Name: sublingual immunotherapy as an alternative to induce protection against acute respiratory infections
Uploaded: 2014-08-30T14:00:00.000+00:00
Duration: 16 min 56 s
Description: Watch this Scientific Journal Video about Sublingual Immunotherapy as an Alternative to Induce Protection Against Acute Respiratory Infections at JoVE.com

We acknowledge Dr. Jean-Claude Sirard from the Center for Infection and Immunity of Lille, Institute Pasteur de Lille-France, for kindly providing the purified flagellin and Dr. Teresa Camou, Director of the National Reference Laboratory, Ministry of Health of Uruguay for kindly providing the pneumococcal strain. 
The authors would like to express their acknowledgement to Mr. Diego Acosta and Mr. Ignacio Turel form BichoFeo Producciones-Uruguay for their commitment and hard work during the entire video production and edition. 
This work was supported by the grants PR_FCE_2009_1_2783 and BE_POS_2010_1_2544 from the National Agency of Research and Innovation, ANII from Uruguay, the Program for Development of Basic Sciences, PEDECIBA of Uruguay and Sectoral Commission of Scientific research, CSIC-Universidad de la Rep&#250;blica, Uruguay.

<ol>
	<li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumococcal+vaccines+WHO+position+paper--2012.">Pneumococcal vaccines WHO position paper--2012.</a> Weekly Epidemiological Record. 14, 129-144 (2012).</li><li>Appelbaum, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carriage+of+antibiotic-resistant+Streptococcus+pneumoniae+by+children+in+eastern+and+central+Europe-a+multicenter+study+with+use+of+standardized+methods.">Carriage of antibiotic-resistant Streptococcus pneumoniae by children in eastern and central Europe-a multicenter study with use of standardized methods.</a> Clin Infect Dis. 23, 712-717 (1996).</li><li>Ramirez, J. A., Anzueto, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changing+needs+of+community-acquired+pneumonia.">Changing needs of community-acquired pneumonia.</a> J Antimicrob Chemother. 66, 3-9 (2011).</li><li>Cuburu, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sublingual+immunization+induces+broad-based+systemic+and+mucosal+immune+responses+in+mice.">Sublingual immunization induces broad-based systemic and mucosal immune responses in mice.</a> Vaccine. 25, 8598-8610 (2007).</li><li>Pedersen, G. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+sublingual+route+for+administration+of+influenza+H5N1+virosomes+in+combination+with+the+bacterial+second+messenger+c-di-GMP.">Evaluation of the sublingual route for administration of influenza H5N1 virosomes in combination with the bacterial second messenger c-di-GMP.</a> PLoS One. 25, 1-12 (2011).</li><li>Song, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sublingual+vaccination+with+influenza+virus+protects+mice+against+lethal+viral+infection.">Sublingual vaccination with influenza virus protects mice against lethal viral infection.</a> Proc Natl Acad Sci USA. 105, 1644-1649 (2008).</li><li>Cogo, R., Ramponi, A., Scivoletto, G., Rippoli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prophylaxis+for+acute+exacerbations+of+chronic+bronchitis+using+an+antibacterial+sublingual+vaccine+obtained+through+mechanical+lysis:+a+clinical+and+pharmacoeconomic+study.">Prophylaxis for acute exacerbations of chronic bronchitis using an antibacterial sublingual vaccine obtained through mechanical lysis: a clinical and pharmacoeconomic study.</a> Acta Biomed. 74, 76-87 (2003).</li><li>Rosaschino, F., Cattaneo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+optimizing+compliance+of+paediatric+patients+for+seasonal+antibacterial+vaccination+with+sublingually+administered+Polyvalent+Mechanical+Bacterial+Lysates+(PMBL).">Strategies for optimizing compliance of paediatric patients for seasonal antibacterial vaccination with sublingually administered Polyvalent Mechanical Bacterial Lysates (PMBL).</a> Acta Biomed. 75, 171-178 (2004).</li><li>Senna, G., Caminati, M., Canonica, G. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Safety+and+tolerability+of+sublingual+immunotherapy+in+clinical+trials+and+real+life.">Safety and tolerability of sublingual immunotherapy in clinical trials and real life.</a> Curr Opin Allergy Clin Immunol. 13, 656-662 (2013).</li><li>Mascarell, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+dendritic+cells+mediate+antigen-specific+tolerance+by+stimulating+TH1+and+regulatory+CD4++T+cells.">Oral dendritic cells mediate antigen-specific tolerance by stimulating TH1 and regulatory CD4+ T cells.</a> J Allergy Clin Immunol. 122, 603-609 (2008).</li><li>Mascarell, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+of+the+lingual+immune+system+reveals+the+presence+of+both+regulatory+and+effector+CD4++T+cells.">Mapping of the lingual immune system reveals the presence of both regulatory and effector CD4+ T cells.</a> Clin Exp Allergy. 39, 1910-1919 (2009).</li><li>Mascarell, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+macrophage-like+cells+play+a+key+role+in+tolerance+induction+following+sublingual+immunotherapy+of+asthmatic+mice.">Oral macrophage-like cells play a key role in tolerance induction following sublingual immunotherapy of asthmatic mice.</a> Mucosal Immunology. 4, 638-647 (2011).</li><li>Hervouet, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigen-bearing+dendritic+cells+from+the+sublingual+mucosa+recirculate+to+distant+systemic+lymphoid+organs+to+prime+mucosal+CD8+T+cells.">Antigen-bearing dendritic cells from the sublingual mucosa recirculate to distant systemic lymphoid organs to prime mucosal CD8 T cells.</a> Mucosal Immunology. 7, 280-291 (2014).</li><li>Munoz, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mucosal+administration+of+flagellin+protects+mice+from+Streptococcus+pneumoniae+lung+infection.">Mucosal administration of flagellin protects mice from Streptococcus pneumoniae lung infection.</a> Infect Immun. 78, 4226-4233 (2010).</li><li>Hayashi, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+innate+immune+response+to+bacterial+flagellin+is+mediated+by+Toll-like+receptor+5.">The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5.</a> Nature. 410, 1099-1103 (2001).</li><li>Lightfield, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+function+for+Naip5+in+inflammasome+activation+by+a+conserved+carboxy-terminal+domain+of+flagellin.">Critical function for Naip5 in inflammasome activation by a conserved carboxy-terminal domain of flagellin.</a> Nature Immunology. 9, 1171-1178 (2008).</li><li>Lightfield, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+requirements+for+NAIP5+in+activation+of+the+NLRC4+inflammasome.">Differential requirements for NAIP5 in activation of the NLRC4 inflammasome.</a> Infect Immun. 79, 1606-1614 (2011).</li><li>Honko, A. N., Mizel, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mucosal+administration+of+flagellin+induces+innate+immunity+in+the+mouse+lung.">Mucosal administration of flagellin induces innate immunity in the mouse lung.</a> Infect Immun. 72, 6676-6679 (2004).</li><li>Janot, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Radioresistant+cells+expressing+TLR5+control+the+respiratory+epithelium's+innate+immune+responses+to+flagellin.">Radioresistant cells expressing TLR5 control the respiratory epithelium's innate immune responses to flagellin.</a> Eur J Immunol. 39 (6), 1587-1596 (2009).</li><li>Van Maele, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TLR5+signaling+stimulates+the+innate+production+of+IL-17+and+IL-22+by+CD3(neg)CD127++immune+cells+in+spleen+and+mucosa.">TLR5 signaling stimulates the innate production of IL-17 and IL-22 by CD3(neg)CD127+ immune cells in spleen and mucosa.</a> J Immunol. 185, 1177-1185 (2010).</li><li>Lee, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neurologic+adverse+events+following+influenza+A+(H1N1)+vaccinations+in+children.">Neurologic adverse events following influenza A (H1N1) vaccinations in children.</a> Pediatrics international: official journal of the Japan Pediatric Society. 54, 325-330 (2012).</li><li>Lewis, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+facial+nerve+paralysis+(Bell's+palsy)+following+intranasal+delivery+of+a+genetically+detoxified+mutant+of+Escherichia+coli+heat+labile+toxin.">Transient facial nerve paralysis (Bell's palsy) following intranasal delivery of a genetically detoxified mutant of Escherichia coli heat labile toxin.</a> PLoS One. 4, e6999 (2009).</li><li>Mutsch, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+the+inactivated+intranasal+influenza+vaccine+and+the+risk+of+Bell's+palsy+in+Switzerland.">Use of the inactivated intranasal influenza vaccine and the risk of Bell's palsy in Switzerland.</a> N Engl J Med. 350, 896-903 (2004).</li><li>Kuo, C. H., Wang, W. L., Chu, Y. T., Lee, M. S., Hung, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sublingual+immunotherapy+in+children:+an+updated+review.">Sublingual immunotherapy in children: an updated review.</a> Pediatr Neonatol. 50, 44-49 (2009).</li><li>Nempont, C., Cavet, D., Rumbo, M., Bompard, C., Villeret, V., Sirard, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deletion+of+flagellin's+hypervariable+region+abrogates+antibody-mediated+neutralization+and+systemic+activation+of+TLR5-dependent+immunity.">Deletion of flagellin's hypervariable region abrogates antibody-mediated neutralization and systemic activation of TLR5-dependent immunity.</a> J. Immunol. 181, 2036-2043 (2008).</li><li>Marques, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protection+against+Streptococcus+pneumoniae+serotype+1+acute+infection+shows+a+signature+of+Th17-+and+IFN-gamma-mediated+immunity.">Protection against Streptococcus pneumoniae serotype 1 acute infection shows a signature of Th17- and IFN-gamma-mediated immunity.</a> Immunobiology. 217, 420-429 (2012).</li><li>Stewart, C. C., Stewart, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Titering+antibodies.">Titering antibodies.</a> Current Protocols in Cytometry. 4, Unit 4.1 (2001).</li><li>Kubista, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+real-time+polymerase+chain+reaction.">The real-time polymerase chain reaction.</a> Molecular Aspects of Medicine. 27, 95-125 (2006).</li><li>Pedersen, G., Cox, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mucosal+vaccine+quandary:+intranasal+vs.+sublingual+immunization+against+influenza.">The mucosal vaccine quandary: intranasal vs. sublingual immunization against influenza.</a> Human Vaccines &amp; Immunotherapeutics. 8, 689-693 (2012).</li><li>Vitaliti, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mucosal+immunity+and+sublingual+immunotherapy+in+respiratory+disorders.">Mucosal immunity and sublingual immunotherapy in respiratory disorders.</a> Journal of Biological Regulators and Homeostatic Agents. 26, S85-S93 (2012).</li></ol>

