We are grateful to Gianni Scimone for excellent assistance with video making.

Handling of HIV infected blood samples requires some important recommendations.
 
 All specimens of blood must be transported in robust leak-proof containers. Care must be taken when collecting the specimen to avoid contamination of the container&#x2019;s exterior and of 
 any paperwork accompanying the specimen.
 
 All persons processing infected blood must wear gloves. Gloves must be changed and hands washed after completion of specimen processing.
 
 Processing of HIV-infected blood samples must be done in a class II biohazard cabinet hood. 
 
 Mechanical pipetting aids should be used. 
 
 Use of needles or other sharps (including glass e.g. pipettes or capillary tubes) must be limited to situations in which there is no alternative.
 
 Laboratory surfaces must be decontaminated with an appropriate chemical disinfectant after a spill of blood and when work activities are completed.
 
 Contaminated materials used must be decontaminated before reuse or must be disposed of correctly via the clinical waste route.
 
 Every incident of occupational exposure to potentially infectious blood or fluids (i.e., those requiring universal precautions) 
 should be treated as a medical emergency as interventions must be initiated promptly to be effective.
 
 The protocol requires 5 days for its completion. The timeframe is detailed in Figure 1.
 
 Bacterial species are identified using the methods described in Figure 2.

1. Sample Collection
<ol>
 <li>9 ml of whole blood is drawn into EDTA containing tubes.</li>
 <li>Tubes are centrifuged at 2000 rpm for 10 minutes at RT to obtain plasma.</li>
 <li>Plasma is collected in a sterile 2 ml Eppendorf-tube.</li>
</ol>
2. DNA Extraction from Plasma Samples
<ol>
 <li>Adequately disinfect hood, pipettes and material needed for the experiment in order to guarantee sterility.</li>
 <li>Position all materials under UV lights for at least 30 minutes.</li>
 <li>Wipe gloves with a disinfectant.</li>
 <li>Soak a few paper towels in ethanol and place them under the hood. Every time a tip is discarded wipe the pipette on the wet paper towels.</li>
</ol>
DNA is extracted using a commercial kit following manufacturer&#x2019;s instructions (Easy-DNA Kit, Invitrogen, Carlsbad CA, USA).
<ol start="5">
 <li>350 &mu;L of plasma are placed in a sterile 2ml eppendorf tube.</li>
 <li>350 &mu;L of filtered ultrapure water are used as negative control.</li>
 <li>Add 10 &mu;L of lysozyme (1mg/ml) to the samples.</li>
 <li>Incubate for 30 minutes at 37&deg;C.</li>
 <li>Add 500 &mu;L of Lysis Solution and mix gently to the samples.</li>
 <li>Incubate for 7 minutes at 65&deg;C.</li>
 <li>Add 900 &mu;L of chloroform to the samples.</li>
 <li>Vortex vigorously until the samples are uniformly viscous.</li>
 <li>Add 200 &mu;L of Precipitation Solution and vortex vigorously.</li>
 <li>Centrifuge samples at 10500 rpm for 10 minutes at RT to separate the phases and form the interface.</li>
 <li>Transfer the upper aqueous phase to a fresh microcentrifuge tube containing 1 ml of ethanol 100%.</li>
 <li>Centrifuge samples at 10500 rpm for 10 minutes at 4&deg;C.</li>
 <li>Remove ethanol.</li>
 <li>Add 1ml of ethanol 70%.</li>
 <li>Centrifuge samples at maximum speed for 10 minutes at 4&deg;C.</li>
 <li>Remove ethanol. The residual ethanol should be removed with a pipettator.</li>
 <li>Resuspend the pellet in 50 &mu;L of ultrapure water.</li>
 <li>Read DNA concentration with a spectrophotometer.</li>
</ol>
3. 16S rRNA Gene PCR
 PCR amplification is performed as previously described 9.
<ol>
 <li>Amplify DNA in a 100 &mu;L reaction mixture consisting of 10 &mu;L of 10X PCR buffer, 5 &mu;L of 25 mM MgCl2, 5 &mu;L of 2 mM total dNTPs, 
 1 &mu;L of 50 &mu;M primer RW01 (AACTGGAGGAAGGTGGGGAT), 1 &mu;L of 50 &mu;M primer DG74 (AGGAGGTGATCCAACCGCA), 34 &mu;L of H20 and 0.5 
 &mu;L of Taq polymerase (AmpliTaq Gold, Applied Biosystem, Foster City, CA, USA).</li>
 <li>Transfer the PCR mix in filters in order to avoid possible contamination by bacterial Taq polymerase.</li>
 <li>Centrifuge filters (Microcon, Millipore, Billerica, MA, USA) for 30 minutes at 500 rcf at 4&deg;C.</li>
 <li>Aliquot the PCR mix according to the number of samples which need to be amplified (positive and negative PCR controls, 
 samples and extracted water).</li>
 <li>Use the following thermal cycler conditions: 94&deg;C for 10 minutes; 40 times for 1 minute each time at 94&deg;C, 55&deg;C and 72&deg;C, 
 and 10 min at 72&deg;C.</li>
 <li>Visualize the PCR product on a 2% agarose gel. Use 100 bp DNA ladder. PCR product size is about 360 bp (Figure 3).</li>
</ol>
4. PCR Product Purification
Only PCR positive samples should be purified. Purification is performed using a commercial kit following manufacturer&#x2019;s instructions (PureLink PCR microkit, Invitrogen, Carlsbad CA, USA). 
<ol>
 <li>Add 4 volumes of Binding Buffer containing isopropanol per 1 volume of PCR product.</li>
 <li>Transfer PCR product with Binding Buffer to a column.</li>
 <li>Centrifuge for 1 minute at 10000 rcf at RT.</li>
 <li>Wash column with Wash Buffer containing ethanol.</li>
 <li>Centrifuge for 1 minute at 10000 rcf at RT.</li>
