We acknowledge Dr. Jean-Claude Sirard from the Center for Infection and Immunity of Lille, Institute Pasteur de Lille-France, for kindly providing the purified flagellin and Dr. Teresa Camou, Director of the National Reference Laboratory, Ministry of Health of Uruguay for kindly providing the pneumococcal strain. 
The authors would like to express their acknowledgement to Mr. Diego Acosta and Mr. Ignacio Turel form BichoFeo Producciones-Uruguay for their commitment and hard work during the entire video production and edition. 
This work was supported by the grants PR_FCE_2009_1_2783 and BE_POS_2010_1_2544 from the National Agency of Research and Innovation, ANII from Uruguay, the Program for Development of Basic Sciences, PEDECIBA of Uruguay and Sectoral Commission of Scientific research, CSIC-Universidad de la Rep&#250;blica, Uruguay.

<ol>
	<li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pneumococcal+vaccines+WHO+position+paper--2012.">Pneumococcal vaccines WHO position paper--2012.</a> Weekly Epidemiological Record. 14, 129-144 (2012).</li><li>Appelbaum, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carriage+of+antibiotic-resistant+Streptococcus+pneumoniae+by+children+in+eastern+and+central+Europe-a+multicenter+study+with+use+of+standardized+methods.">Carriage of antibiotic-resistant Streptococcus pneumoniae by children in eastern and central Europe-a multicenter study with use of standardized methods.</a> Clin Infect Dis. 23, 712-717 (1996).</li><li>Ramirez, J. A., Anzueto, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changing+needs+of+community-acquired+pneumonia.">Changing needs of community-acquired pneumonia.</a> J Antimicrob Chemother. 66, 3-9 (2011).</li><li>Cuburu, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sublingual+immunization+induces+broad-based+systemic+and+mucosal+immune+responses+in+mice.">Sublingual immunization induces broad-based systemic and mucosal immune responses in mice.</a> Vaccine. 25, 8598-8610 (2007).</li><li>Pedersen, G. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+sublingual+route+for+administration+of+influenza+H5N1+virosomes+in+combination+with+the+bacterial+second+messenger+c-di-GMP.">Evaluation of the sublingual route for administration of influenza H5N1 virosomes in combination with the bacterial second messenger c-di-GMP.</a> PLoS One. 25, 1-12 (2011).</li><li>Song, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sublingual+vaccination+with+influenza+virus+protects+mice+against+lethal+viral+infection.">Sublingual vaccination with influenza virus protects mice against lethal viral infection.</a> Proc Natl Acad Sci USA. 105, 1644-1649 (2008).</li><li>Cogo, R., Ramponi, A., Scivoletto, G., Rippoli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prophylaxis+for+acute+exacerbations+of+chronic+bronchitis+using+an+antibacterial+sublingual+vaccine+obtained+through+mechanical+lysis:+a+clinical+and+pharmacoeconomic+study.">Prophylaxis for acute exacerbations of chronic bronchitis using an antibacterial sublingual vaccine obtained through mechanical lysis: a clinical and pharmacoeconomic study.</a> Acta Biomed. 74, 76-87 (2003).</li><li>Rosaschino, F., Cattaneo, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+optimizing+compliance+of+paediatric+patients+for+seasonal+antibacterial+vaccination+with+sublingually+administered+Polyvalent+Mechanical+Bacterial+Lysates+(PMBL).">Strategies for optimizing compliance of paediatric patients for seasonal antibacterial vaccination with sublingually administered Polyvalent Mechanical Bacterial Lysates (PMBL).</a> Acta Biomed. 75, 171-178 (2004).</li><li>Senna, G., Caminati, M., Canonica, G. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Safety+and+tolerability+of+sublingual+immunotherapy+in+clinical+trials+and+real+life.">Safety and tolerability of sublingual immunotherapy in clinical trials and real life.</a> Curr Opin Allergy Clin Immunol. 13, 656-662 (2013).</li><li>Mascarell, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+dendritic+cells+mediate+antigen-specific+tolerance+by+stimulating+TH1+and+regulatory+CD4++T+cells.">Oral dendritic cells mediate antigen-specific tolerance by stimulating TH1 and regulatory CD4+ T cells.</a> J Allergy Clin Immunol. 122, 603-609 (2008).</li><li>Mascarell, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+of+the+lingual+immune+system+reveals+the+presence+of+both+regulatory+and+effector+CD4++T+cells.">Mapping of the lingual immune system reveals the presence of both regulatory and effector CD4+ T cells.</a> Clin Exp Allergy. 39, 1910-1919 (2009).</li><li>Mascarell, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+macrophage-like+cells+play+a+key+role+in+tolerance+induction+following+sublingual+immunotherapy+of+asthmatic+mice.">Oral macrophage-like cells play a key role in tolerance induction following sublingual immunotherapy of asthmatic mice.</a> Mucosal Immunology. 4, 638-647 (2011).</li><li>Hervouet, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigen-bearing+dendritic+cells+from+the+sublingual+mucosa+recirculate+to+distant+systemic+lymphoid+organs+to+prime+mucosal+CD8+T+cells.">Antigen-bearing dendritic cells from the sublingual mucosa recirculate to distant systemic lymphoid organs to prime mucosal CD8 T cells.