The authors have nothing to disclose.

Sublingual administration of therapeutic agents has been proven as a useful means to modulate the immune response in the respiratory tract. The main advantage of SLIT for the treatment of respiratory conditions is that it does not involve direct delivery of compounds into the lungs or nostrils, being safer than treatments based on intranasal administration31.
Sublingual immunotherapy can be used to modulate the immune response in different ways, either for induction of regulatory responses that can ameliorate the symptoms of allergic inflammation and asthma32 or to induce transient activation of innate immune mechanisms to treat acute lung infections as shown here.
The mouse model presented in this video is a convenient method for screening of different compounds as therapeutic agents for SLIT.
This animal model offers a useful means to determine the impact of SLIT in the lungs&#8217; immune response as well as in other organs (e.g., draining lymph nodes or distal mucosal sites) that cannot be mimicked by the use of in vitro models. Although there are several papers that describe results obtained using sublingual immunotherapy, detailed methods for the procedures of sublingual administration have not been made available yet. Additionally, the model can be used for evaluation of sublingual vaccines aiming to confer systemic as well as local protection in the respiratory tract.
As shown in the accompanying video, sublingual administration of compounds is a simple procedure that can be easily performed without the need of extensive training. Typically, a person proficient in animal handling will require 1 hr to perform SLIT in a group of 10 mice using injectable anesthetics as described in this protocol. If pneumococcal challenge is performed as well, 90 additional min will be required to prepare the bacterial suspension and perform intranasal challenge of the animals.
The FACS protocols presented here allow convenient characterisation of impact of the SLIT at the local site of administration, draining lymph nodes as well as their effects on the lungs&#8217; cell dynamics.
Separate analysis of the bronchoalveolar content and lung parenchyma is important to discriminate the airways&#8217; immune resident and infiltrating cell types from those that remain within the tissue. Analysis of the BAL content allows the study of alveolar macrophage turnover as well as the dynamics of cells recruitment into the alveolar spaces induced by different treatments, e.g., PMNs, eosinophils, monocytes. BAL can also be used to assess presence of secreted cytokines and chemokines by Enzyme-linked Immunosorbent Assay (ELISA) or detection of secreted IgA antibodies elicited after sublingual vaccination. Study of the lungs&#8217; tissue will allow characterisation of other cell types, classically dendritic cells, T cells and B cells.
Preparation of BAL samples and lymph nodes for FACS analysis is simple. After sample collection, normally 60 min are required to complete the staining protocol for 10-20 samples. In contrast, isolation of cells from lungs or sublingual tissue will require more time since digestion of the extracellular matrix is required. Absorption of the therapeutic agent delivered by sublingual route can be addressed by tracking of fluorescently or radioactively labelled molecules using in vivo imaging systems.
Sublingual immunotherapy is an attractive method to effectively induce immune responses in the respiratory tract as well as systemically that can be used to treat or prevent respiratory conditions. Elucidation of the mechanisms determining activation vs tolerance of the immune response in the respiratory tract after SLIT is crucial to allow rational design of new therapeutic strategies that could be used alone or in combination with available treatments against different respiratory conditions.