 <li>Centrifuge at maximum speed for 1 minute at RT to dry the silica membrane and remove any residual Wash Buffer with ethanol.</li>
 <li>Add 10 &mu;L of ultrapure water.</li>
 <li>Incubate for 1 minute at RT.</li>
 <li>Centrifuge at maximum speed for 2 minutes at RT to collect the purified DNA.</li>
</ol>
5. Cloning
Lysogeny Broth (LB) Plate Preparation
<ol>
 <li>Dissolve 25 gr of LB mix in approximately 800 ml of water.</li>
 <li>Bring the final volume to 1 L.</li>
 <li>Add 15 gr of Bactoagar.</li>
 <li>Autoclave for 20 minutes.</li>
 <li>After autoclaving, vigorously swirl the solution in the flask to mix molten agar.</li>
 <li>Cool the solution to 50&deg;C.</li>
 <li>Add Ampicillin (50 &mu;g/ml) and swirl until it dissolves.</li>
 <li>Pour plates to a depth of approximately 3mm.</li>
 <li>Leave the plates out at room temperature.</li>
 <li>Spread X-Gal (40mg/ml) and IPTG (100 mM) on each LB plate and incubate at 37&deg;C until ready for use.</li>
</ol>
Competent Cells Transformation
Transformation is performed using a commercial kit following manufacturer&#x2019;s instructions (Topo TA cloning kit, Invitrogen, Carlsbad CA, USA).
<ol>
 <li>Prepare the cloning reaction mix (1-4 &mu;L of fresh PCR product, 1 &mu;L of salt solution, 1 &mu;L of vector and water if necessary).</li>
 <li>Mix reaction gently and incubate for 5-10 minutes at RT.</li>
 <li>Place the reaction on ice.</li>
 <li>Add 2 &mu;L of the cloning reaction into a vial of competent cells and mix gently.</li>
 <li>Incubate on ice for 30 minutes.</li>
 <li>Heat-shock the cells for 30 seconds at 42&deg;C.</li>
 <li>Immediately transfer the tube into ice.</li>
 <li>Add 250 &mu;L of medium.</li>
 <li>Cap the tube tighly and shake the tube horizontally at 37&deg;C for 1 hour.</li>
 <li>Spread 50 &mu;L from each transformation on a prewarmed selective plate.</li>
 <li>Incubate overnight at 37&deg;C.</li>
</ol>
Following incubation, white and blue colonies develop on plates. White colonies are positive for PCR product insertion and blue colonies are negative for PCR product insertion.
6. Sequencing Analysis
Sequencing Reaction
<ol>
 <li>A mix is made using these reagents: 2,5 &mu;l DNA, 1 &mu;l primer (5pmol/ &mu;l) 1,1 &mu;l BigDye (Applied Biosystem, Foster City, CA, USA ).</li>
 <li>Thermal cycler conditions: 96&deg;C for 1 minutes; 25 times for 96&deg;C for 10 sec, 55&deg;C for 15 sec and 60&deg;C for 4 min.</li>
</ol>
Column Purification
<ol>
 <li>For each reaction, prepare one MicroSpin Column (Qiagen, , Milan, Italy).</li>
 <li>Invert column and vortex to mix resin.</li>
 <li>Snap off the bottom of column, loosen lid &frac14; turn, and place column in a microcentrifuge tube.</li>
 <li>Centrifuge 3200 rpm for 1 minute.</li>
 <li>Transfer column to a clean microcentrifuge tube.</li>
 <li>Carefully pipet the entire PCR sequencing reaction into the center of the column.</li>
 <li>Centrifuge 3200 rpm for 1 minute.</li>
 <li>Purified DNA will eluite into tube (20 &mu;l of ultrapure water).</li>
</ol>
Sequencing Analysis
<ol>
 <li>Load the purified sample (20 &mu;l) into 96-multiwell plate.</li>
 <li>Load the plate into the sequencer. Automated DNA Sequencers generate a four-color chromatogram showing the results of the sequencing 
 run.</li>
 <li>Input the nucleotide sequence as a query against the public sequence databases. The search is performed on the NCBI databases and 
 servers, with Basic Local Alignment Search Tool (BLAST).</li>
 <li>Consider only bacteria with 98-100% homologies.</li>
</ol>
7. Representative Results
<img src="/files/ftp_upload/2830/2830fig1.jpg" alt="Figure 1" /> 
 Figure 1. Timeline of the procedure.
<img src="/files/ftp_upload/2830/2830fig2.jpg" alt="Figure 2" /> 
 Figure 2. Flow charts of the entire bacterial identification procedure.
<img src="/files/ftp_upload/2830/2830fig3.jpg" alt="Figure 3" /> 
 Figure 3. 2% agarose gel showing broad range 16S rRNA gene PCR products. Lane 1 contains a 100bp DNA ladder, lane 2 contains 
 the PCR positive control, lane 3 shows the negative PCR control. Lane 4 shows samples from an HIV-positive patient, and lane 5 contains water.
 Lane 6 shows samples from a healthy individual and a negative PCR reaction; lane 7 contains water. Only HIV positive patients displays a 
 positive PCR amplification. Ultrapure water used as a negative control during the extraction step, indicates that no contamination occurred.
<img src="/files/ftp_upload/2830/2830fig4.jpg" alt="Figure 4" /> 
 Figure 4. 0.7% agarose gel showing plasmid extracted with miniprep procedure. Lane 1 contains a 1 Kilobase DNA ladder, lane 2 
 contains the blue control colony, lanes 3 through 12 contain white colonies. The plasmid from the blue colony does not contain the PCR product
 insert. All 10 white colonies contain plasmid with the correct insert.
<img src="/files/ftp_upload/2830/2830fig5.jpg" alt="Figure 5" /> 
 Figure 5. Shows an example of bacterial sequencing analysis in plasma from one HIV-positive individual. Our results show that microbial translocation in HIV disease involves a polimicrobic flora, which is not seen in HIV-negative subjects, suggesting substantial failure of gut immunity in controlling bacteria translocation.

