Name: in situ detection of bacteria within paraffin-embedded tissues using a digoxin-labeled dna probe targeting 16s rrna
Uploaded: 2015-05-21T13:00:00.000+00:00
Duration: 11 min 15 s
Description: Watch this Scientific Journal Video about In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA at JoVE.com

This study was supported by a grant (2013R1A1A3005669) from the National Research Foundation of Korea and a grant (HI13C0016) of the Korean Health Technology R&#38;D Project, Ministry of Health &#38; Welfare.

1. Probe Preparation
<ol>
	<li>PCR amplification of the probe
	<ol>
		<li>For the P. gingivalis&#8211;specific probe, amplify a 343-bp DNA fragment of P. gingivalis 16S rRNA by PCR using the genomic DNA of P. gingivalis and the following primers: 5&#39;- TGC AAC TTG CCT TAC AGA GG-3&#39; and 5&#39;- ACT CGT ATC GCC CGT TAT TC-3&#39;10. Perform amplifications with the following cycle conditions: 35 cycles at 95 &#176;C for 30 sec, 60 &#176;C for 30 sec, and 72 &#176;C for 1 min 20 sec followed by a 5&#160;min extension at 72 &#176;C10,11.</li>
		<li>Amplify the eubacterial probe using a 70-bp DNA fragment (5&#39;-CAGGTGCTGCATGGCTGTCGTCAGCTCGTGTTGTGAAATGTTGGGTTAAG 
		TCCCGCAACGAGCGCAACCC-3&#39;) synthesized as an oligonucleotide and the following primers: 5&#39;-CAG GTR CTG CMT GGY-3&#39; and 5&#39;-AGG GTT GCG CTC GTT-3&#39;11. Perform amplifications with the following cycle conditions: 40 cycles at 9 4&#176;C for 30 sec, 60 &#176;C for 30 sec and 72 &#176;C for 1 min 20 s followed by a 5 min extension at 72 &#176;C11,12.</li>
		<li>Precipitate the PCR products (&#8805;500 &#181;l) by adding 3 M sodium acetate (pH 5.2) and 100% ethanol (at a 10:1:2 ratio) and incubating at -20 &#176;C for 2 hr.</li>
		<li>Centrifuge the mixture at 14,000 x g for 15 min, resuspend the pellet in 100 &#181;l of TE buffer, and measure the DNA concentration by optical density at 260 nm.</li>
	</ol>
	</li>
	<li>DIG-labeling using a DIG DNA labeling and detection kit
	<ol>
		<li>Mix 3 &#181;g of the probe with water to a final volume of 15 &#181;l.</li>
		<li>Denature the DNA at 95 &#176;C for 10 min and quickly chill on ice.</li>
		<li>Add 2 &#181;l of 10x hexanucleotide mix, 2 &#181;l of dNTP-labeling mix, and 1 &#181;l of Klenow enzyme to 15 &#181;l of the denatured DNA.</li>
		<li>Mix and incubate at 37 &#176;C for 24 hr to 48 hr and stop reaction by heating at 65 &#176;C.</li>
	</ol>
	</li>
	<li>Check the sensitivity of the DIG-labeled probe using a DIG DNA labeling and detection kit
	<ol>
		<li>Manually load 1 &#181;l of serial dilutions of the positive control probe provided in the kit and 1 ng of the DIG-labeled probe on the nylon membrane and dry for 5 min at RT.</li>
		<li>Briefly soak the membrane in 2x SSC buffer (0.3 M NaCl, 30 mM sodium citrate, pH 7.0) and incubate the membrane at 80 &#176;C for 1 hr to immobilize the DNA.</li>
		<li>Briefly soak the membrane in maleic acid buffer (MAB, 0.1 M maleic acid, 0.15 M NaCl, pH 7.5) and incubate with anti-DIG alkaline phosphatase (AP)-conjugated antibody diluted (1:5,000) in 6 ml of blocking solution provided in the kit at RT for 30 min.</li>
		<li>Wash the membrane with MABT (MAB containing 1% Tween 20) and apply 40 &#181;l of the NBT/BCIP solution mixed with 2 ml detection buffer (0.1 M Tris-HCl, 0.1 M NaCl, 0.05 M MgCl2, pH 9.5) onto the membrane for 1 min. If the sensitivity of the labeled probe is not satisfying, repeat steps from 1.1.3 to 1.3.4.</li>
		<li>Measure the DNA concentration of the labeled probe (OD260) and adjust the concentration to 100 ng &#181;l-1.</li>
	</ol>
	</li>
	<li>Check the specificity of the DIG-labeled probe
	<ol>