</a> Mucosal Immunology. 7, 280-291 (2014).</li><li>Munoz, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mucosal+administration+of+flagellin+protects+mice+from+Streptococcus+pneumoniae+lung+infection.">Mucosal administration of flagellin protects mice from Streptococcus pneumoniae lung infection.</a> Infect Immun. 78, 4226-4233 (2010).</li><li>Hayashi, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+innate+immune+response+to+bacterial+flagellin+is+mediated+by+Toll-like+receptor+5.">The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5.</a> Nature. 410, 1099-1103 (2001).</li><li>Lightfield, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+function+for+Naip5+in+inflammasome+activation+by+a+conserved+carboxy-terminal+domain+of+flagellin.">Critical function for Naip5 in inflammasome activation by a conserved carboxy-terminal domain of flagellin.</a> Nature Immunology. 9, 1171-1178 (2008).</li><li>Lightfield, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+requirements+for+NAIP5+in+activation+of+the+NLRC4+inflammasome.">Differential requirements for NAIP5 in activation of the NLRC4 inflammasome.</a> Infect Immun. 79, 1606-1614 (2011).</li><li>Honko, A. N., Mizel, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mucosal+administration+of+flagellin+induces+innate+immunity+in+the+mouse+lung.">Mucosal administration of flagellin induces innate immunity in the mouse lung.</a> Infect Immun. 72, 6676-6679 (2004).</li><li>Janot, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Radioresistant+cells+expressing+TLR5+control+the+respiratory+epithelium's+innate+immune+responses+to+flagellin.">Radioresistant cells expressing TLR5 control the respiratory epithelium's innate immune responses to flagellin.</a> Eur J Immunol. 39 (6), 1587-1596 (2009).</li><li>Van Maele, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TLR5+signaling+stimulates+the+innate+production+of+IL-17+and+IL-22+by+CD3(neg)CD127++immune+cells+in+spleen+and+mucosa.">TLR5 signaling stimulates the innate production of IL-17 and IL-22 by CD3(neg)CD127+ immune cells in spleen and mucosa.</a> J Immunol. 185, 1177-1185 (2010).</li><li>Lee, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neurologic+adverse+events+following+influenza+A+(H1N1)+vaccinations+in+children.">Neurologic adverse events following influenza A (H1N1) vaccinations in children.</a> Pediatrics international: official journal of the Japan Pediatric Society. 54, 325-330 (2012).</li><li>Lewis, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+facial+nerve+paralysis+(Bell's+palsy)+following+intranasal+delivery+of+a+genetically+detoxified+mutant+of+Escherichia+coli+heat+labile+toxin.">Transient facial nerve paralysis (Bell's palsy) following intranasal delivery of a genetically detoxified mutant of Escherichia coli heat labile toxin.</a> PLoS One. 4, e6999 (2009).</li><li>Mutsch, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+the+inactivated+intranasal+influenza+vaccine+and+the+risk+of+Bell's+palsy+in+Switzerland.">Use of the inactivated intranasal influenza vaccine and the risk of Bell's palsy in Switzerland.</a> N Engl J Med. 350, 896-903 (2004).</li><li>Kuo, C. H., Wang, W. L., Chu, Y. T., Lee, M. S., Hung, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sublingual+immunotherapy+in+children:+an+updated+review.">Sublingual immunotherapy in children: an updated review.</a> Pediatr Neonatol. 50, 44-49 (2009).</li><li>Nempont, C., Cavet, D., Rumbo, M., Bompard, C., Villeret, V., Sirard, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deletion+of+flagellin's+hypervariable+region+abrogates+antibody-mediated+neutralization+and+systemic+activation+of+TLR5-dependent+immunity.">Deletion of flagellin's hypervariable region abrogates antibody-mediated neutralization and systemic activation of TLR5-dependent immunity.</a> J. Immunol. 181, 2036-2043 (2008).</li><li>Marques, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protection+against+Streptococcus+pneumoniae+serotype+1+acute+infection+shows+a+signature+of+Th17-+and+IFN-gamma-mediated+immunity.">Protection against Streptococcus pneumoniae serotype 1 acute infection shows a signature of Th17- and IFN-gamma-mediated immunity.</a> Immunobiology. 217, 420-429 (2012).</li><li>Stewart, C. C., Stewart, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Titering+antibodies.">Titering antibodies.</a> Current Protocols in Cytometry. 4, Unit 4.1 (2001).</li><li>Kubista, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+real-time+polymerase+chain+reaction.">The real-time polymerase chain reaction.</a> Molecular Aspects of Medicine. 27, 95-125 (2006).</li><li>Pedersen, G., Cox, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mucosal+vaccine+quandary:+intranasal+vs.+sublingual+immunization+against+influenza.">The mucosal vaccine quandary: intranasal vs. sublingual immunization against influenza.</a> Human Vaccines &amp; Immunotherapeutics. 8, 689-693 (2012).</li><li>Vitaliti, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mucosal+immunity+and+sublingual+immunotherapy+in+respiratory+disorders.">Mucosal immunity and sublingual immunotherapy in respiratory disorders.</a> Journal of Biological Regulators and Homeostatic Agents. 26, S85-S93 (2012).</li></ol>