<ol>
	<li>Hooper, L. V., Macpherson, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+adaptations+that+maintain+homeostasis+with+the+intestinal+microbiota.">Immune adaptations that maintain homeostasis with the intestinal microbiota.</a> Nat Rev Immunol. 10, 159-169 (2010).</li><li>Macpherson, A. J., Harris, N. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+between+commensal+intestinal+bacteria+and+the+immune+system.">Interactions between commensal intestinal bacteria and the immune system.</a> Nat Rev Immunol. 4, 478-485 (2004).</li><li>Kanauchi, O., Mitsuyama, K., Araki, Y., Andoh, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+intestinal+flora+in+the+treatment+of+inflammatory+bowel+disease.">Modification of intestinal flora in the treatment of inflammatory bowel disease.</a> Curr Pharm Des. 9, 333-346 (2003).</li><li>Brenchley, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+translocation+is+a+cause+of+systemic+immune+activation+in+chronic+HIV+infection.">Microbial translocation is a cause of systemic immune activation in chronic HIV infection.</a> Nat Med. 12, 1365-1371 (2006).</li><li>Brenchley, J. M., Price, D. A., Douek, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV+disease:+fallout+from+a+mucosal+catastrophe.">HIV disease: fallout from a mucosal catastrophe.</a> Nat Immunol. 7, 235-239 (2006).</li><li>Jiang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasma+levels+of+bacterial+DNA+correlate+with+immune+activation+and+the+magnitude+of+immune+restoration+in+persons+with+antiretroviral-treated+HIV+infection.">Plasma levels of bacterial DNA correlate with immune activation and the magnitude of immune restoration in persons with antiretroviral-treated HIV infection.</a> J Infect Dis. 199, 1177-1185 (2009).</li><li>Marchetti, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+translocation+is+associated+with+sustained+failure+in+CD4++T-cell+reconstitution+in+HIV-infected+patients+on+long-term+highly+active+antiretroviral+therapy.">Microbial translocation is associated with sustained failure in CD4+ T-cell reconstitution in HIV-infected patients on long-term highly active antiretroviral therapy.</a> AIDS. 22, 2035-2038 (2008).</li><li>Marchetti, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+Microbial+Translocation+and+Immune+Hyperactivation+in+Disease+Progression+of+HIV++Patients+with+Preserved+CD4+Count+in+the+Absence+of+ART.">Role of Microbial Translocation and Immune Hyperactivation in Disease Progression of HIV+ Patients with Preserved CD4 Count in the Absence of ART.</a> , (2010).</li><li>Greisen, K., Loeffelholz, M., Purohit, A., Leong, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+primers+and+probes+for+the+16S+rRNA+gene+of+most+species+of+pathogenic+bacteria,+including+bacteria+found+in+cerebrospinal+fluid.">PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid.</a> J Clin Microbiol. 32, 335-351 (1994).</li></ol>