		<li>Denature genomic DNA samples (25 ng 3 &#181;l-1 per each sample) from various bacterial species, including the bacterium targeted by the specific probe, at 95 &#176;C for 10 min and quickly chill on ice.</li>
		<li>Manually load the denatured DNA on the nylon membrane and dry for 20 min at RT.</li>
		<li>Briefly soak the membrane in 2x SSC buffer and incubate the membrane at 80 &#176;C for 2 hr to immobilize the DNA.</li>
		<li>Block the membrane with a blocking solution at RT for 1 hr.</li>
		<li>Dilute the probe at 1 ng &#181;l-1 in hybridization buffer, denature the diluted probes, and apply onto the membrane.</li>
		<li>Incubate the membrane at 45 &#176;C for 1 hr.</li>
		<li>Wash the membrane three times with 2x SSC buffer.</li>
		<li>Briefly soak the membrane in MAB.</li>
		<li>Incubate with anti-DIG AP-conjugated antibody diluted (1:2,000) in 6 ml of blocking solution at RT for 1 hr.</li>
		<li>Wash the membrane with MABT and apply 40 &#181;l of the NBT/BCIP solution mixed with 2 ml detection buffer.</li>
		<li>When the probe does not achieve the expected specificity, increase the hybridization temperature until the specificity is observed.</li>
	</ol>
	</li>
</ol>
2.&#160;In Situ Hybridization
Note: To avoid drying of the specimens and reagents, perform all incubations in a humidified chamber lined with wet paper towels.
<ol>
	<li>De-paraffinization and rehydration of tissue sections
	<ol>
		<li>Prepare 4 &#181;m thick tissue sections from paraffin-embedded blocks. Formalin, paraformaldehyde, and zinc-based fixative are compatible with this protocol.</li>
		<li>Prepare all reagents using DEPC-treated water.</li>
		<li>Heat slides in a dry oven at 60 &#176;C for 30 min and incubate slides at RT for 30 min.</li>
		<li>Immerse slides in 100% xylene for 5 min three times; use fresh xylene each time. 
		Note: Do this de-waxing procedure in a chemical fume hood.</li>
		<li>Immerse slides in 100% ethanol for 5 min twice, using fresh ethanol each time, and rehydrate specimens in serial 90%, 80% and 70% ethanol solutions for 5 min each.</li>
		<li>Immerse slides in DEPC-treated water for 1 min and wash slides in DEPC-treated PBS (pH 7.4) for 6 min.</li>
	</ol>
	</li>
	<li>Pretreatments of tissue sections
	<ol>
		<li>Immerse slides in 0.1 N hydrochloric acid for 20 min and wash slides in DEPC-treated water for 30 sec.</li>
		<li>Draw a hydrophobic barrier surrounding specimens using a wax pen. 
		Note: The size of the hydrophobic barrier depends on the size of specimens. Therefore, the volumes of reagents used in the following steps vary depending on the size of specimens but have to fill the hydrophobic barrier (50 &#181;l for small specimens and 400 &#181;l for large specimens).</li>
		<li>Treat specimens with 50 to 400 &#181;l of proteinase K (1 to 10 &#181;g ml-1 in DEPC-treated PBS) in a dry oven at 37 &#176;C for 30 min and wash slides in DEPC-treated 1x PBS for 1 min.</li>
		<li>Soak slides in 4% paraformaldehyde in DEPC-treated PBS for 10 min, then wash slides in DEPC-treated PBS for 1 min.</li>
		<li>Soak slides in 0.1 M triethanolamine-HCl (pH 8.0) containing 0.5% acetic anhydride for 20 min and wash slides in DEPC-treated water for 30 sec.</li>
	</ol>
	</li>
	<li>Hybridization with probe and washing
	<ol>
		<li>Immerse slides in 2x SSC buffer for 20 min.</li>
		<li>Dilute the probe at 1 ng &#181;l-1 in hybridization buffer (4x SSC, 50% [vol/vol] formamide, 1x Denhardt&#8217;s solution, 10% [wt/vol] dextran sulfate, 0.1% [wt/vol] sodium dodecyl sulfate, 0.4 mg ml-1 salmon sperm DNA). For negative controls, mix the labeled probe with a 10-fold excess amount of non-labeled probe.</li>
		<li>Denature the diluted probes and apply 50 to 400 &#181;l onto tissue sections. Place a cover slip on the slide and seal with nail polish.</li>