The overall goal of this work is to illustrate the benefits of sublingual immunotherapy for the treatment of acute respiratory infections (ARI) and present the advantages of this delivery route compared to other routes of administration, namely intranasal.
ARI cause millions of deaths every year especially in children under five. Streptococcus pneumoniae remains as one of the major etiological agents of bacterial pneumonia in infants and the elderly1,2. To present, the main available treatment relies on the use of antibiotics but resistant strains are continuously arising3,4.
SLIT induces broad responses at systemic and also mucosal level, particularly at the respiratory tract5. It has proven effectiveness against influenza infection, promoting long term protection with production of humoral and cellular responses6,7. Besides, it has been shown that prophylactic treatment with bacterial lysates delivered by sublingual route reduced exacerbations of chronic obstructive bronchitis in the elderly8 and prevented recurrent respiratory infections in children9. SLIT has been widely used for the treatment of allergies and asthma. Clinical studies had not only demonstrated its efficacy to modulate the immune response in the respiratory tract but also its safety10. Despite the growing interest of pharmaceutical companies and researchers in SLIT, the mechanisms involved in the induction of mucosal immune responses after sublingual delivery of compounds remain obscure. Recently, attention has been focused on the mechanisms promoting tolerance associated with allergen desensitization. It has been proposed that resident and recruited cells at the sublingual mucosa, like dendritic cells and macrophages, can promote tolerance after SLIT11-13. Dendritic cells of the oral mucosa can promote IFN-gamma and IL-10 producing T helper cells11 as well as recirculate to the distal genital mucosa and promote CD8+ T cells14. However, little is known about the impact of SLIT on innate cells or its capacity to improve pathogen clearance during acute respiratory infections.
The natural control of pneumococcal infection in the lungs greatly depends on the efficient and swift activation of local innate defences. We previously showed that enhancement of lungs&#8217; innate immunity by a single intranasal dose of flagellin (FliC), a TLR5 and NLRC4 agonist, protects 75-100% of mice challenged with a lethal dose of a clinical isolate of Streptococcus pneumoniae serotype 1. This protection was shown to be dependent on local recruitment of GR1+ cells (likely polymorphonuclear neutrophils, PMNs) and not dependent on antibodies, B or T cells15. 
Flagellin is the structural component of the bacterial flagellum. In its monomeric form it is recognized by two Pathogen Recognition Receptors (PRRs), TLR5 that senses extracellular FliC16 and NLRC4/NAIP5 inflammasome that detects intracellular flagellin17,18. When FliC is sensed by the PRRs an important inflammatory response is triggered. We and others have demonstrated that instillation of purified FliC from Salmonella enterica serovar Typhimurium into the lungs drives swift production of chemokines and cytokines specially when recognized by the lungs&#8217; epithelium that in turn orchestrate the recruitment of immune cells into the airways, mainly PMNs15,19-21. Although transient, the substantial neutrophil infiltration that takes place into the airways after nasal delivery of FliC could be a concern if moving towards clinical therapies for human use. Excessive inflammation could be detrimental for the lungs&#8217; function. Moreover, it has been shown that intranasal delivery of immunostimulatory molecules may cause facial paralysis and/or brain toxicity22-24. 
Sublingual immunotherapy offers a safer alternative to modulate the immune response in the respiratory tract compared to the intranasal route. It is non-invasive, painless, simple and has good patient compliance25. Furthermore, as mentioned before, it can induce protective responses in the respiratory mucosa without the risks associated to direct intranasal or intrapulmonary delivery of formulations. Sublingual route could be alternatively used to deliver molecules that have great effects onto the lung&#8217;s immune system but that have been proven to be toxic or to elicit great inflammation when administered intranasally. Besides these advantages, formulations for sublingual immunotherapy have lower cost of manufacture since non-sterile products can be delivered by this route and endotoxic shock is not a concern for SLIT. On the other hand, it is worth noticing that higher doses of the immunostimulatory compounds compared to those used by intranasal or parenteral routes are necessary to induce an immune response in the lungs; also highly concentrated solutions are needed when using the mouse model of SLIT since the anatomical site where the formulations are deposited is small. 
Based on our previous published data, we developed a model of protection using sublingual immunotherapy with flagellin as model immunostimulant. We demonstrated that a single dose of flagellin induced 60% survival against invasive pneumococcal pneumonia caused by the serotype 1 strain while all mice in the control group died of infection within 5 days. Flow cytometry analysis showed that higher numbers of PMN are recruited into the airways of protected animals after sublingual treatment with flagellin suggesting that these cells might be involved in the mechanism of protection induced by sublingual immunotherapy. 
This video shows in detail how to perform sublingual immunotherapy and also how to recover relevant tissue from the sublingual mucosa, draining lymph nodes as well as lungs and airways to perform further analysis. Additionally, it illustrates the general technique of cell preparation for FACS analysis and briefly shows how to prepare Streptococcus pneumoniae suspensions and how to perform intranasal infections in mouse to set up the acute infection model.

