieved with immunological and imaging-based approaches.

This report demonstrates a technique for mechanical isolation of individual viable neurons retaining attached presynaptic boutons. Vibrodissociated neurons have the advantages of rapid production, excellent pharmacological control and improved space-clamp without influence from neighboring cells. This method can be used for imaging of synaptic elements and patch-clamp recording.

Kemirgen Beyin Dilimleri Nöronlar Vibrodissociation Sinaptik İletim ve Görüntü Presinaptik Terminalleri Eğitim

Mechanical dissociation of neurons from the central nervous system has the advantage that presynaptic boutons remain attached to the isolated neuron of ...

Nörobilim

Mapping Inhibitory Neuronal Circuits by Laser Scanning Photostimulation

Inhibitory neurons are crucial to cortical function. They comprise about 20% of the entire cortical neuronal population and can be further subdivided into diverse subtypes based on their immunochemical, morphological, and physiological properties1-4. Although previous research has revealed much about intrinsic properties of individual types of inhibitory neurons, knowledge about their local circuit connections is still relatively limited3,5,6. Given that each individual neuron's function is shaped by its excitatory and inhibitory synaptic input within cortical circuits, we have been using laser scanning photostimulation (LSPS) to map local circuit connections to specific inhibitory cell types. Compared to conventional electrical stimulation or glutamate puff stimulation, LSPS has unique advantages allowing for extensive mapping and quantitative analysis of local functional inputs to individually recorded neurons3,7-9. Laser photostimulation via glutamate uncaging selectively activates neurons perisomatically, without activating axons of passage or distal dendrites, which ensures a sub-laminar mapping resolution. The sensitivity and efficiency of LSPS for mapping inputs from many stimulation sites over a large region are well suited for cortical circuit analysis.
Here we introduce the technique of LSPS combined with whole-cell patch clamping for local inhibitory circuit mapping. Targeted recordings of specific inhibitory cell types are facilitated by use of transgenic mice expressing green fluorescent proteins (GFP) in limited inhibitory neuron populations in the cortex3,10, which enables consistent sampling of the targeted cell types and unambiguous identification of the cell types recorded. As for LSPS mapping, we outline the system instrumentation, describe the experimental procedure and data acquisition, and present examples of circuit mapping in mouse primary somatosensory cortex. As illustrated in our experiments, caged glutamate is activated in a spatially restricted region of the brain slice by UV laser photolysis; simultaneous voltage-clamp recordings allow detection of photostimulation-evoked synaptic responses. Maps of either excitatory or inhibitory synaptic input to the targeted neuron are generated by scanning the laser beam to stimulate hundreds of potential presynaptic sites. Thus, LSPS enables the construction of detailed maps of synaptic inputs impinging onto specific types of inhibitory neurons through repeated experiments. Taken together, the photostimulation-based technique offers neuroscientists a powerful tool for determining the functional organization of local cortical circuits.

This paper introduces an approach of combining laser scanning photostimulation with whole cell recordings in transgenic mice expressing GFP in limited inhibitory neuron populations. The technique allows for extensive mapping and quantitative analysis of local synaptic circuits of specific inhibitory cortical neurons.

Lazer Tarama Photostimulation tarafından inhibitör nöronal devreler Haritalama

Inhibitory neurons are crucial to cortical function. They comprise about 20% of the entire cortical neuronal population and can be further subdivided into ...

Multi-unit Recording Methods to Characterize Neural Activity in the Locust (Schistocerca Americana) Olfactory Circuits

Detection and interpretation of olfactory cues are critical for the survival of many organisms. Remarkably, species across phyla have strikingly similar olfactory systems suggesting that the biological approach to chemical sensing has been optimized over evolutionary time1. In the insect olfactory system, odorants are transduced by olfactory receptor neurons (ORN) in the antenna, which convert chemical stimuli into trains of action potentials. Sensory input from the ORNs is then relayed to the antennal lobe (AL; a structure analogous to the vertebrate olfactory bulb). In the AL, neural representations for odors take the form of spatiotemporal firing patterns distributed across ensembles of principal neurons (PNs; also referred to as projection neurons)2,3. The AL output is subsequently processed by Kenyon cells (KCs) in the downstream mushroom body (MB), a structure associated with olfactory memory and learning4,5. Here, we present electrophysiological recording techniques to monitor odor-evoked neural responses in these olfactory circuits.
First, we present a single sensillum recording method to study odor-evoked responses at the level of populations of ORNs6,7. We discuss the use of saline filled sharpened glass pipettes as electrodes to extracellularly monitor ORN responses. Next, we present a method to extracellularly monitor PN responses using a commercial 16-channel electrode3. A similar approach using a custom-made 8-channel twisted wire tetrode is demonstrated for Kenyon cell recordings8. We provide details of our experimental setup and present representative recording traces for each of these techniques.