No conflicts of interest declared.

We hereby show a PCR/sequencing protocol to characterise the translocation of bacteria in peripheral blood of HIV-infected individuals.
Most reliable results are obtained when using plasma collected in EDTA-containing tubes. After blood sampling, plasma should be separated by 
	centrifugation within 2/3 hours, to avoid haemolysis and DNA fragment degradation. Samples are stored first at -20&deg;C for 
	approximately 5 days and then at -80&deg;C. Multiple freeze and thaw cycles which may cause...

<table border="1">
	<tbody>
		<tr>
			<th>Name of Reagent</th>
			<th>Company</th>
			<th>Catalogue Number</th>
			<th>Comments (optional)</th>
		</tr>
		<tr>
			<td>Easty-DNA Kit</td>
			<td>Invitrogen</td>
			<td>K 180001</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>Sigma-Aldrich</td>
			<td>C2432</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Sigma-Aldrich</td>
			<td>E7203</td>
			<td>&nbsp;</td>
		<tr/>
		<tr>
			<td>UltraPure Waer</td>
			<td>Invitrogen</td>
			<td>10977049</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Lysozyme</td>
			<td>Fluka</td>
			<td>62970</td>
			<td>10 &mu;g/mL in Distillated Water</td>
		</tr>
		<tr>
			<td>AmpliTaq Gold</td>
			<td>Applied Biosystem</td>
			<td>26478701</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Microcon 100</td>
			<td>Millipore</td>
			<td>42413</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>PCR primers</td>
			<td>Invitrogen</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Eppendorf</td>
			<td>C1343</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>DNA ladder</td>
			<td>Invitrogen</td>
			<td>15628019</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Purelink PCR micro kit</td>
			<td>Invitrogen</td>
			<td>K310050</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>LB Agar, powder</td>
			<td>Invitrogen</td>
			<td>22700025</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Bactoagar</td>
			<td>Invitrogen</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Invitrogen</td>
			<td>11593027</td>
			<td>10 mg/mL in Distillated Water</td>
		</tr>
		<tr>
			<td>X-gal</td>
			<td>Invitrogen</td>
			<td>15520034</td>
			<td>40mg/mL in DMF</td>
		</tr>
		<tr>
			<td>IPTG</td>
			<td>Invitrogen</td>
			<td>15529019</td>
			<td>100mM in Distillated water</td>
		</tr>
		<tr>
			<td>Topo TA cloning kit</td>
			<td>Invitrogen</td>
			<td>K450002</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Purelink Quick Plasmid Miniprep kit</td>
			<td>Invitrogen</td>
			<td>K210010</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Big dye</td>
			<td>Applied Biosystem</td>
			<td>4337455</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>DyeEx 2.0 spin kit</td>
			<td>Qiagen</td>
			<td>63204</td>
			<td>&nbsp;</td>
		</tr>
	</tbody>
</table>

sequencing of bacterial microflora in peripheral blood: our experience with hiv-infected patients