<table><tbody><tr><td>Ketamine solution (50 mg/ml)</td><td>Pharma Service, Uruguay</td><td></td><td></td></tr><tr><td>Xilacine solution (2 %)</td><td>Portinco S.A., Uruguay</td><td></td><td></td></tr><tr><td>Sterile 1 ml syringe</td><td>Modern, Uruguay</td><td></td><td></td></tr><tr><td>Sterile 27 G needle</td><td>Modern, Uruguay</td><td></td><td></td></tr><tr><td>RPMI 1640</td><td>General Electric Health Care</td><td>E15885</td><td></td></tr><tr><td>Fetal Bovine Serum</td><td>ATCC</td><td>302020</td><td></td></tr><tr><td>Penicillin/Streptomycin Solution</td><td>SIGMA</td><td>P4333</td><td></td></tr><tr><td>Sterile PBS without Ca&lt;sup&gt;2+&lt;/sup&gt;/Mg&lt;sup&gt;2+&lt;/sup&gt;</td><td>PAA</td><td>H21002</td><td></td></tr><tr><td>Type-I Collagenase</td><td>Life Technologies/Gibco</td><td>17100017</td><td></td></tr><tr><td>Deoxyribonuclease I (DNAse-I)</td><td>SIGMA</td><td>D4513</td><td></td></tr><tr><td>Dispase</td><td>Life Technologies/Gibco</td><td>17105041</td><td></td></tr><tr><td>PerCP-Cy5.5 conjugated rat anti mouse IgG2b anti CD11b</td><td>BD</td><td>550993</td><td>Clone M1/70</td></tr><tr><td>APC conjugated hamster anti mouse IgG1 anti CD11c</td><td>BD</td><td>550261</td><td>Clone HL3&amp;nbsp;</td></tr><tr><td>APC-Cy7 conjugated rat anti mouse IgG2a anti Ly6G</td><td>BD</td><td>560600</td><td>Clone 1A8</td></tr><tr><td>Sterile Saline Solution</td><td>Laboratorio Farmaco Uruguayo, Uruguay</td><td></td><td></td></tr><tr><td>Tryptic Soy Agar</td><td>BD Difco, France</td><td>236950</td><td></td></tr><tr><td>Defibrinated Sheep Blood</td><td>Biokey, Uruguay</td><td></td><td></td></tr><tr><td>Sterile Petri Dishes</td><td>Greiner</td><td>633180</td><td></td></tr><tr><td>p10 Pipette</td><td>Gilson</td><td>F144802</td><td></td></tr><tr><td>p20 Pipette</td><td>Eppendorf</td><td>3120000097</td><td></td></tr><tr><td>p200 Pipette</td><td>Gilson</td><td>F123601</td><td></td></tr><tr><td>p200 Pipette</td><td>Capp</td><td>C200</td><td></td></tr><tr><td>p200 Pipette</td><td>Eppendorf</td><td>3120000054</td><td></td></tr><tr><td>p1000 Pipette</td><td>Eppendorf</td><td>3120000062</td><td></td></tr><tr><td>Sterile Filter Tips p10</td><td>Greiner</td><td>771288</td><td></td></tr><tr><td>Sterile Filter Tips p200</td><td>Greiner</td><td>739288</td><td></td></tr><tr><td>Sterile Filter Tips p1000</td><td>Greiner</td><td>750288</td><td></td></tr><tr><td>Vortex</td><td>BIOSAN</td><td>V1-plus</td><td></td></tr><tr><td>Stainless steel fine tip forceps&amp;nbsp;</td><td>SIGMA</td><td>Z168785/Z168777</td><td>Curved and straight</td></tr><tr><td>Dressing tissue forceps</td><td>SIGMA</td><td>F4392</td><td>Length 8 inches</td></tr><tr><td>Micro-dissecting forceps</td><td>SIGMA</td><td>F4017</td><td>Straight&amp;nbsp;</td></tr><tr><td>Micro-dissecting forceps</td><td>SIGMA</td><td>F4142&amp;nbsp;</td><td>Curved</td></tr><tr><td>Mayo Scissors</td><td>SIGMA</td><td>Z265993&amp;nbsp;</td><td></td></tr><tr><td>Scalpel</td><td>SAKIRA MEDICAL</td><td></td><td></td></tr><tr><td>Sterile Biopsy Punch &amp;Oslash; 3mm</td><td>Stiefel Laboratories Ltd.</td><td>2079D</td><td>5 mm diameter can also be used</td></tr><tr><td>Sterile 1.5 ml Tubes</td><td>Deltalab</td><td>200400P</td><td></td></tr><tr><td>Sterile 15 ml Tubes</td><td>Greiner</td><td>188271</td><td></td></tr><tr><td>Sterile 50 ml Tubes</td><td>Greiner</td><td>227261</td><td></td></tr><tr><td>Sterile serological pipettes 5 ml</td><td>Greiner</td><td>606160</td><td></td></tr><tr><td>Sterile serological pipettes 10 ml</td><td>Greiner</td><td>607160</td><td></td></tr><tr><td>Sterile serological pipettes 25 ml</td><td>Greiner</td><td>760180</td><td></td></tr><tr><td>Biological safety cabinet, class II</td><td>Thermo Scientific</td><td>1300 series, type A2</td><td></td></tr><tr><td>Micro-Isolator&amp;nbsp;Rack</td><td>RAIR&amp;nbsp;IsoSystem&amp;nbsp;</td><td>76144W</td><td>Super&amp;nbsp;Mouse&amp;nbsp;1800 AllerZone&amp;nbsp;</td></tr><tr><td>Refrigerated Microcentrifuge</td><td>Eppendorf</td><td>Legend Micro 21R</td><td></td></tr><tr><td>Microcentrifuge</td><td>Heraeus</td><td>Biofuge-pico</td><td></td></tr><tr><td>Centrifuge</td><td>Thermo Scientific</td><td>Sorval ST40R</td><td></td></tr><tr><td>CO&lt;sub&gt;2&lt;/sub&gt; Incubator&amp;nbsp;</td><td>Thermo Scientific</td><td>Model&amp;nbsp; 3111</td><td></td></tr><tr><td>Sterile Thin-tip pasteur pipettes</td><td>Deltalab</td><td>D210022</td><td></td></tr><tr><td>Sterile pasteur pipettes</td><td>Deltalab</td><td>200007</td><td></td></tr><tr><td>Sterile 24-well plate</td><td>Greiner</td><td>662160</td><td></td></tr><tr><td>Trypan Blue Solution&amp;nbsp;</td><td>Life Technologies</td><td>T10282</td><td></td></tr><tr><td>Automatic Cell Counter - Countess</td><td>Life Technologies</td><td>C10227&amp;nbsp;</td><td></td></tr><tr><td>Countess Cell Counting Chamber Slides</td><td>Life Technologies</td><td>C10312</td><td></td></tr><tr><td>Flow Cytometry Tubes</td><td>BD</td><td>343675</td><td></td></tr><tr><td>Flow Cytometer - FACS Canto-II</td><td>BD</td><td></td><td></td></tr><tr><td>Real Time PCR Instrument - Rotor Gene Q or ABI 7900</td><td>Qiagen / Applied Biosystems</td><td></td><td></td></tr><tr><td>Trizol Reagent</td><td>Life Technologies</td><td>15596-026</td><td>Molecular Biology Grade</td></tr><tr><td>DNAse-I</td><td>Life Technologies</td><td>18068-015</td><td>Molecular Biology Grade</td></tr><tr><td>DNAse-I Buffer 10X</td><td>Life Technologies</td><td>18068015</td><td>Molecular Biology Grade</td></tr><tr><td>EDTA 25 mM</td><td>Life Technologies</td><td>18068015</td><td>Molecular Biology Grade</td></tr><tr><td>Ultra-Pure Water</td><td>Life Technologies</td><td>10977</td><td>Molecular Biology Grade</td></tr><tr><td>RNAse Out</td><td>Life Technologies</td><td>100000840</td><td>Molecular Biology Grade</td></tr><tr><td>Random Hexamer Primers</td><td>Life Technologies</td><td>N8080127</td><td>Molecular Biology Grade</td></tr><tr><td>M-MLV-RT buffer</td><td>Life Technologies</td><td>18057-018</td><td>Molecular Biology Grade</td></tr><tr><td>M-MLV-RT enzime</td><td>Life Technologies</td><td>28025-021</td><td>Molecular Biology Grade</td></tr><tr><td>QuantiTect Syber Green PCR Kit</td><td>Qiagen</td><td>204143</td><td>Molecular Biology Grade</td></tr><tr><td>Specific primers&amp;nbsp;</td><td>Life Technologies</td><td></td><td>Molecular Biology Grade</td></tr></tbody></table>

sublingual immunotherapy as an alternative to induce protection against acute respiratory infections

Sublingual route has been widely used to deliver small molecules into the bloodstream and to modulate the immune response at different sites. It has been shown to effectively induce humoral and cellular responses at systemic and mucosal sites, namely the lungs and urogenital tract. Sublingual vaccination can promote protection against infections at the lower and upper respiratory tract; it can also promote tolerance to allergens and ameliorate asthma symptoms. Modulation of lung&#8217;s immune response by sublingual immunotherapy (SLIT) is safer than direct administration of formulations by intranasal route because it does not require delivery of potentially harmful molecules directly into the airways. In contrast to intranasal delivery, side effects involving brain toxicity or facial paralysis are not promoted by SLIT. The immune mechanisms underlying SLIT remain elusive and its use for the treatment of acute lung infections has not yet been explored. Thus, development of appropriate animal models of SLIT is needed to further explore its potential advantages. 
This work shows how to perform sublingual administration of therapeutic agents in mice to evaluate their ability to protect against acute pneumococcal pneumonia. Technical aspects of mouse handling during sublingual inoculation, precise identification of sublingual mucosa, draining lymph nodes and isolation of tissues, bronchoalveolar lavage and lungs are illustrated. Protocols for single cell suspension preparation for FACS analysis are described in detail. Other downstream applications for the analysis of the immune response are discussed. Technical aspects of the preparation of Streptococcus pneumoniae inoculum and intranasal challenge of mice are also explained.
SLIT is a simple technique that allows screening of candidate molecules to modulate lungs&#8217; immune response. Parameters affecting the success of SLIT are related to molecular size, susceptibility to degradation and stability of highly concentrated formulations.