		<li>Heat slides in PCR machine at 90 &#176;C for 10 min and incubate slides in a humidified chamber O/N&#160;at 45 &#176;C or optimal temperature determined at step 1.4.11.</li>
		<li>Cool the slides at 4 &#176;C for 30 min, remove cover slips, and immerse slides in a serial SSC buffer as followings: 4x SSC for 10 min, pre-warmed (45 &#176;C) 2x SSC for 20 min, 2x SSC for 10 min, and 0.2x SSC for 10 min.</li>
	</ol>
	</li>
	<li>Detection with anti-DIG AP-conjugated antibody
	<ol>
		<li>Wash slides in MABT for 5 min.</li>
		<li>Block with 50 to 400 &#181;l of blocking solution with 1% Tween 20 for 20 min.</li>
		<li>Add 50 to 400 &#181;l of anti-DIG-AP antibody diluted in blocking solution (1:1,000) anld incubate at 37 &#176;C for 90 min.</li>
		<li>Wash slides in MABT for 10 min.</li>
		<li>Immerse slides in detection buffer containing 1% Tween 20 for 5 min.</li>
		<li>Treat with 50 to 400 &#181; of 1 mM levamisole (in detection buffer containing 1% Tween 20) for 5 min to inactivate endogenous alkaline phosphatase.</li>
		<li>Distribute 50 to 400 &#181;l of the premixed NBT/BCIP solution (diluted in detection buffer at 1:100) onto each specimen and incubate slides in a humidified chamber at RT for 2 to 3 hr until the developed signal is satisfactory.</li>
		<li>Rinse slides with de-ionized water to stop visualization and apply 50 to 400 &#181;l of 0.05% [wt/vol] methyl green as a counter stain at 37 &#176;C for 10 min.</li>
		<li>Rinse slides with de-ionized water, dehydrate in 100% ethanol, and immerse in xylene.</li>
		<li>Apply 80 &#181;l of mounting solution onto each slide and cover with cover slips.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Takarada, H., Cattoni, M., Sugimoto, A., Rose, G. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructural+studies+of+human+gingiva.+II.+The+lower+part+of+the+pocket+epithelium+in+chronic+periodontitis.">Ultrastructural studies of human gingiva. II. The lower part of the pocket epithelium in chronic periodontitis.</a> J. Periodontol. 45 (3), 155-169 (1974).</li><li>Allenspach-Petrzilka, G. E., Guggenheim, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+invasion+of+the+periodontium;+an+important+factor+in+the+pathogenesis+of+periodontitis.">Bacterial invasion of the periodontium; an important factor in the pathogenesis of periodontitis.</a> J. Clin. Periodontol. 10 (6), 609-617 (1983).</li><li>Saglie, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+presence+of+bacteria+in+the+oral+epithelium+in+periodontal+disease.+II.+Immunohistochemical+identification+of+bacteria.">The presence of bacteria in the oral epithelium in periodontal disease. II. Immunohistochemical identification of bacteria.</a> J. Periodontol. 57 (8), 492-500 (1986).</li><li>Christersson, L. A., Albini, B., Zambon, J. J., Wikesj&#246;, U. M., Genco, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue+localization+of+Actinobacillus+actinomycetemcomitans.+in+human+periodontitis.+I.+Light,+immunofluorescence+and+electron+microscopic+studies.">Tissue localization of Actinobacillus actinomycetemcomitans. in human periodontitis. I. Light, immunofluorescence and electron microscopic studies.</a> J. Periodontol. 58 (8), 529-539 (1987).</li><li>Saglie, F. R., Pertuiset, J., Rezende, M. T., Nestor, M., Marfany, A., Cheng, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ.+correlative+immuno-identification+of+mononuclear+infiltrates+and+invasive+bacteria+in+diseased+gingiva.">In situ. correlative immuno-identification of mononuclear infiltrates and invasive bacteria in diseased gingiva.</a> J. Periodontol. 59 (10), 688-696 (1988).</li><li>Rautemaa, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracellular+localization+of+Porphyromonas+gingivalis.