Multi-unit Recording Methods to Characterize Neural Activity in the Locust Schistocerca Americana Olfactory Circuits

We demonstrate variations of the extracellular multi-unit recording technique to characterize odor-evoked responses in the first three stages of the invertebrate olfactory pathway. These techniques can easily be adapted to examine ensemble activity in other neural systems as well.

Locust Sinir Aktivitesi Karakterize Multi-ünite Kayıt Yöntemleri (<em&gt; Schistocerca Americana</em&gt;) Olfaktör Devreler

Detection and interpretation of olfactory cues are critical for the survival  of many organisms. Remarkably, species across phyla have strikingly similar ...

In Vivo Two-photon Imaging Of Experience-dependent Molecular Changes In Cortical Neurons

The brain's ability to change in response to experience is essential for healthy brain function, and abnormalities in this process contribute to a variety of brain disorders1,2. To better understand the mechanisms by which brain circuits react to an animal's experience requires the ability to monitor the experience-dependent molecular changes in a given set of neurons, over a prolonged period of time, in the live animal. While experience and associated neural activity is known to trigger gene expression changes in neurons1,2, most of the methods to detect such changes do not allow repeated observation of the same neurons over multiple days or do not have sufficient resolution to observe individual neurons3,4. Here, we describe a method that combines in vivo two-photon microscopy with a genetically encoded fluorescent reporter to track experience-dependent gene expression changes in individual cortical neurons over the course of day-to-day experience. 
One of the well-established experience-dependent genes is Activity-regulated cytoskeletal associated protein (Arc)5,6. The transcription of Arc is rapidly and highly induced by intensified neuronal activity3, and its protein product regulates the endocytosis of glutamate receptors and long-term synaptic plasticity7. The expression of Arc has been widely used as a molecular marker to map neuronal circuits involved in specific behaviors3. In most of those studies, Arc expression was detected by in situ hybridization or immunohistochemistry in fixed brain sections. Although those methods revealed that the expression of Arc was localized to a subset of excitatory neurons after behavioral experience, how the cellular patterns of Arc expression might change with multiple episodes of repeated or distinctive experiences over days was not investigated. 
In vivo two-photon microscopy offers a powerful way to examine experience-dependent cellular changes in the living brain8,9. To enable the examination of Arc expression in live neurons by two-photon microscopy, we previously generated a knock-in mouse line in which a GFP reporter is placed under the control of the endogenous Arc promoter10. This protocol describes the surgical preparations and imaging procedures for tracking experience-dependent Arc-GFP expression patterns in neuronal ensembles in the live animal. In this method, chronic cranial windows were first implanted in Arc-GFP mice over the cortical regions of interest. Those animals were then repeatedly imaged by two-photon microscopy after desired behavioral paradigms over the course of several days. This method may be generally applicable to animals carrying other fluorescent reporters of experience-dependent molecular changes4.

In Vivo Two-photon Imaging Of Experience-dependent Molecular Changes In Cortical Neurons

Experience-dependent molecular changes in neurons are essential for the brain's ability to adapt in response to behavioral challenges. An in vivo two-photon imaging method is described here that allows the tracking of such molecular changes in individual cortical neurons through genetically encoded reporters.

Kortikal Nöronlar In Vivo İki foton Of Görüntüleme Deneyimi bağımlı Moleküler Değişiklikler

The brain's ability to change in response to experience is essential for healthy brain function, and abnormalities in this process contribute to a variety ...

Fast Micro-iontophoresis of Glutamate and GABA: A Useful Tool to Investigate Synaptic Integration

One of the fundamental interests in neuroscience is to understand the integration of excitatory and inhibitory inputs along the very complex structure of the dendritic tree, which eventually leads to neuronal output of action potentials at the axon. The influence of diverse spatial and temporal parameters of specific synaptic input on neuronal output is currently under investigation, e.g. the distance-dependent attenuation of dendritic inputs, the location-dependent interaction of spatially segregated inputs, the influence of GABAergig inhibition on excitatory integration, linear and non-linear integration modes, and many more.
With fast micro-iontophoresis of glutamate and GABA it is possible to precisely investigate the spatial and temporal integration of glutamatergic excitation and GABAergic inhibition. Critical technical requirements are either a triggered fluorescent lamp, light-emitting diode (LED), or a two-photon scanning microscope to visualize dendritic branches without introducing significant photo-damage of the tissue. Furthermore, it is very important to have a micro-iontophoresis amplifier that allows for fast capacitance compensation of high resistance pipettes. Another crucial point is that no transmitter is involuntarily released by the pipette during the experiment.
Once established, this technique will give reliable and reproducible signals with a high neurotransmitter and location specificity. Compared to glutamate and GABA uncaging, fast iontophoresis allows using both transmitters at the same time but at very distant locations without limitation to the field of view. There are also advantages compared to focal electrical stimulation of axons: with micro-iontophoresis the location of the input site is definitely known and it is sure that only the neurotransmitter of interest is released. However it has to be considered that with micro-iontophoresis only the postsynapse is activated and presynaptic aspects of neurotransmitter release are not resolved. In this article we demonstrate how to set up micro-iontophoresis in brain slice experiments.