Sublingual immunotherapy can be successfully used to modulate lungs&#8217; immune response. We showed that a single dose of flagellin, the TLR5 and NLRC4 agonist, can induce significant upregulation of the mRNA encoding the chemokines CXCL1, CCL20 and the cytokine IL-6 compared to saline treated controls. Fold induction of mRNA levels peaked at 8 h after SLIT and return to basal levels after 20 hr (Figure 1). However, when SLIT was performed 2 hr prior intranasal infection with S. pneumoniae, levels of Cxcl1 and Il6 mRNA remained significantly upregulated even 24 hr after SLIT compared to non-treated animals (Figure 2).
Analysis of the cell populations in BAL and lung tissue by FACS revealed that animals treated with FliC by sublingual route had increased number of neutrophils in the airways but not in the lungs&#8217; tissue (Figure 3).
Finally, survival after pneumococcal challenge was compared in animals previously treated with FliC by sublingual route or with saline as a control. As shown in Figure 4, SLIT with flagellin promoted protection and increased survival against acute pneumococcal pneumonia.
<img alt="Figure 1" fo:content-width="6.7in" src="/files/ftp_upload/52036/52036fig1highresV2.jpg" width="680" /> 
Figure 1.&#160;Kinetics of the lungs&#8217; transcriptional profile after sublingual immunotherapy with flagellin. Eight to 10 weeks old BALB/c mice (n=4) were treated with 10 &#181;g of flagellin or saline by sublingual route under anaesthesia. Lungs were collected at different time points and placed in nucleic acid preservative. Total RNA extraction was performed and cDNA was synthesized. mRNA levels were evaluated by real time PCR using specific primers listed in Table 1. Relative quantification was performed according &#916;Ct method using Actb mRNA levels for normalization. Results are shown as fold increase compared to saline treated group as median&#177;SEM. Asterisks indicate statistically significant differences (p &#60; 0.05) calculated according to Mann-Whitney test. Results are representative of 2 independent experiments.
<img alt="Figure 2" fo:content-width="6.2in" src="/files/ftp_upload/52036/52036fig2highresV2.jpg" width="660" /> 
Figure 2.&#160;Lungs&#8217; transcriptional profile during pneumococcal pneumonia after sublingual immunotherapy with flagellin. Eight to 10 weeks old BALB/c mice (n=4 for control group and n=7 for treated group) were treated with 10 &#181;g of flagellin or saline by sublingual route under anaesthesia. 2 hr later mice were challenged by intranasal route with the minimal lethal dose (MLD) causing 100% mortality of a clinical isolate of S. pneumoniae serotype 1 E1585, corresponding to 4x105 CFU/50 &#181;l. Lungs were collected 24 hr after challenge and stored in nucleic acid preservative until RNA extraction and cDNA synthesis were carried out. Real time PCR was carried out (See primer list in Table 1) and relative quantification was performed according &#916;Ct method using Actb mRNA levels for normalization. Results are shown as fold increase compared to saline treated group as median&#177;SEM. Asterisks indicate statistically significant differences (p &#60; 0.05) calculated according to Mann-Whitney test.
<img alt="Figure 3" fo:content-width="6.5in" src="/files/ftp_upload/52036/52036fig3highresV2.jpg" width="680" /> 
Figure 3.&#160;Analysis of polymorphonuclear neutrophil (PMN) recruitment in lungs&#8217; tissue and airways after SLIT. Eight to 10 weeks old BALB/c mice (n=4) were treated with 10 &#181;g of flagellin or saline by sublingual route under anaesthesia. 2 hr later mice were challenged by intranasal route with the MLD of S. pneumoniae serotype 1 E1585. 24 hr after challenge, BAL was performed and lungs were processed for FACS analysis. PMN were identified as Ly6Ghigh/CD11bhigh/CD11cnegative cells and based on the FCS-SSC profile. Results are expressed as percentage of PMN with respect of total cell numbers in BAL or lungs. Bars represent median&#177;SEM. Asterisks indicate statistically significant differences (p &#60; 0.05) calculated according to one-way Mann-Whitney test.
<img alt="Figure 4" fo:content-width="5.3in" src="/files/ftp_upload/52036/52036fig4highresV2.jpg" width="530" /> 
Figure 4.&#160;SLIT with flagellin protects mice against acute pneumococcal pneumonia. Eight to 10 weeks old BALB/c mice (n = 8) were treated with 10 &#181;g of flagellin or saline by sublingual route under anaesthesia. 2 hr later mice were challenged by intranasal route with the MLD of S. pneumoniae serotype 1 E1585. Survival was assessed on a daily basis. Kaplan-Meier curves were compared according Log-rank (Mantel-Cox) test. Asterisks indicate statistically significant differences (p &#60; 0.05).Results are representative of 2 independent experiments.
<table align="center" border="1" cellpadding="0" cellspacing="0">
	<tbody align="center">
		<tr>
			<td>Name</td>
			<td>Sequence 5&#8217;-3&#8217;</td>
			<td>PCR Product lenght (bp)</td>
		</tr>
		<tr>
			<td>mB-actin_F</td>
			<td>GCTTCTTTGCAGCTCCTTCGT</td>
			<td rowspan="2">68</td>
		</tr>
		<tr>
			<td>mB-actin_R</td>
			<td>CGTCATCCATGGCGAACTG</td>
		</tr>
		<tr>
			<td>mCCL20_F</td>
			<td>TTTTGGGATGGAATTGGACAC</td>
			<td rowspan="2">69</td>
		</tr>
		<tr>
			<td>mCCL20_R</td>
			<td>TGCAGGTGAAGCCTTCAACC</td>
		</tr>
		<tr>
			<td>mCXCL1_F</td>
			<td>CTTGGTTCAGAAAATTGTCCAAAA</td>
			<td rowspan="2">84</td>
		</tr>
		<tr>
			<td>mCXCL1_R</td>
			<td>ACGGTGCCATCAGAGCAGTCT</td>
		</tr>
		<tr>
			<td>mIL-6_F</td>
			<td>GTTCTCTGGGAAATCGTGGAAA</td>
			<td rowspan="2">78</td>
		</tr>
		<tr>
			<td>mIL-6_R</td>
			<td>AAGTGCATCATCGTTGTTCATACA</td>
		</tr>
		<tr>
			<td>mTNFalpha_F</td>
			<td>CATCTTCTCAAAATTCGAGTGACAA</td>
			<td rowspan="2">63</td>
		</tr>
		<tr>
			<td>mTNFalpha_R</td>
			<td>CCTCCACTTGGTGGTTTGCT</td>
		</tr>
		<tr>
			<td>mCxcl2_F</td>
			<td>CCCTCAACGGAAGAACCAAA</td>
			<td rowspan="2">72</td>
		</tr>
		<tr>
			<td>mCxcl2_R</td>
			<td>CACATCAGGTACGATCCAGGC</td>
		</tr>
	</tbody>
</table>
Table 1.&#160;Primer list used for real time PCR analysis. Specific primer sequences used for qPCR analysis. Forward and reverse primers for mouse actb, Cccl20, Cxcl1, Il6, Tnfa and Cxcl1 are presented as 5&#8217;-3&#8217; sequences and expected product length is indicated in base pairs (bp).