+thiol+proteinase+in+periodontal+tissues+of+chronic+periodontitis+patients.">Intracellular localization of Porphyromonas gingivalis. thiol proteinase in periodontal tissues of chronic periodontitis patients.</a> Oral Dis. 10 (5), 298-305 (2004).</li><li>Marttila, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracellular+localization+of+Treponema+denticola.+chymotrypsin-like+proteinase+in+chronic+periodontitis.">Intracellular localization of Treponema denticola. chymotrypsin-like proteinase in chronic periodontitis.</a> J. Oral Microbiol. 6, (2014).</li><li>Colombo, A. V., da Silva, C. M., Haffajee, A., Colombo, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+intracellular+oral+species+within+human+crevicular+epithelial+cells+from+subjects+with+chronic+periodontitis+by+fluorescence+in+situ.+hybridization.">Identification of intracellular oral species within human crevicular epithelial cells from subjects with chronic periodontitis by fluorescence in situ. hybridization.</a> J. Periodontal Res. 42 (3), 236-243 (2007).</li><li>Abrams, K., Caton, J., Polson, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histologic+comparisons+of+interproximal+gingival+tissues+related+to+the+presence+or+absence+of+bleeding.">Histologic comparisons of interproximal gingival tissues related to the presence or absence of bleeding.</a> J. Periodontol. 55 (11), 629-632 (1984).</li><li>Kim, Y. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Presence+of+Porphyromonas+gingivalis.+and+plasma+cell+dominance+in+gingival+tissues+with+periodontitis.">Presence of Porphyromonas gingivalis. and plasma cell dominance in gingival tissues with periodontitis.</a> Oral Dis. 16 (4), 375-381 (2010).</li><li>Choi, Y. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Porphyromonas+gingivalis.+and+dextran+sodium+sulfate+induce+periodontitis+through+the+disruption+of+physical+barriers.">Porphyromonas gingivalis. and dextran sodium sulfate induce periodontitis through the disruption of physical barriers.</a> Eur. J. Inflammation. 10, 419-431 (2013).</li><li>Choi, Y. S., Kim, Y. C., Ji, S., Choi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Increased+bacterial+invasion+and+differential+expression+of+tight+junction+proteins,+growth+factors,+and+growth+factor+receptors+in+periodontal+lesions.">Increased bacterial invasion and differential expression of tight junction proteins, growth factors, and growth factor receptors in periodontal lesions.</a> J. Periodontol. 85 (8), e313-e322 (2014).</li><li>Baker, G. C., Smith, J. J., Cowan, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review+and+re-analysis+of+domain-specific+16S+primers.">Review and re-analysis of domain-specific 16S primers.</a> J. Microbiol. Methods. 55 (3), 541-555 (2003).</li><li>Hajishengallis, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Low-abundance+biofilm+species+orchestrates+inflammatory+periodontal+disease+through+the+commensal+microbiota+and+the+complement.">A Low-abundance biofilm species orchestrates inflammatory periodontal disease through the commensal microbiota and the complement.</a> Cell Host Microbe. 10 (5), 497-506 (2011).</li><li>Axon, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gastric+cancer+and+Helicobacter+pylori.">Gastric cancer and Helicobacter pylori.</a> Aliment. Pharmacol. Ther. 16 (suppl. 4), 83-88 (2002).</li><li>Fenhalls, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ.+detection+of+Mycobacterium+tuberculosis+transcripts+in+human+lung+granulomas+reveals+differential+gene+expression+in+necrotic+lesions.">In situ. detection of Mycobacterium tuberculosis transcripts in human lung granulomas reveals differential gene expression in necrotic lesions.</a> Infect. Immun. 70 (11), 6330-6338 (2002).</li></ol>