The healthy gastrointestinal tract is physiologically colonized by a large variety of commensal microbes that influence the development 
	of the humoral and cellular mucosal immune system1,2. 
 Microbiota is shielded from the immune system via a strong mucosal barrier. Infections and antibiotics are known to alter both the normal 
	gastrointestinal tract barrier and the composition of resident bacteria, which may result in possible immune abnormalities3.
HIV causes a breach in the gastrointestinal barrier with progressive failure of mucosal immunity and leakage into the systemic circulation of bacterial bioproducts, such as lipopolysaccharide and 
	bacterial DNA fragments, which contribute to systemic immune activation4-7. Microbial translocation is implicated in HIV/AIDS immunopathogenesis and response to therapy 4,8.
We aimed to characterise the composition of bacteria translocating in peripheral blood of HIV-infected patients. To pursue our aim we set up a PCR reaction for the panbacteric 16S ribosomial gene 
	followed by a sequencing analysis.
Briefly, whole blood from both HIV-infected and healthy subjects is used. Given that healthy individuals present normal intestinal homeostasis no translocation of microflora is expected in 
	these patients. Following whole blood collection by venipuncture and plasma separation, DNA is extracted from plasma and used to perform a broad range PCR reaction for the panbacteric 
	16S ribosomial gene9. Following PCR product purification, cloning and sequencing analyses are performed.

Watch this Scientific Journal Video about Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients at JoVE.com

Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients

Our experiment will show how to perform a sequencing analysis of bacterial species translocating in peripheral blood of HIV positive patients.

The healthy gastrointestinal tract is physiologically colonized by a large variety of commensal microbes that influence the development 
	of the humoral ...

sequencing-bacterial-microflora-peripheral-blood-our-experience-with

Research

JoVE Journal

Medicine

12.2K Views.  San Paolo Hospital University of Milan, Italy. Our experiment will show how to perform a sequencing analysis of bacterial species translocating in peripheral blood of HIV positive patients. 

Video: Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients

Modeling Intracerebral Hemorrhage in Mice: Injection of Autologous Blood or Bacterial Collagenase

Spontaneous intracerebral hemorrhage (ICH) defines a potentially life-threatening neurological malady that accounts for 10-15% of all stroke-related hospitalizations and for which no effective treatments are available to date1,2. Because of the heterogeneity of ICH in humans, various preclinical models are needed to thoroughly explore prospective therapeutic strategies3. Experimental ICH is commonly induced in rodents by intraparenchymal injection of either autologous blood or bacterial collagenase4. The appropriate model is selected based on the pathophysiology of hemorrhage induction and injury progression. The blood injection model mimics a rapidly progressing hemorrhage. Alternatively, bacterial collagenase enzymatically disrupts the basal lamina of brain capillaries, causing an active bleed that generally evolves over several hours5. Resultant perihematomal edema and neurofunctional deficits can be quantified from both models. In this study, we described and evaluated a modified double injection model of autologous whole blood6 as well as an ICH injection model of bacterial collagenase7, both of which target the basal ganglia (corpus striatum) of male CD-1 mice. We assessed neurofunctional deficits and brain edema at 24 and 72 hr after ICH induction. Intrastriatal injection of autologous blood (30 &mu;l) or bacterial collagenase (0.075U) caused reproducible neurofunctional deficits in mice and significantly increased brain edema at 24 and 72 hr after surgery (p&lt;0.05). In conclusion, both models yield consistent hemorrhagic infarcts and represent basic methods for preclinical ICH research.

Clinically relevant animal models of intracerebral hemorrhage (ICH) are needed to extend our knowledge of hemorrhagic stroke and to examine novel therapeutic strategies. In this study, we describe and evaluate two ICH models that implement unilateral injections of either autologous whole blood or bacterial collagenase into the basal ganglia (corpus striatum) of mice.

Spontaneous intracerebral hemorrhage (ICH) defines a potentially life-threatening neurological malady that accounts for 10-15% of all stroke-related ...

Measuring Frailty in HIV-infected Individuals. Identification of Frail Patients is the First Step to Amelioration and Reversal of Frailty

A simple, validated protocol consisting of a battery of tests is available to identify elderly patients with frailty syndrome. This syndrome of decreased reserve and resistance to stressors increases in incidence with increasing age. In the elderly, frailty may pursue a step-wise loss of function from non-frail to pre-frail to frail. We studied frailty in HIV-infected patients and found that ~20% are frail using the Fried phenotype using stringent criteria developed for the elderly1,2. In HIV infection the syndrome occurs at a younger age.
HIV patients were checked for 1) unintentional weight loss; 2) slowness as determined by walking speed; 3) weakness as measured by a grip dynamometer; 4) exhaustion by responses to a depression scale; and 5) low physical activity was determined by assessing kilocalories expended in a week's time. Pre-frailty was present with any two of five criteria and frailty was present if any three of the five criteria were abnormal.
The tests take approximately 10-15 min to complete and they can be performed by medical assistants during routine clinic visits. Test results are scored by referring to standard tables. Understanding which of the five components contribute to frailty in an individual patient can allow the clinician to address relevant underlying problems, many of which are not evident in routine HIV clinic visits.