Watch this Scientific Journal Video about Sublingual Immunotherapy as an Alternative to Induce Protection Against Acute Respiratory Infections at JoVE.com

Sublingual Immunotherapy as an Alternative to Induce Protection Against Acute Respiratory Infections

The present work illustrates the convenience of using sublingual immunotherapy to boost the innate immune response in the lungs and confer protection against acute pneumococcal pneumonia in mouse.

Sublingual route has been widely used to deliver small molecules into the bloodstream and to modulate the immune response at different sites. It has been ...

sublingual-immunotherapy-as-an-alternative-to-induce-protection

Research

Education

JoVE Core

JoVE Journal

Pharmacology

Medicine

Unit 1

Other Respiratory Disorders

SCIENTISTS IN ACTION

16.8K Views.  Universidad de la República. The present work illustrates the convenience of using sublingual immunotherapy to boost the innate immune response in the lungs and confer protection against acute pneumococcal pneumonia in mouse.

Video: Sublingual Immunotherapy as an Alternative to Induce Protection Against Acute Respiratory Infections

Non-surgical Intratracheal Instillation of Mice with Analysis of Lungs and Lung Draining Lymph Nodes by Flow Cytometry

Phagocytic cells such as alveolar macrophages and lung dendritic cells (LDCs) continuously sample antigens from the alveolar spaces in the 
lungs. LDCs, in particular, are known to migrate to the lung draining lymph nodes (LDLNs) where they present inhaled antigens to T cells initiating an 
appropriate immune response to a variety of immunogens1,2. To model interactions between the lungs and airborne antigens in mice, antigens can be 
administered intranasally1,3,4, intratracheally5 or as aerosols6. Delivery by each route involves distinct technical skills and limitations that need to be 
considered before designing an experiment. For example, intranasal and aerosolized exposure delivers antigens to both the lungs and the upper respiratory 
tract. Hence antigens can access the nasal associated lymphoid tissue (NALT)7, potentially complicating interpretation of the results. In addition, swallowing, 
sneezing and the breathing rate of the mouse may also lead to inconsistencies in the doses delivered. Although the involvement of the upper respiratory tract may 
be preferred for some studies, it can complicate experiments focusing on events specifically initiated in the lungs. In this setting, the intratracheal (i.t) 
route is preferable as it delivers test materials directly into the lungs and bypasses the NALT. Many i.t injection protocols involve either blind intubation of the 
trachea through the oral cavity or surgical exposure of the trachea to access the lungs. Herein, we describe a simple, consistent, non-surgical method for i.t 
instillation. The opening of the trachea is visualized using a laryngoscope and a bent gavage needle is then inserted directly into the trachea to deliver the 
innoculum. We also describe procedures for harvesting and processing of LDLNs and lungs for analysis of antigen trafficking by flow cytometry.

We illustrate non-surgical delivery of test materials into the lungs of anesthetized mice via the trachea. This method permits lung exposure to bacterial and viral pathogens, cytokines, antibodies, beads, chemicals, or dyes. We further describe harvesting and processing of lungs and lung draining lymph nodes (LDLNs) for flow cytometry.

Phagocytic cells such as alveolar macrophages and lung dendritic cells (LDCs) continuously sample antigens from the alveolar spaces in the 
lungs. LDCs, ...

Immunology and Infection

Examining the Role of Nasopharyngeal-associated Lymphoreticular Tissue (NALT) in Mouse Responses to Vaccines

The nasopharyngeal-associated lymphoreticular tissues (NALT) found in humans, rodents, and other mammals, contribute to immunity in the nasal sinuses1-3. The NALT are two parallel bell-shaped structures located in the nasal passages above the hard palate, and are usually considered to be secondary components of the mucosal-associated lymphoid system4-6. Located within the NALT are discrete compartments of B and T lymphocytes interspersed with antigen-presenting dendritic cells4,7,8. These cells are surrounded by an epithelial cell layer intercalated with M-cells that are responsible for antigen retrieval from the mucosal surfaces of the air passages9,10. Naive lymphocytes circulating through the NALT are poised to respond to first encounters with respiratory pathogens7. While NALT disappear in humans by the age of two years, the Waldeyer's Ring and similarly structured lymphatic organs continue to persist throughout life6. In contrast to humans, mice retain NALT throughout life, thus providing a convenient animal model for the study of immune responses originating within the nasal sinuses11.
Cultures of single-cell suspensions of NALT are not practical due to low yields of mononuclear cells. However, NALT biology can be examined by ex vivo culturing of the intact organ, and this method has the additional advantage of maintaining the natural tissue structure. For in vivo studies, genetic knockout models presenting defects limited to NALT are not currently available due to a poor understanding of the developmental pathway. For example, while lymphotoxin-&alpha; knockout mice have atrophied NALT, the Peyer's patches, peripheral lymph nodes, follicular dendritic cells and other lymphoid tissues are also altered in these genetically manipulated mice12,13. As an alternative to gene knockout mice, surgical ablation permanently eliminates NALT from the nasal passage without affecting other tissues. The resulting mouse model has been used to establish relationships between NALT and immune responses to vaccines1,3. Serial collection of serum, saliva, nasal washes and vaginal secretions is necessary for establishing the basis of host responses to vaccination, while immune responses originating directly from NALT can be confirmed by tissue culture. The following procedures outline the surgeries, tissue culture and sample collection necessary to examine local and systemic humoral immune responses to intranasal (IN) vaccination.

Examining the Role of Nasopharyngeal-associated Lymphoreticular Tissue NALT in Mouse Responses to Vaccines

Methods to examine contributions of the nasopharyngeal-associated lymphoreticular tissues (NALT) to nasal and systemic immune responses of mice to intranasal vaccines are described. We demonstrate a surgical procedure to establish a NALT-dependent mouse model and ex vivo cultures of extracted NALT.