The authors have nothing to disclose.

Here a protocol to localize bacteria within paraffin-embedded tissues using a DIG-labeled DNA probe has been described. The probe targets the DNA or RNA molecules of bacterial 16S rRNA gene, and the 16S rRNA-targeting probes can be designed as either species-specific or universal. The specific hybridization of the P. gingivalis-specific probe to P. gingivalis but not to other oral bacteria has been previously shown10. In contrast, the eubacterial probe hybridized to all bacterial genomic DNA ...

Bacteria play a role in the etiology of various oral diseases such as periodontitis, pulpitis, pericoronitis, cellulitis, and osteomyelitis. In order to understand the role of bacteria in the pathogenesis of disease and to monitor the effect of treatments, localization of bacteria within the tissue is important. The presence of bacteria within gingival tissue from patients with periodontitis has been shown using various methods, including electron microscopy1,2, immunohistochemistry and immunofluorescence using bacteria-specific antibodies3-7, and fluorescent in situ hybridization (FISH)8 using a fluorescence-labeled oligonucleotide probe targeting 16S rRNA. Nevertheless, these methods are not widely used due to technical limitation or difficulties. Compared with antibodies, probes targeting 16S rRNA are easy to produce and achieve species-specificity. FISH has proven to be an excellent tool for the visualization of bacteria in their natural environments such as plaque biofilm. However, application of FISH to tissue samples is limited due to autofluorescence of various tissue components. For example, the strong autofluorescence of red blood cells often hampers the application of fluorescence technology to inflamed tissues when they involve bleeding9.
In order to localize bacteria within the inflamed gingival tissues, therefore, an in situ hybridization method using a digoxigenin (DIG)-labeled DNA probe has been developed and successfully applied10,11. Here a detailed protocol for the localization of bacteria within paraffin-embedded tissues using P. gingivalis-specific and universal eubacterial probes has been described. It is particularly focused on standardization of the method so that similar results can be reproduced in other laboratories. This protocol allows localization of bacteria within their histological context and the results are highly reproducible. The described protocol can be used to localize bacteria either in a species-specific or universal manner in various tissues. The universal probe is especially useful to detect bacteria in polymicrobial diseases and to study a potential role of bacteria in diseases where the role of specific bacteria is not known.

<table><tbody><tr><td>Acetic anhydride</td><td>Sigma</td><td>6404</td><td></td></tr><tr><td>50% Dextran sulfate solution</td><td>Millipore</td><td>S4030</td><td></td></tr><tr><td>50X Denhardt&amp;rsquo;s solution</td><td>Sigma</td><td>D2532</td><td></td></tr><tr><td>DEPC</td><td>Sigma</td><td>P159220</td><td></td></tr><tr><td>DIG DNA labeling and detection kit</td><td>Roche</td><td>11 093 657 910</td><td></td></tr><tr><td>Formamide</td><td>Sigma</td><td>F9037</td><td></td></tr><tr><td>ImmEdge&amp;trade; Pen</td><td>Dako</td><td>H-400</td><td></td></tr><tr><td>Levamisole</td><td>Vector</td><td>SP-5000</td><td></td></tr><tr><td>Magnesium chloride</td><td>Sigma</td><td>246964</td><td></td></tr><tr><td>Maleic acid</td><td>Sigma</td><td>M0375</td><td></td></tr><tr><td>Methyl green</td><td>Sigma</td><td>M6776</td><td></td></tr><tr><td>Paraformaldehyde</td><td>Sigma</td><td>P1648</td><td></td></tr><tr><td>Permount</td><td>Fisher</td><td>SP15-500</td><td></td></tr><tr><td>Salmon sperm DNA solution</td><td>Invitrogen</td><td>#15632-011</td><td></td></tr><tr><td>Sodium chloride</td><td>Sigma</td><td>S9625</td><td></td></tr><tr><td>Sodium citrate</td><td>Duksan</td><td>D1420</td><td></td></tr><tr><td>Sodium dodecyl sulfate</td><td>Amresco</td><td>227</td><td></td></tr><tr><td>Triethanolamine-HCl</td><td>Sigma</td><td>90279</td><td></td></tr><tr><td>Tris-HCl</td><td>Research organics</td><td>3098T</td><td></td></tr></tbody></table>

in situ detection of bacteria within paraffin-embedded tissues using a digoxin-labeled dna probe targeting 16s rrna

The presence of bacteria within the pocket epithelium and underlying connective tissue in gingival biopsies from patients with periodontitis has been reported using various methods, including electron microscopy, immunohistochemistry or immunofluorescence using bacteria-specific antibodies, and fluorescent in situ hybridization (FISH) using a fluorescence-labeled oligonucleotide probe. Nevertheless, these methods are not widely used due to technical limitation or difficulties. Here a method to localize bacteria within paraffin-embedded tissues using DIG-labeled DNA probes has been introduced. The paraffin-embedded tissues are the most common form of biopsy tissues available from pathology banks. Bacteria can be detected either in a species-specific or universal manner. Bacterial signals are detected as either discrete forms (coccus, rod, fusiform, and hairy form) of bacteria or dispersed forms. The technique allows other histological information to be obtained: the epithelia, connective tissue, inflammatory infiltrates, and blood vessels are well distinguished. This method can be used to study the role of bacteria in various diseases, such as periodontitis, cancers, and inflammatory immune diseases.