Frailty syndrome is commonly seen in the aged and reflects multi-system physiological change. However, with reduced functional reserve and resilience frailty is also known to be common in the HIV infected population. This study outlined an easily administered screening test to identify HIV patients with frailty. When significant components of frailty are identified, clinicians will be able to focus on amelioration of the problem and promote reversion to the pre-frail state.

A simple, validated protocol consisting of a battery of tests is available to identify elderly patients with frailty syndrome. This syndrome of decreased ...

Computerized Dynamic Posturography for Postural Control Assessment in Patients with Intermittent Claudication

Computerized dynamic posturography with the EquiTest is an objective technique for measuring postural strategies under challenging static and dynamic conditions. As part of a diagnostic assessment, the early detection of postural deficits is important so that appropriate and targeted interventions can be prescribed. The Sensory Organization Test (SOT) on the EquiTest determines an individual&#39;s use of the sensory systems (somatosensory, visual, and vestibular) that are responsible for postural control. Somatosensory and visual input are altered by the calibrated sway-referenced support surface and visual surround, which move in the anterior-posterior direction in response to the individual&#39;s postural sway. This creates a conflicting sensory experience. The Motor Control Test (MCT) challenges postural control by creating unexpected postural disturbances in the form of backwards and forwards translations. The translations are graded in magnitude and the time to recover from the perturbation is computed.
Intermittent claudication, the most common symptom of peripheral arterial disease, is characterized by a cramping pain in the lower limbs and caused by muscle ischemia secondary to reduced blood flow to working muscles during physical exertion. Claudicants often display poor balance, making them susceptible to falls and activity avoidance. The Ankle Brachial Pressure Index (ABPI) is a noninvasive method for indicating the presence of peripheral arterial disease and intermittent claudication, a common symptom in the lower extremities. ABPI is measured as the highest systolic pressure from either the dorsalis pedis or posterior tibial artery divided by the highest brachial artery systolic pressure from either arm. This paper will focus on the use of computerized dynamic posturography in the assessment of balance in claudicants.

Individuals with intermittent claudication exhibit poor balance compared to healthy controls. Computerized dynamic posturography is an objective method for measuring an individual's postural responses to balance disturbances. This provides an objective reflection of the person&#x2019;s ability to respond to situations under which sensory stimuli are altered and unexpected perturbations occur.

Computerized dynamic posturography with the EquiTest is an objective technique for measuring postural strategies under challenging static and dynamic ...

Assessment of Vascular Function in Patients With Chronic Kidney Disease

Patients with chronic kidney disease (CKD) have significantly increased risk of cardiovascular disease (CVD) compared to the general population, and this is only partially explained by traditional CVD risk factors. Vascular dysfunction is an important non-traditional risk factor, characterized by vascular endothelial dysfunction (most commonly assessed as impaired endothelium-dependent dilation [EDD]) and stiffening of the large elastic arteries. While various techniques exist to assess EDD and large elastic artery stiffness, the most commonly used are brachial artery flow-mediated dilation (FMDBA) and aortic pulse-wave velocity (aPWV), respectively. Both of these noninvasive measures of vascular dysfunction are independent predictors of future cardiovascular events in patients with and without kidney disease. Patients with CKD demonstrate both impaired FMDBA, and increased aPWV. While the exact mechanisms by which vascular dysfunction develops in CKD are incompletely understood, increased oxidative stress and a subsequent reduction in nitric oxide (NO) bioavailability are important contributors. Cellular changes in oxidative stress can be assessed by collecting vascular endothelial cells from the antecubital vein and measuring protein expression of markers of oxidative stress using immunofluorescence. We provide here a discussion of these methods to measure FMDBA, aPWV, and vascular endothelial cell protein expression.

The degree of vascular dysfunction and contributing physiological mechanisms can be assessed in patients with chronic kidney disease by measuring brachial artery flow-mediated dilation, aortic pulse-wave velocity, and vascular endothelial cell protein expression.

Patients with chronic kidney disease (CKD) have significantly increased risk of cardiovascular disease (CVD) compared to the general population, and this ...

Orthotopic Implantation and Peripheral Immune Cell Monitoring in the II-45 Syngeneic Rat Mesothelioma Model

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of the role of the tumor microenvironment in treatment response, collectively point to the need for immune-competent orthotopic models for pre-clinical testing of these new therapies. This paper demonstrates how to establish an orthotopic immune-competent rat model of pleural malignant mesothelioma. Monitoring disease progression in orthotopic models is confounded by the internal location of the tumors. To longitudinally monitor disease progression and its effect on circulating immune cells in this and other rat models of cancer, a single tube flow cytometry assay requiring only 25 &#181;l whole blood is described. This provides accurate quantification of seven immune parameters: total lymphocytes, monocytes and neutrophils, as well as the T-cell subsets CD4 and CD8, B-cells and Natural Killer cells. Different subsets of these parameters are useful in different circumstances and models, with the neutrophil to lymphocyte ratio having the greatest utility for monitoring disease progression in the mesothelioma model. Analyzing circulating immune cell levels using this single tube method may also assist in monitoring the response to immune-based treatments and understanding the underlying mechanisms leading to success or failure of treatment.