The authors have nothing to disclose.

A administração sublingual de agentes terapêuticos tem sido provado como um meio útil para modular a resposta imunitária no tracto respiratório. A principal vantagem de ITSL para o tratamento de doenças respiratórias é de que não envolve a entrega directa de compostos para os pulmões ou nariz, sendo mais seguro do que os tratamentos baseados em administração intranasal 31. Imunoterapia sublingual pode ser utilizado para modular a resposta imunitária de diferentes maneiras, quer para a indução de respostas de regulação que pode melhorar os sintomas da inflamação alérgica e asma 32 ou para induzir a activação transiente de mecanismos da imunidade inata para o tratamento de infecções pulmonares agudas, como mostrado aqui. O modelo de rato apresentadas nesta vídeo é um método conveniente para o rastreio de compostos, como agentes terapêuticos para a ITSL. Este modelo animal oferece um meio útil para determinar o impactode corte na resposta imune dos pulmões, bem como noutros órgãos (por exemplo,. nódulos linfáticos drenantes ou mucosas distais) que não podem ser imitados pela utilização de modelos in vitro. Apesar de existirem vários trabalhos que descrevem os resultados obtidos com a imunoterapia sublingual, métodos de aplicação dos procedimentos de administração sublingual não foram disponibilizados ainda. Além disso, o modelo pode ser utilizado para a avaliação de vacinas sublinguais destinadas a conferir protecção sistémica, bem como local no trato respiratório. Como mostrado no vídeo acompanhante, administração sublingual de compostos é um processo simples que pode ser facilmente realizada sem a necessidade de formação extensiva. Tipicamente, uma pessoa competente na manipulação dos animais requer 1 hora para efectuar a ITSL num grupo de 10 ratinhos usando anestésicos injectáveis, tal como descrito no presente protocolo. Se desafio pneumocócica é realizada, bem como, 90 minutos adicionais serão necessários para preparara suspensão bacteriana e executar intranasal desafio dos animais. Os protocolos FACS aqui apresentados permitem a caracterização conveniente de impacto da SLIT no site local de administração, os linfonodos de drenagem, bem como seus efeitos sobre a dinâmica das células dos pulmões. A análise separada do parênquima pulmonar e conteúdo broncoalveolar é importante para discriminar residente imune as vias aéreas e se infiltrar tipos de células a partir de aqueles que permanecem dentro do tecido. A análise do conteúdo BAL permite o estudo da rotatividade dos macrófagos alveolares bem como a dinâmica do recrutamento de células para os espaços alveolares induzidas por diferentes tratamentos, por exemplo,. PMN, eosinófilos, monócitos. BAL também pode ser usado para avaliar a presença de citocinas e quimiocinas secretadas por Enzyme-linked Immunosorbent Assay (ELISA) ou de detecção de anticorpos IgA segregados induzidos após a vacinação sublingual. Estudo de tecido dos pulmõesvai permitir a caracterização de outros tipos de células, as células dendríticas, classicamente, células T e células B. Preparação de amostras de BAL e nódulos linfáticos para análise FACS é simples. Após a coleta da amostra, normalmente 60 minutos são necessários para completar o protocolo de coloração por 10-20 amostras. Em contraste, o isolamento de células a partir de tecido dos pulmões ou sublingual estarão requerem mais tempo que é necessária a digestão da matriz extracelular. Absorção do agente terapêutico entregues por via sublingual pode ser abordada por rastreamento de moléculas fluorescente ou marcadas radioactivamente usando em sistemas de imagem vivo. Imunoterapia sublingual é um método atraente para induzir eficazmente respostas imunes no tracto respiratório, bem como sistemicamente que pode ser usado para tratar ou prevenir doenças respiratórias. A elucidação dos mecanismos que determinam a activação vs tolerância da resposta imunitária no tracto respiratório após a ITSL ié essencial para permitir que o desenho racional de novas estratégias terapêuticas que podem ser utilizados sozinhos ou em combinação com tratamentos disponíveis contra diferentes condições respiratórias.