In this article we introduce fast micro-iontophoresis of neurotransmitters as a technique to investigate integration of postsynaptic signals with high spatial and temporal precision.

Glutamat ve GABA hızlı Micro-iyontoforez: Synaptic Entegrasyon Araştırma yararlı bir araç

One of the fundamental interests in neuroscience is to understand the integration of excitatory and inhibitory inputs along the very complex structure of ...

A Procedure for Implanting Organized Arrays of Microwires for Single-unit Recordings in Awake, Behaving Animals

In vivo electrophysiological recordings in the awake, behaving animal provide a powerful method for understanding neural signaling at the single-cell level. The technique allows experimenters to examine temporally and regionally specific firing patterns in order to correlate recorded action potentials with ongoing behavior. Moreover, single-unit recordings can be combined with a plethora of other techniques in order to produce comprehensive explanations of neural function. In this article, we describe the anesthesia and preparation for microwire implantation. Subsequently, we enumerate the necessary equipment and surgical steps to accurately insert a microwire array into a target structure. Lastly, we briefly describe the equipment used to record from each individual electrode in the array. The fixed microwire arrays described are well-suited for chronic implantation and allow for longitudinal recordings of neural data in almost any behavioral preparation. We discuss tracing electrode tracks to triangulate microwire positions as well as ways to combine microwire implantation with immunohistochemical techniques in order to increase the anatomical specificity of recorded results.

Implanting organized arrays of microwires for use in single-unit electrophysiological recordings presents a number of technical challenges.&#160;Methods for performing this technique and the equipment necessary are described.&#160;Also, the beneficial use of organized microwire arrays to record from distinct neural subregions with high spatial selectivity is discussed.

Hayvanlar davranmak, Awake Tek-birim Recordings Microwires Organize Dizileri implantasyon için Usulü

In vivo electrophysiological recordings in the awake, behaving animal provide a powerful method for understanding neural signaling at the single-cell ...

Using the Electroretinogram to Assess Function in the Rodent Retina and the Protective Effects of Remote Limb Ischemic Preconditioning

The ERG is the sum of all retinal activity. The ERG is usually recorded from the cornea, which acts as an antenna that collects and sums signals from the retina. The ERG is a sensitive measure of changes in retinal function that are pan-retinal, but is less effective for detecting damage confined to a small area of retina. In the present work we describe how to record the &#8216;flash&#8217; ERG, which is the potential generated when the retina is exposed to a brief light flash. We describe methods of anaesthesia, mydriasis and corneal management during recording; how to keep the retina dark adapted; electrode materials and placement; the range and calibration of stimulus energy; recording parameters and the extraction of data. We also describe a method of inducing ischemia in one limb, and how to use the ERG to assess the effects of this remote-from-the-retina ischemia on retinal function after light damage. A two-flash protocol is described which allows isolation of the cone-driven component of the dark-adapted ERG, and thereby the separation of the rod and cone components. Because it can be recorded with techniques that are minimally invasive, the ERG has been widely used in studies of the physiology, pharmacology and toxicology of the retina. We describe one example of this usefulness, in which the ERG is used to assess the function of the light-damaged retina, with and without a neuroprotective intervention; preconditioning by remote ischemia.

The electroretinogram (ERG) is an electrical potential generated by the retina in response to light. This paper describes how to use the ERG to assess retinal function, in dark-adapted rats, and how it can be can be used to assess a neuroprotective intervention, in the present case remote ischemic preconditioning.

Kemirgen Retina ve Uzaktan Ekstremite İskemik Önkoşullamanın Koruyucu Etkileri Fonksiyonu Değerlendirmek Üzere elektroretinogram kullanma

The ERG is the sum of all retinal activity. The ERG is usually recorded from the cornea, which acts as an antenna that collects and sums signals from the ...