The generation of an orthotopic rat model of pleural malignant mesothelioma by implantation of II-45 mesothelioma cells into the pleural cavity of immune competent rats is presented. A flow cytometric method to analyze seven immune cell subsets in these animals from a 25 &#181;l&#160;blood sample is also described.

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of ...

Endotoxin Activity Assay for the Detection of Whole Blood Endotoxemia in Critically Ill Patients

Lipopolysaccharide, also known as endotoxin, is a fundamental component of gram-negative bacteria and plays a crucial role in the development of sepsis and septic shock. The early identification of an infectious process that is rapidly evolving to a critical illness might prompt a quicker and more intensive treatment, thereby potentially leading to better patient outcomes. The Endotoxin Activity (EA) assay can be used at the bedside as a reliable biomarker of systemic endotoxemia. The detection of elevated endotoxin activity levels has been repeatedly shown to be associated with an increased disease severity in patients with sepsis and septic shock. The assay is quick and easy to perform. Briefly, after sampling, an aliquot of whole blood is mixed with an anti-endotoxin antibody and with added LPS. Endotoxin activity is measured as the relative oxidative burst of primed neutrophils as detected by chemioluminescence. The assay&#39;s output is expressed on a scale from 0 (absent) to 1 (maximal) and categorized as &#8220;low&#8221; (&#60;0.4 units), &#8220;intermediate&#8221; (0.4&#8211;0.59 units), or &#8220;high&#8221; (&#8805;0.6 units). The detailed methodology and rationale for the implementation of the EA assay are reported in this manuscript.

We hereby present a protocol to measure at the bedside the endotoxin activity of human whole blood samples. The Endotoxin Activity assay is a simple test to perform and may be a useful biomarker in critically ill patients with sepsis.

Lipopolysaccharide, also known as endotoxin, is a fundamental component of gram-negative bacteria and plays a crucial role in the development of sepsis ...

Digital Handwriting Analysis of Characters in Chinese Patients with Mild Cognitive Impairment

An increasing amount of evidence shows that cognitive deficits and movement dysfunctions are not separated. Patients with mild cognitive impairment (MCI) can manifest fine motor disorders of the upper extremities. Handwriting is a complex and unique human activity involving both motor and cognitive coordination. Researchers from western countries have discovered that patients with MCI have abnormal handwriting features. However, no relevant studies have been conducted in the Chinese population. Owing to the cross-culture phenomenon of handwriting, the aim of this study is to find new handwriting tasks to demonstrate the differences in handwriting features between elderly patients with MCI and age-matched healthy individuals.

This study proposed a digital handwriting analysis of characters in individuals with mild cognitive impairment to find more information than is revealed by traditional pencil&#8211;paper handwriting analysis.

An increasing amount of evidence shows that cognitive deficits and movement dysfunctions are not separated. Patients with mild cognitive impairment (MCI) ...

Fertility Preservation in Patients with Severe Ovarian Dysfunction

Ovarian function progressively declines during aging and in some pathophysiological conditions including karyotype abnormality, autoimmune diseases, chemo- and radiation-therapies, as well as ovarian surgeries. In unmarried women with severe ovarian dysfunction, fertility preservation is important for future pregnancies. Although oocyte cryopreservation is an established method for fertility preservation, these patients could only preserve a limited number of oocytes even after ovarian hyperstimulation, leading to repeated stimulations to ensure sufficient oocytes to guarantee future pregnancy. To solve this issue, we have recently developed a drug-free in vitro activation (IVA) procedure, which enable us to stimulate early stages of ovarian follicles to develop to the preantral follicle stage. These preantral follicles can respond to the unique protocol of gonadotropin stimulation, resulting in increased number of retrieved oocytes per ovarian stimulation for cryopreservation. The drug-free IVA comprised from the surgical approach and ovarian stimulation. We removed a part of cortex from one or both ovaries from patients under laparoscopic surgery. The ovarian cortical tissues were cut into small cubes to disrupt the Hippo signaling pathway and stimulate the development of early stage follicles. These cubes were grafted orthotropically into remaining ovaries as well as beneath the serosa of both Fallopian tubes. We have already published the surgical procedure of the drug-free IVA and the protocol of subsequent ovarian stimulation, but herein we present the details of laboratory methods required for drug-free IVA.