The overall goal of this work is to illustrate the benefits of sublingual immunotherapy for the treatment of acute respiratory infections (ARI) and present the advantages of this delivery route compared to other routes of administration, namely intranasal.
ARI cause millions of deaths every year especially in children under five. Streptococcus pneumoniae remains as one of the major etiological agents of bacterial pneumonia in infants and the elderly1,2. To present, the main available treatment relies on the use of antibiotics but resistant strains are continuously arising3,4.
SLIT induces broad responses at systemic and also mucosal level, particularly at the respiratory tract5. It has proven effectiveness against influenza infection, promoting long term protection with production of humoral and cellular responses6,7. Besides, it has been shown that prophylactic treatment with bacterial lysates delivered by sublingual route reduced exacerbations of chronic obstructive bronchitis in the elderly8 and prevented recurrent respiratory infections in children9. SLIT has been widely used for the treatment of allergies and asthma. Clinical studies had not only demonstrated its efficacy to modulate the immune response in the respiratory tract but also its safety10. Despite the growing interest of pharmaceutical companies and researchers in SLIT, the mechanisms involved in the induction of mucosal immune responses after sublingual delivery of compounds remain obscure. Recently, attention has been focused on the mechanisms promoting tolerance associated with allergen desensitization. It has been proposed that resident and recruited cells at the sublingual mucosa, like dendritic cells and macrophages, can promote tolerance after SLIT11-13. Dendritic cells of the oral mucosa can promote IFN-gamma and IL-10 producing T helper cells11 as well as recirculate to the distal genital mucosa and promote CD8+ T cells14. However, little is known about the impact of SLIT on innate cells or its capacity to improve pathogen clearance during acute respiratory infections.
The natural control of pneumococcal infection in the lungs greatly depends on the efficient and swift activation of local innate defences. We previously showed that enhancement of lungs&#8217; innate immunity by a single intranasal dose of flagellin (FliC), a TLR5 and NLRC4 agonist, protects 75-100% of mice challenged with a lethal dose of a clinical isolate of Streptococcus pneumoniae serotype 1. This protection was shown to be dependent on local recruitment of GR1+ cells (likely polymorphonuclear neutrophils, PMNs) and not dependent on antibodies, B or T cells15. 
Flagellin is the structural component of the bacterial flagellum. In its monomeric form it is recognized by two Pathogen Recognition Receptors (PRRs), TLR5 that senses extracellular FliC16 and NLRC4/NAIP5 inflammasome that detects intracellular flagellin17,18. When FliC is sensed by the PRRs an important inflammatory response is triggered. We and others have demonstrated that instillation of purified FliC from Salmonella enterica serovar Typhimurium into the lungs drives swift production of chemokines and cytokines specially when recognized by the lungs&#8217; epithelium that in turn orchestrate the recruitment of immune cells into the airways, mainly PMNs15,19-21. Although transient, the substantial neutrophil infiltration that takes place into the airways after nasal delivery of FliC could be a concern if moving towards clinical therapies for human use. Excessive inflammation could be detrimental for the lungs&#8217; function. Moreover, it has been shown that intranasal delivery of immunostimulatory molecules may cause facial paralysis and/or brain toxicity22-24. 
Sublingual immunotherapy offers a safer alternative to modulate the immune response in the respiratory tract compared to the intranasal route. It is non-invasive, painless, simple and has good patient compliance25. Furthermore, as mentioned before, it can induce protective responses in the respiratory mucosa without the risks associated to direct intranasal or intrapulmonary delivery of formulations. Sublingual route could be alternatively used to deliver molecules that have great effects onto the lung&#8217;s immune system but that have been proven to be toxic or to elicit great inflammation when administered intranasally. Besides these advantages, formulations for sublingual immunotherapy have lower cost of manufacture since non-sterile products can be delivered by this route and endotoxic shock is not a concern for SLIT. On the other hand, it is worth noticing that higher doses of the immunostimulatory compounds compared to those used by intranasal or parenteral routes are necessary to induce an immune response in the lungs; also highly concentrated solutions are needed when using the mouse model of SLIT since the anatomical site where the formulations are deposited is small. 
Based on our previous published data, we developed a model of protection using sublingual immunotherapy with flagellin as model immunostimulant. We demonstrated that a single dose of flagellin induced 60% survival against invasive pneumococcal pneumonia caused by the serotype 1 strain while all mice in the control group died of infection within 5 days. Flow cytometry analysis showed that higher numbers of PMN are recruited into the airways of protected animals after sublingual treatment with flagellin suggesting that these cells might be involved in the mechanism of protection induced by sublingual immunotherapy. 
This video shows in detail how to perform sublingual immunotherapy and also how to recover relevant tissue from the sublingual mucosa, draining lymph nodes as well as lungs and airways to perform further analysis. Additionally, it illustrates the general technique of cell preparation for FACS analysis and briefly shows how to prepare Streptococcus pneumoniae suspensions and how to perform intranasal infections in mouse to set up the acute infection model.