The nasopharyngeal-associated lymphoreticular tissues (NALT) found in humans, rodents, and other mammals, contribute to immunity in the nasal sinuses1-3. ...

Intralymphatic Immunotherapy and Vaccination in Mice

Vaccines are typically injected subcutaneously or intramuscularly for stimulation of immune responses. The success of this requires efficient drainage of vaccine to lymph nodes where antigen presenting cells can interact with lymphocytes for generation of the wanted immune responses. The strength and the type of immune responses induced also depend on the density or frequency of interactions as well as the microenvironment, especially the content of cytokines. As only a minute fraction of peripherally injected vaccines reaches the lymph nodes, vaccinations of mice and humans were performed by direct injection of vaccine into inguinal lymph nodes, i.e.&#160;intralymphatic injection. In man, the procedure is guided by ultrasound. In mice, a small (5-10 mm) incision is made in the inguinal region of anesthetized animals, the lymph node is localized and immobilized with forceps, and a volume of 10-20 &#956;l of the vaccine is injected under visual control. The incision is closed with a single stitch using surgical sutures. Mice were vaccinated with plasmid DNA, RNA, peptide, protein, particles, and bacteria as well as adjuvants, and strong improvement of immune responses against all type of vaccines was observed. The intralymphatic method of vaccination is especially appropriate in situations where conventional vaccination produces insufficient immunity or where the amount of available vaccine is limited.

Prophylactic and therapeutic vaccination often fails to stimulate strong immune responses due to week drainage of the vaccine to lymph nodes and consequently poor involvement of immune cells. By direct injection of vaccine to lymph nodes, so-called intralymphatic injection, vaccine efficacy can be strongly improved and vaccine doses can be reduced.

Vaccines are typically injected subcutaneously or intramuscularly for stimulation of immune responses. The success of this requires efficient drainage of ...

Intubation-mediated Intratracheal (IMIT) Instillation: A Noninvasive, Lung-specific Delivery System

Respiratory disease studies typically involve the use of murine models as surrogate systems. However, there are significant physiologic differences between the murine and human respiratory systems, especially in their upper respiratory tracts (URT). In some models, these differences in the murine nasal cavity can have a significant impact on disease progression and presentation in the lower respiratory tract (LRT) when using intranasal instillation techniques, potentially limiting the usefulness of the mouse model to study these diseases. For these reasons, it would be advantageous to develop a technique to instill bacteria directly into the mouse lungs in order to study LRT disease in the absence of involvement of the URT. We have termed this lung specific delivery technique intubation-mediated intratracheal (IMIT) instillation. This noninvasive technique minimizes the potential for instillation into the bloodstream, which can occur during more invasive traditional surgical intratracheal infection approaches, and limits the possibility of incidental digestive tract delivery. IMIT is a two-step process in which mice are first intubated, with an intermediate step to ensure correct catheter placement into the trachea, followed by insertion of a blunt needle into the catheter to mediate direct delivery of bacteria into the lung. This approach facilitates a &#62;98% efficacy of delivery into the lungs with excellent distribution of reagent throughout the lung. Thus, IMIT represents a novel approach to study LRT disease and therapeutic delivery directly into the lung, improving upon the ability to use mice as surrogates to study human respiratory disease. Furthermore, the accuracy and reproducibility of this delivery system also makes it amenable to Good Laboratory Practice Standards (GLPS), as well as delivery of a wide range of reagents which require high efficiency delivery to the lung.

Intubation-mediated Intratracheal IMIT Instillation: A Noninvasive, Lung-specific Delivery System

Intubation-mediated intratracheal (IMIT) instillation of reagents is an excellent, noninvasive method for studying respiratory disease, as well as a method for instilling therapeutic reagents directly into the lung. It is a rapid and highly reproducible method which is suitable for preclinical testing.

Respiratory disease studies typically involve the use of murine models as surrogate systems. However, there are significant physiologic differences ...

Intra-tracheal Administration of Haemophilus influenzae in Mouse Models to Study Airway Inflammation

Here, we describe a detailed procedure to efficiently and directly deliver Haemophilus influenzae into the lower respiratory tracts of mice. We demonstrate the procedure for preparing H. influenzae inoculum, intra-tracheal instillation of H. influenzae into the lung, collection of broncho-alveolar lavage fluid (BALF), analysis of immune cells in the BALF, and RNA isolation for differential gene expression analysis. This procedure can be used to study the lung inflammatory response to any bacteria, virus or fungi. Direct tracheal instillation is mostly preferred over intranasal or aerosol inhalation procedures because it more efficiently delivers the bacterial inoculum into the lower respiratory tract with less ambiguity.

Intra-tracheal Administration of Haemophilus influenzae in Mouse Models to Study Airway Inflammation

We demonstrate the procedure for intra-tracheal inoculation of Haemophilus influenzae into the lower respiratory tracts of mice. This is a very useful tool to study signaling pathways that regulate airway inflammation in mouse models.

Here, we describe a detailed procedure to efficiently and directly deliver Haemophilus influenzae into the lower respiratory tracts of mice. We ...

Protective Efficacy and Pulmonary Immune Response Following Subcutaneous and Intranasal BCG Administration in Mice

Despite global coverage of intradermal BCG vaccination, tuberculosis remains one of the most prevalent infectious diseases in the world. Preclinical data have encouraged pulmonary tuberculosis vaccines as a promising strategy to prevent pulmonary disease, which is responsible for transmission. In this work, we describe the methodology used to demonstrate in the mouse model the benefits of intranasal BCG vaccination when compared to subcutaneous. Our data revealed greater protective efficacy following intranasal BCG administration. In addition, our results indicate that pulmonary vaccination triggers a higher immune response in lungs, including Th1 and Th17 responses, as well as an increase of immunoglobulin A (IgA) concentration in respiratory airways. Our data show correlation between protective efficacy and the presence of IL17-producing cells in lungs post-Mycobacterium tuberculosis challenge, suggesting a role for this cytokine in the protective response conferred by pulmonary vaccination. Finally, we detail the global workflow we have developed to study respiratory vaccination in the mouse model, which could be extrapolated to other tuberculosis vaccines, apart from BCG, targeting the mucosal response or other pulmonary routes of administration such as the intratracheal or aerosol.

We herein detail the methodology followed to compare protective efficacy and lung immune response induced by intranasal and subcutaneous immunization with BCG in mouse model. Our results show the benefits of pulmonary vaccination and suggest a role for IL17-mediated response in vaccine-induced protection.

Despite global coverage of intradermal BCG vaccination, tuberculosis remains one of the most prevalent infectious diseases in the world. Preclinical data ...