We present details of laboratory procedures for drug-free in vitro activation (IVA) of ovarian follicles for patients with severe ovarian dysfunction. This method could increase the number of retrievable oocytes per ovarian hyperstimulation and benefit fertility preservation for those patients.

Ovarian function progressively declines during aging and in some pathophysiological conditions including karyotype abnormality, autoimmune diseases, ...

Evaluation of a Point-of-Care Testing Analyzer for Measuring Peripheral Blood Leukocytes

White blood cell (WBC) is an important indicator of inflammation in the body, and it can help distinguish between bacterial and viral infections. At present, most primary medical institutions in China have a poor percentage of adoption of blood-testing technology, and a hematology detection system with a high price to performance ratio and easy operation is urgently needed in primary healthcare centers. This paper introduces the principle and operation procedures of a point-of-care testing (POCT) card-based leukocyte analyzer (evaluated system), which was used to detect WBC indexes such as neutrophils, lymphocytes, and intermediate group cells (including eosinophils, basophils, and monocytes) in whole blood. The results from the evaluated system were compared to those from two commercial automatic hematology analyzers (reference system). The correlation and consistency between the evaluated system and the commercial reference systems were analyzed. The results showed that WBC count and number of granulocytes detected by the evaluated and reference systems showed a strong positive correlation (rs = 0.972 and 0.973, respectively), while the number of lymphocytes showed a relatively low correlation (rs = 0.851). A Bland-Altman plot showed that the major difference between the values detected by the evaluated system and the reference systems is within 95% limits of agreement (LoA), indicating that the two systems are in good agreement. In conclusion, the evaluated system has an excellent correlation, robust consistency, and a reliable comparison with the results of the widely used automatic hematology analyzers. It is ideal for WBC detection in primary medical institutions where a full-automatic five-category hematology analyzer is unavailable, especially during the COVID-19 normalized prevention and control period.

A protocol to measure peripheral blood leukocytes using a POCT card-based leukocyte analyzer is presented here. Same blood samples were tested by two automated hematology analyzers to evaluate the consistency and accuracy of the results. The results showed that the evaluated analyzer had a good correlation with the reference system.

White blood cell (WBC) is an important indicator of inflammation in the body, and it can help distinguish between bacterial and viral infections. At ...

Cox-Maze IV Procedure Concomitant with Valvular Surgery In Situs Inversus Dextrocardia: A Single-Center Experience in China

Atrial fibrillation (AF) is the most common cardiac arrhythmia. The use of ablation technologies made the Cox-Maze IV procedure (CMP-IV) technically easier, faster, becoming the gold standard for the surgical treatment of AF. However, the efficacy and safety of CMP-IV in situs inversus dextrocardia are largely unknown. This paper summarizes the CMP-IV procedure performed concomitantly with valvular surgery in patients with situs inversus dextrocardia at this institution.
From February 2016 to September 2020, three dextrocardia patients with persistent AF and valvular diseases were referred to this institution for valvular and CMP-IV surgery. CMP-IV was performed using either cryoablation with a nitrous oxide (N2O)-based cryoprobe or a bipolar radiofrequency clamp and bipolar radiofrequency pen. Mechanical valve replacement or mitral vavuloplasty was performed in another patient in addition to tricuspid annuloplasty. Transmurality of the ablated atrial tissues was evaluated by electron microscopy. Heart function was assessed by transthoracic echocardiography. Cardiac rhythm was monitored by 24 h Holter at 3, 6, 12, 18, 24, and 48 months follow-up. 
All the AF was successfully eliminated in the ablation procedure without recurrence or other complications during hospitalization. The mean bypass and crossclamp times were similar in all the patients. The postoperative ventilator support time, the duration of stay in the ICU, and postoperative residence time were also not significantly different among the patients. Transmural atrial necrosis was detected in the ablated atrial tissues. Sinus rhythm maintenance was achieved at 3, 6, 12, 18, 24, and 48 months follow-up in all the patients. All valve protheses switched freely; no tricuspid regurgitation was observed. The results of the present study demonstrate that the CMP-IV is safe and effective in eliminating AF in dextrocardia patients concomitant with valvular surgery.

We summarize the Cox-Maze IV procedure concomitant with valvular surgery performed in patients with situs inversus dextrocardia at this institution.

Atrial fibrillation (AF) is the most common cardiac arrhythmia. The use of ablation technologies made the Cox-Maze IV procedure (CMP-IV) technically ...