<table border="0" cellpadding="0" cellspacing="0" width="992">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Name of Material/ Equipment</td>
			<td style="width:212px;">Company</td>
			<td style="width:141px;">Catalog Number</td>
			<td style="width:245px;">Comments/Description</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Ketamine solution (50 mg/ml)</td>
			<td style="width:212px;">Pharma Service, Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Xilacine solution (2 %)</td>
			<td style="width:212px;">Portinco S.A., Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Sterile 1ml syringe</td>
			<td style="width:212px;">Modern, Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Sterile 27G needle</td>
			<td style="width:212px;">Modern, Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">RPMI 1640</td>
			<td style="width:212px;">General Electric Health Care</td>
			<td style="width:141px;">E15885</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Fetal Bovine Serum</td>
			<td style="width:212px;">ATCC</td>
			<td style="width:141px;">302020</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Penicillin/Streptimycin Solution</td>
			<td style="width:212px;">SIGMA</td>
			<td style="width:141px;">P4333</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:395px;">Sterile PBS without Ca2+/Mg2+</td>
			<td style="width:212px;">PAA</td>
			<td style="width:141px;">H21002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Type-I Collagenase</td>
			<td>Life Technologies/Gibco</td>
			<td style="width:141px;">17100017</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Deoxyribonuclease I (DNAse-I)</td>
			<td>SIGMA</td>
			<td style="width:141px;">D4513</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Dispase</td>
			<td>Life Technologies/Gibco</td>
			<td>17105041</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">PerCP-Cy5.5 conjugated rat anti mouse IgG2b anti CD11b</td>
			<td style="width:212px;">BD</td>
			<td style="width:141px;">550993</td>
			<td style="width:245px;">Clone M1/70</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">APC conjugated hamster anti mouse IgG1 anti CD11c</td>
			<td style="width:212px;">BD</td>
			<td style="width:141px;">550261</td>
			<td style="width:245px;">Clone HL3&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">APC-Cy7 conjugated rat anti mouse IgG2a anti Ly6G</td>
			<td style="width:212px;">BD</td>
			<td style="width:141px;">560600</td>
			<td style="width:245px;">Clone 1A8</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:395px;">Sterile Saline Solution</td>
			<td style="width:212px;">Laboratorio Farmaco Uruguayo, Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td style="width:245px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Tryptic Soy Agar</td>
			<td style="width:212px;">BD Difco, France</td>
			<td style="width:141px;">236950</td>
			<td style="width:245px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Defibrinated Sheep Blood</td>
			<td style="width:212px;">Biokey, Uruguay</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">Sterile Petri Dishes</td>
			<td style="width:212px;">Greiner</td>
			<td style="width:141px;">633180</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">p10 Pipette</td>
			<td style="width:212px;">Gilson</td>
			<td style="width:141px;">F144802</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:395px;">P20 Pipette</td>
			<td>Eppendorf</td>
			<td style="width:141px;">3120000097</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p200 Pipette</td>
			<td style="width:212px;">Gilson</td>
			<td style="width:141px;">F123601</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p200 Pipette</td>
			<td style="width:212px;">Capp</td>
			<td style="width:141px;">C200</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p200 Pipette</td>
			<td>Eppendorf</td>
			<td style="width:141px;">3120000054</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p1000 Pipette</td>
			<td>Eppendorf</td>
			<td style="width:141px;">3120000062</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile Filter Tips P10</td>
			<td>Greiner</td>
			<td>771288</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile Filter Tips P200</td>
			<td>Greiner</td>
			<td>739288</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile Filter Tips P1000</td>
			<td>Greiner</td>
			<td>750288</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Vortex</td>
			<td>BIOSAN</td>
			<td>V1-plus</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Stainless steel fine tip forceps&#160;</td>
			<td>SIGMA</td>
			<td>Z168785/Z168777</td>
			<td>curved and straight</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dressing tissue forceps</td>
			<td>SIGMA</td>
			<td>F4392</td>
			<td>length 8 inches</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Micro-dissecting forceps</td>
			<td>SIGMA</td>
			<td>F4017</td>
			<td>straight&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Micro-dissecting forceps</td>
			<td>SIGMA</td>
			<td>F4142&#160;</td>
			<td>Curved</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mayo Scissors</td>
			<td>SIGMA</td>
			<td>Z265993&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Scalpel</td>
			<td>SAKIRA MEDICAL</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile Biopsy Punch &#216; 3mm</td>
			<td>Stiefel Laboratories Ltd.</td>
			<td>2079D</td>
			<td>5mm diameter can also be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile 1.5ml Tubes</td>
			<td>Deltalab</td>
			<td>200400P</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile 15ml Tubes</td>
			<td>Greiner</td>
			<td>188271</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile 50ml Tubes</td>
			<td>Greiner</td>
			<td>227261</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile serological pipettes 5 ml</td>
			<td>Greiner</td>
			<td>606160</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile serological pipettes 10 ml</td>
			<td>Greiner</td>
			<td>607160</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile serological pipettes 25 ml</td>
			<td>Greiner</td>
			<td>760180</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Biological safety cabinet, class II</td>
			<td>Thermo Scientific</td>
			<td>1300 series, type A2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Micro-Isolator&#160;Rack</td>
			<td>RAIR&#160;IsoSystem&#160;</td>
			<td>76144W</td>
			<td>Super&#160;Mouse&#160;1800 AllerZone&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Refrigerated Microcentfifuge</td>
			<td>Eppendorf</td>
			<td>Legend Micro 21R</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Microcentfifuge</td>
			<td>Heraeus</td>
			<td>Biofuge-pico</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Centrifuge</td>
			<td>Thermo Scientific</td>
			<td>Sorval ST40R</td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">CO2 Incubator&#160;</td>
			<td>Thermo Scientific</td>
			<td>Model&#160; 3111</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile Thin-tip pasteur pipettes</td>
			<td>Deltalab</td>
			<td>D210022</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile pasteur pipettes</td>
			<td>Deltalab</td>
			<td>200007</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sterile 24-well plate</td>
			<td>Greiner</td>
			<td>662160</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trypan Blue Solution&#160;</td>
			<td>Life Technologies</td>
			<td>T10282</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Automatic Cell Counter - Cuntess</td>
			<td>Life Technologies</td>
			<td>C10227&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Countess Cell Counting Chamber Slides</td>
			<td>Life Technologies</td>
			<td>C10312</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Flow Cytometry Tubes</td>
			<td>BD</td>
			<td>343675</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Flow Cytometer - FACS Canto-II</td>
			<td>BD</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Real Time PCR Instrument - Rotor Gene Q or ABI 7900</td>
			<td>Qiagen / Applied Biosystems</td>
			<td style="width:141px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trizol Reagent</td>
			<td>Life Technologies</td>
			<td>15596-026</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNAse-I</td>
			<td>Life Technologies</td>
			<td>18068-015</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNAse-I Buffer 10X</td>
			<td>Life Technologies</td>
			<td>18068015</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EDTA 25 mM</td>
			<td>Life Technologies</td>
			<td>18068015</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ultra-Pure Water</td>
			<td>Life Technologies</td>
			<td>10977</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNAse Out</td>
			<td>Life Technologies</td>
			<td>100000840</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Rndom Hexamer Primers</td>
			<td>Life Technologies</td>
			<td>N8080127</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">M-MLV-RT buffer</td>
			<td>Life Technologies</td>
			<td>18057-018</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">M-MLV-RT enzime</td>
			<td>Life Technologies</td>
			<td>28025-021</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QuantiTect Syber Green PCR Kit</td>
			<td>Qiagen</td>
			<td>204143</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Specific primers&#160;</td>
			<td>Life Technologies</td>
			<td style="width:141px;">N/A</td>
			<td>Molecular Biology Grade</td>
		</tr>
	</tbody>
</table>