Optogenetic Entrainment of Hippocampal Theta Oscillations in Behaving Mice

Extensive data on relationships of neural network oscillations to behavior and organization of neuronal discharge across brain regions call for new tools to selectively manipulate brain rhythms. Here we describe an approach combining projection-specific optogenetics with extracellular electrophysiology for high-fidelity control of hippocampal theta oscillations (5-10 Hz) in behaving mice. The specificity of the optogenetic entrainment is achieved by targeting channelrhodopsin-2 (ChR2) to the GABAergic population of medial septal cells, crucially involved in the generation of hippocampal theta oscillations, and a local synchronized activation of a subset of inhibitory septal afferents in the hippocampus. The efficacy of the optogenetic rhythm control is verified by a simultaneous monitoring of the local field potential (LFP) across lamina of the CA1 area and/or of neuronal discharge. Using this readily implementable preparation we show efficacy of various optogenetic stimulation protocols for induction of theta oscillations and for the manipulation of their frequency and regularity. Finally, a combination of the theta rhythm control with projection-specific inhibition addresses the readout of particular aspects of the hippocampal synchronization by efferent regions.

We describe the use of optogenetics and electrophysiological recordings for selective manipulations of hippocampal theta oscillations (5-10 Hz) in behaving mice. The efficacy of the rhythm entrainment is monitored using local field potential. A combination of opto- and pharmacogenetic inhibition addresses the efferent readout of hippocampal synchronization.

Hipokampal teta salınımlarını fareler davranışlar içinde Optogenetic sürüklenme

Extensive data on relationships of neural network oscillations to behavior and organization of neuronal discharge across brain regions call for new tools ...

Optogenetics Identification of a Neuronal Type with a Glass Optrode in Awake Mice

It is a major concern in neuroscience how different types of neurons work in neural circuits. Recent advances in optogenetics have enabled the identification of the neuronal type in in vivo electrophysiological experiments in broad brain regions. In optogenetics experiments, it is critical to deliver the light to the recording site. However, it is often hard to deliver the stimulation light to the deep brain regions from the brain&#39;s surface. Especially, it is difficult for the stimulation light to reach the deep brain regions when the optical transparency of the brain surface is low, as is often the case with recordings from awake animals. Here, we describe a method to record spike responses to the light from an awake mouse using a custom-made glass optrode. In this method, the light is delivered through the recording glass electrode so that it is possible to reliably stimulate the recorded neuron with light in the deep brain regions. This custom-made optrode system consists of accessible and inexpensive materials and is easy to assemble.

This work introduces a method to perform an optogenetic single-unit recording reliably from an awake mouse using a custom-made glass optrode.

Bir cam Optrode uyanık farelerde nöronal türüyle Optogenetics tanımlaması

It is a major concern in neuroscience how different types of neurons work in neural circuits. Recent advances in optogenetics have enabled the ...

In Vivo Calcium Imaging of Lateral-line Hair Cells in Larval Zebrafish

Sensory hair cells are mechanoreceptors found in the inner ear that are required for hearing and balance. Hair cells are activated in response to sensory stimuli that mechanically deflect apical protrusions called hair bundles. Deflection opens mechanotransduction (MET) channels in hair bundles, leading to an influx of cations, including calcium. This cation influx depolarizes the cell and opens voltage-gated calcium channels located basally at the hair-cell presynapse. In mammals, hair cells are encased in bone, and it is challenging to functionally assess these activities in vivo. In contrast, larval zebrafish are transparent and possess an externally located lateral-line organ that contains hair cells. These hair cells are functionally and structurally similar to mammalian hair cells and can be functionally assessed in vivo. This article outlines a technique that utilizes a genetically encoded calcium indicator (GECI), GCaMP6s, to measure stimulus-evoked calcium signals in zebrafish lateral-line hair cells. GCaMP6s can be used, along with confocal imaging, to measure in vivo calcium signals at the apex and base of lateral-line hair cells. These signals provide a real-time, quantifiable readout of both mechanosensation- and presynapse-dependent calcium activities within these hair cells. These calcium signals also provide important functional information regarding how hair cells detect and transmit sensory stimuli. Overall, this technique generates useful data about relative changes in calcium activity in vivo. It is less well-suited for quantification of the absolute magnitude of calcium changes. This in vivo technique is sensitive to motion artifacts. A reasonable amount of practice and skill are required for proper positioning, immobilization, and stimulation of larvae. Ultimately, when properly executed, the protocol outlined in this article provides a powerful way to collect valuable information about the activity of hair-cells in their natural, fully integrated states within a live animal.

The zebrafish is a model system that has many valuable features including optical clarity, rapid external development, and, of particular importance to the field of hearing and balance, externally located sensory hair cells. This article outlines how transgenic zebrafish can be used to assay both hair-cell mechanosensation and presynaptic function in toto.

Larva zebra balığı sonradan içini kaplamak saç hücrelerinin vivo kalsiyum görüntüleme

Sensory hair cells are mechanoreceptors found in the inner ear that are required for hearing and balance. Hair cells are activated in response to sensory ...