Noninvasive Sampling of Mucosal Lining Fluid for the Quantification of In Vivo Upper Airway Immune-mediator Levels

This protocol describes noninvasive sampling of undisturbed upper airway mucosal lining fluid. It also details the extraction procedure used prior to the analysis of immune mediators in fluid eluates for the study of the airway topical immune signature, without the need for stimulation procedures (often used by other techniques). The mucosal lining fluid is sampled on a strip of filter paper placed at the anterior part of the inferior turbinate and left for 2 min of absorption. Analytes are eluted from the filter papers, and the extracted protein-based eluates are analyzed by an electrochemiluminescence-based immunoassay, allowing for the high-sensitivity quantification of low- and high-level analytes in the same sample. We measured the in vivo levels of 20 preselected immune mediators related to specific immune signaling pathways in the upper airway mucosa, but the technique is not limited to that specific panel or sampling site. The technique was first implemented in 7-year-old children from the Copenhagen Prospective Studies on Asthma in Childhood2000 (COPSAC2000) cohort with allergic rhinitis. It was thereafter used in the longitudinal COPSAC2010 birth cohort, sampled at 1 month, 2 years, and 6 years of age and at instances of acute respiratory symptoms. We successfully obtained and analyzed samples from 620 (89%) of 700 1-month-old children; a few samples were below the assay detection limit (reported as the median (Inter-Quartile Range (IQR)). The number of samples below the detection limit (i.e.&#160;from 0 to the set point for the lower limit of detection) for each mediator was 29 (7.25 - 119.5). This technique enables the quantification of the in vivo airway mucosal immune profile from birth, can be applied longitudinally, and can be applied to studies on the effect of genetics and early-life environmental exposures, pathophysiology, endotyping, and monitoring of respiratory diseases, and development and evaluation of novel therapeutics.

Noninvasive Sampling of Mucosal Lining Fluid for the Quantification of In Vivo Upper Airway Immune-mediator Levels

This protocol describes a noninvasive technique for the sampling of undisturbed mucosal lining fluid from the upper airways. It can be used to perform the quantification of in vivo levels of protein mediators, such as cytokines and chemokines, in subjects of all ages.

This protocol describes noninvasive sampling of undisturbed upper airway mucosal lining fluid. It also details the extraction procedure used prior to the ...

Antigenic Liposomes for Generation of Disease-specific Antibodies

Antibody responses provide critical protective immunity to a wide array of pathogens. There remains a high interest in generating robust antibodies for vaccination as well as understand how pathogenic antibody responses develop in allergies and autoimmune disease. Generating robust antigen-specific antibody responses is not always trivial. In mouse models, it often requires multiple rounds of immunizations with adjuvant that leads to a great deal of variability in the levels of induced antibodies. One example is in mouse models of peanut allergies where more robust and reproducible models that minimize mouse numbers and the use of adjuvant would be beneficial. Presented here is a highly reproducible mouse model of peanut allergy anaphylaxis. This new model relies on two key factors: (1) antigen-specific splenocytes are adoptively transferred from a peanut-sensitized mouse into a na&#239;ve recipient mouse, normalizing the number of antigen-specific memory B- and T-cells across a large number of mice; and (2) recipient mice are subsequently boosted with a strong multivalent immunogen in the form of liposomal nanoparticles displaying the major peanut allergen (Ara h 2). The major advantage of this model is its reproducibility, which ultimately lowers the number of animals used in each study, while minimizing the number of animals receiving multiple injections of adjuvant. The modular assembly of these immunogenic liposomes provides relatively facile adaptability to other allergic or autoimmune models that involve pathogenic antibodies.

Described is the preparation of antigenic liposomal nanoparticles and their use in stimulating B-cell activation in vitro and in vivo. Consistent and robust antibody responses led to the development of a new peanut allergy model. The protocol for generating antigenic liposomes can be extended to different antigens and immunization models.

Antibody responses provide critical protective immunity to a wide array of pathogens. There remains a high interest in generating robust antibodies for ...

Evaluation of Host-Pathogen Responses and Vaccine Efficacy in Mice

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a striking increase in life expectancy around the globe. Nonetheless, determining vaccine efficacy remains a challenge. Emerging evidence suggests that the current acellular vaccine (aPV) for Bordetella pertussis (B. pertussis) induces suboptimal immunity. Therefore, a major challenge is designing a next-generation vaccine that induces protective immunity without the adverse side effects of a whole-cell vaccine (wPV). Here we describe a protocol that we used to test the efficacy of a promising, novel adjuvant that skews immune responses to a protective Th1/Th17 phenotype and promotes a better clearance of a B. pertussis challenge from the murine respiratory tract. This article describes the protocol for mouse immunization, bacterial inoculation, tissue harvesting, and analysis of immune responses. Using this method, within our model, we have successfully elucidated crucial mechanisms elicited by a promising, next-generation acellular pertussis vaccine. This method can be applied to any infectious disease model in order to determine vaccine efficacy.

Here we present an elegant protocol for in vivo evaluation of vaccine effectiveness and host immune responses. This protocol can be adapted for vaccine models that study viral, bacterial, or parasitic pathogens.

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a ...

Intranasal Immunization and Milk Collection in Studies of Maternal Immunization in New Zealand White Rabbits (Oryctolagus cuniculus)

Due to similarities in placentation and antibody transfer with humans, rabbits are an excellent model of maternal immunization. Additional advantages of this research model are the ease of breeding and sample collection, relatively short gestation period, and large litter sizes. Commonly assessed routes of immunization include subcutaneous, intramuscular, intranasal, and intradermal. Nonterminal sample collection for the chronological detection of the immunologic responses to these immunizations include the collection of blood, from both dams and kits, and milk from the lactating does. In this article, we will demonstrate techniques our lab has utilized in studies of maternal immunization in New Zealand White rabbits (Oryctolagus cuniculus), including intranasal immunization and milk collection.

Intranasal Immunization and Milk Collection in Studies of Maternal Immunization in New Zealand White Rabbits Oryctolagus cuniculus

This article describes and demonstrates the administration of intranasal vaccines and the collection of milk from lactating rabbits (Oryctolagus cuniculus) as a means to assess mucosal immunity in a translationally appropriate model of maternal immunization.

Due to similarities in placentation and antibody transfer with humans, rabbits are an excellent model of maternal immunization. Additional advantages of ...

Sublingual Immunotherapy as an Alternative to Induce Protection Against Acute Respiratory Infections

Summary

Explore More Videos

Chapters in this video

Non-surgical Intratracheal Instillation of Mice with Analysis of Lungs and Lung Draining Lymph Nodes by Flow Cytometry

Examining the Role of Nasopharyngeal-associated Lymphoreticular Tissue (NALT) in Mouse Responses to Vaccines

Intralymphatic Immunotherapy and Vaccination in Mice

Intubation-mediated Intratracheal (IMIT) Instillation: A Noninvasive, Lung-specific Delivery System

Intra-tracheal Administration of Haemophilus influenzae in Mouse Models to Study Airway Inflammation

Protective Efficacy and Pulmonary Immune Response Following Subcutaneous and Intranasal BCG Administration in Mice

Noninvasive Sampling of Mucosal Lining Fluid for the Quantification of In Vivo Upper Airway Immune-mediator Levels

Antigenic Liposomes for Generation of Disease-specific Antibodies

Evaluation of Host-Pathogen Responses and Vaccine Efficacy in Mice

Intranasal Immunization and Milk Collection in Studies of Maternal Immunization in New Zealand White Rabbits (Oryctolagus cuniculus)