sublingual immunotherapy as an alternative to induce protection against acute respiratory infections

Sublingual route has been widely used to deliver small molecules into the bloodstream and to modulate the immune response at different sites. It has been shown to effectively induce humoral and cellular responses at systemic and mucosal sites, namely the lungs and urogenital tract. Sublingual vaccination can promote protection against infections at the lower and upper respiratory tract; it can also promote tolerance to allergens and ameliorate asthma symptoms. Modulation of lung&#8217;s immune response by sublingual immunotherapy (SLIT) is safer than direct administration of formulations by intranasal route because it does not require delivery of potentially harmful molecules directly into the airways. In contrast to intranasal delivery, side effects involving brain toxicity or facial paralysis are not promoted by SLIT. The immune mechanisms underlying SLIT remain elusive and its use for the treatment of acute lung infections has not yet been explored. Thus, development of appropriate animal models of SLIT is needed to further explore its potential advantages. 
This work shows how to perform sublingual administration of therapeutic agents in mice to evaluate their ability to protect against acute pneumococcal pneumonia. Technical aspects of mouse handling during sublingual inoculation, precise identification of sublingual mucosa, draining lymph nodes and isolation of tissues, bronchoalveolar lavage and lungs are illustrated. Protocols for single cell suspension preparation for FACS analysis are described in detail. Other downstream applications for the analysis of the immune response are discussed. Technical aspects of the preparation of Streptococcus pneumoniae inoculum and intranasal challenge of mice are also explained.
SLIT is a simple technique that allows screening of candidate molecules to modulate lungs&#8217; immune response. Parameters affecting the success of SLIT are related to molecular size, susceptibility to degradation and stability of highly concentrated formulations.

Imunoterapia sublingual pode ser utilizado com êxito para modular a resposta imune pulmões. Mostramos que uma única dose de flagelina, o agonista TLR5 e NLRC4, pode induzir a regulação positiva significativa do mRNA que codifica a CXCL1 quimiocinas, CCL20 e a citocina IL-6, comparada com os controlos tratados com solução salina. Dobrar a indução de níveis de ARNm de um pico a 8 h após a ITSL e voltar aos níveis basais após 20 horas (Figura 1). No entanto, quando foi realizada a ITSL infecção intranasal antes de 2 horas com S. Pneumoniae, os níveis de mRNA de IL6 CXCL1 e permaneceu significativamente regulada até 24 horas após a ITSL em comparação com animais não tratados (Figura 2). Análise das populações de células no LBA e no tecido pulmonar por FACS revelou que os animais tratados com FliC por via sublingual havia aumento do número de neutrófilos nas vias respiratórias, mas não no tecido dos pulmões (Figura 3). <p class = &quot;jove_content&quot;&gt; Finalmente, a sobrevivência após provocação pneumocócica foi comparada em animais previamente tratados com FliC por via sublingual ou com solução salina como controle. Como mostrado na Figura 4, com ITSL flagelina promoveu aumento da sobrevivência e protecção contra a pneumonia pneumocócica aguda. <img alt="Figura 1" fo:content-width="6.7in" src="/files/ftp_upload/52036/52036fig1highresV2.jpg" width="680" /> Figura 1: Cinética do perfil da transcrição dos pulmões após imunoterapia sublingual com flagelina. Oito a 10 semanas de idade BALB / c (n = 4) foram tratados com 10 ug de flagelina ou soro fisiológico por via sublingual, sob anestesia. Pulmões foram coletadas em momentos diferentes e colocados em conservante ácido nucleico. Extracção de RNA total foi realizada e o cDNA foi sintetizado. níveis de mRNA foram avaliadas por PCR em tempo real utilizando primers específicos constantes do Table 1 A quantificação relativa foi realizada de acordo com método ΔCt usando níveis ACTB mRNA para a normalização. Os resultados são apresentados como aumento de vezes em comparação com o grupo tratado com solução salina em mediana ± SEM. Os asteriscos indicam diferenças estatisticamente significantes (p &lt;0,05), calculado de acordo com o teste de Mann-Whitney. Os resultados são representativos de duas experiências independentes. <img alt="Figura 2" fo:content-width="6.2in" src="/files/ftp_upload/52036/52036fig2highresV2.jpg" width="660" /> A Figura 2 o perfil de transcrição &#39;Pulmões durante pneumonia pneumocócica após imunoterapia sublingual com flagelina. Oito a 10 semanas de idade BALB / c (n = 4 por grupo de controlo e n = 7 por grupo tratado) foi tratado com 10 ug de flagelina ou salina por via sublingual, sob anestesia. 2 horas mais tarde, os ratinhos foram infectados por via intranasal com a dose letal mínima (MLD), provocando 10Mortalidade de 0% de um isolado clínico de S. pneumoniae serotipo 1 E1585, correspondente a 4x10 5 CFU / 50 ul. Os pulmões foram recolhidos 24 horas após o desafio e armazenado em conservante ácido nucleico até a extracção de ARN e a síntese de ADNc foram efectuadas. PCR em tempo real foi realizado (ver a lista de iniciadores na Tabela 1) e quantificação relativa foi realizada de acordo com método ΔCt utilizando os níveis de mRNA para ACTB normalização. Os resultados são apresentados como aumento de vezes em comparação com o grupo tratado com solução salina em mediana ± SEM. Os asteriscos indicam diferenças estatisticamente significantes (p &lt;0,05), calculado de acordo com o teste de Mann-Whitney. <img alt="Figura 3" fo:content-width="6.5in" src="/files/ftp_upload/52036/52036fig3highresV2.jpg" width="680" /> Figura 3 Análise de polimorfonucleares neutrófilos (PMN) de recrutamento em tecido e vias aéreas nos pulmões após SLIT. Oito a10 semanas de idade BALB / c (n = 4) foram tratados com 10 ug de flagelina ou soro fisiológico por via sublingual, sob anestesia. 2 horas mais tarde, os ratinhos foram desafiados por via intranasal com o MLD de S. pneumoniae sorotipo 1 E1585. 24 horas após o desafio, a BAL foi realizada e os pulmões foram processados ​​por análise de FACS. PMN foram identificadas como células CD11b Ly6G alto / alto / CD11c negativos e com base no perfil FCS-SSC. Os resultados são expressos como percentagem de PMN em relação dos números de células totais na LBA ou pulmões. As barras representam a média ± SEM. Os asteriscos indicam diferenças estatisticamente significantes (p &lt;0,05), calculados de acordo com one-way teste de Mann-Whitney. <img alt="Figura 4" fo:content-width="5.3in" src="/files/ftp_upload/52036/52036fig4highresV2.jpg" width="530" /> Figura 4. SLIT com flagelina protege ratinhos contra a pneumonia pneumocócica aguda. </strong&gt; Oito a 10 semanas de idade BALB / c ratinhos (n = 8) foram tratados com 10 ug de flagelina ou soro fisiológico por via sublingual, sob anestesia. 2 horas mais tarde, os ratinhos foram desafiados por via intranasal com o MLD de S. pneumoniae sorotipo 1 E1585. A sobrevida foi avaliada em uma base diária. Curvas de Kaplan-Meier foram comparadas segundo teste log-rank (Mantel-Cox). Os asteriscos indicam diferenças estatisticamente significantes (p &lt;0,05) .Results são representativos de dois experimentos independentes. <table align="center" border="1" cellpadding="0" cellspacing="0"><tbody align="center"><tr><td> Nome </td><td> Sequência de 5&#39;-3 &#39; </td><td> PCR comprimento do produto (pb) </td></tr><tr><td> MB-actin_F </td><td> GCTTCTTTGCAGCTCCTTCGT </td><td rowspan="2"> 68 </td></tr><tr><td> MB-actin_R </td><td> CGTCATCCATGGCGAACTG </td></tr><tr><td>mCCL20_F </td><td> TTTTGGGATGGAATTGGACAC </td><td rowspan="2"> 69 </td></tr><tr><td> mCCL20_R </td><td> TGCAGGTGAAGCCTTCAACC </td></tr><tr><td> mCXCL1_F </td><td> CTTGGTTCAGAAAATTGTCCAAAA </td><td rowspan="2"> 84 </td></tr><tr><td> mCXCL1_R </td><td> ACGGTGCCATCAGAGCAGTCT </td></tr><tr><td> mIL-6_F </td><td> GTTCTCTGGGAAATCGTGGAAA </td><td rowspan="2"> 78 </td></tr><tr><td> mIL-6_R </td><td> AAGTGCATCATCGTTGTTCATACA </td></tr><tr><td> mTNFalpha_F </td><td> CATCTTCTCAAAATTCGAGTGACAA </td><td rowspan="2"> 63 </td></tr><tr><td> mTNFalpha_R </td><td> CCTCCACTTGGTGGTTTGCT </td></tr><tr><td> mCxcl2_F </td><td> CCCTCAACGGAAGAACCAAA </td><td rowspan="2"> 72 </td></tr><tr><td> mCxcl2_R </td><td> CACATCAGGTACGATCCAGGC </td></tr></tbody></table> Tabela 1 lista Primer usado para tempo real, análise de PCR. Seqüências de primers específicos utilizados para a análise de qPCR. Adiante e iniciadores para rato ACTB reversa, Cccl20, CXCL1, IL6, TNF e CXCL1 são apresentados como as sequências 5&#39;-3 &#39;e o comprimento do produto esperado é indicado em pares de bases (pb).

Watch this Scientific Journal Video about Sublingual Immunotherapy as an Alternative to Induce Protection Against Acute Respiratory Infections at JoVE.com

Sublingual Immunotherapy as an Alternative to Induce Protection Against Acute Respiratory Infections

The present work illustrates the convenience of using sublingual immunotherapy to boost the innate immune response in the lungs and confer protection against acute pneumococcal pneumonia in mouse.

Imunoterapia sublingual como uma alternativa para induzir protecção contra Infecções Respiratórias Agudas

Sublingual route has been widely used to deliver small molecules into the bloodstream and to modulate the immune response at different sites. It has been ...

sublingual-immunotherapy-as-an-alternative-to-induce-protection

Research

Education

JoVE Core

JoVE Journal

Pharmacology

Medicine

Unit 1

Other Respiratory Disorders

SCIENTISTS IN ACTION

16.7K visualizações.  Universidad de la República. The present work illustrates the convenience of using sublingual immunotherapy to boost the innate immune response in the lungs and confer protection against acute pneumococcal pneumonia in mouse.