Figure 1 shows dot blotting of DIG-labeled probes compared with the positive control probe provided in the kit to determine their sensitivity. The 343 bp P. gingivalis-specific probe is 25 times more sensitive than the 70 bp eubacterial probe. Figure 2 shows in situ hybridization of gingival tissues obtained from patients with chronic periodontitis for detection of P. gingivalis and eubacteria. The bacterial signals, shown in violet, were detected within the ep...

Watch this Scientific Journal Video about In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA at JoVE.com

In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA

Here a method to localize bacteria within paraffin-embedded tissues using DIG-labeled 16S rRNA-targeting DNA probes has been described. This protocol can be applied to study the role of bacteria in various diseases such as periodontitis, cancers, and inflammatory immune diseases.

In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA

The presence of bacteria within the pocket epithelium and underlying connective tissue in gingival biopsies from patients with periodontitis has been ...

in-situ-detection-bacteria-within-paraffin-embedded-tissues-using

Research

JoVE Journal

Immunology and Infection

10.9K Views.  School of Dentistry and Dental Research Institute, Seoul National University. Here a method to localize bacteria within paraffin-embedded tissues using DIG-labeled 16S rRNA-targeting DNA probes has been described. This protocol can be applied to study the role of bacteria in various diseases such as periodontitis, cancers, and inflammatory immune diseases.

Video: In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these diseases, do not exist in isolation when they colonize the vector; rather, they likely engage in interactions with resident microorganisms in the gut lumen. The vector microbiota has been demonstrated to play an important role in pathogen transmission for several vector-borne diseases. Whether resident bacteria in the gut of the Ixodes scapularis tick, the vector of several human pathogens including Borrelia burgdorferi, influence tick transmission of pathogens is not determined. We require methods for characterizing the composition of the bacteria associated with the tick gut to facilitate a better understanding of potential interspecies interactions in the tick gut. Using whole-mount in situ hybridization to visualize RNA transcripts associated with particular bacterial species allows for the collection of qualitative data regarding the abundance and distribution of the microbiota in intact tissue. This technique can be used to examine changes in the gut microbiota milieu over the course of tick feeding and can also be applied to analyze expression of tick genes. Staining of whole tick guts yield information about the gross spatial distribution of target RNA in the tissue without the need for three-dimensional reconstruction and is less affected by environmental contamination, which often confounds the sequencing-based methods frequently used to study complex microbial communities. Overall, this technique is a valuable tool that can be used to better understand vector-pathogen-microbiota interactions and their role in disease transmission.

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Here, we present a protocol to spatially and temporally assess the presence of viable microbiota in tick guts using a modified whole-mount in situ hybridization approach.

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these ...

Genetics

Detection of Bacteria Using Fluorogenic DNAzymes

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses each and every year. Prevention of such outbreaks and minimization of the impact of an ongoing epidemic place an ever-increasing demand for analytical methods that can accurately identify culprit pathogens at the earliest stage. Although there is a large array of effective methods for pathogen detection, none of them can satisfy all the following five premier requirements embodied for an ideal detection method: high specificity (detecting only the bacterium of interest), high sensitivity (capable of detecting as low as a single live bacterial cell), short time-to-results (minutes to hours), great operational simplicity (no need for lengthy sampling procedures and the use of specialized equipment), and cost effectiveness. For example, classical microbiological methods are highly specific but require a long time (days to weeks) to acquire a definitive result.1 PCR- and antibody-based techniques offer shorter waiting times (hours to days), but they require the use of expensive reagents and/or sophisticated equipment.2-4 Consequently, there is still a great demand for scientific research towards developing innovative bacterial detection methods that offer improved characteristics in one or more of the aforementioned requirements. Our laboratory is interested in examining the potential of DNAzymes as a novel class of molecular probes for biosensing applications including bacterial detection.5
DNAzymes (also known as deoxyribozymes or DNA enzymes) are man-made single-stranded DNA molecules with the capability of catalyzing chemical reactions.6-8 These molecules can be isolated from a vast random-sequence DNA pool (which contains as many as 1016 individual sequences) by a process known as "in vitro selection" or "SELEX" (systematic evolution of ligands by exponential enrichment).9-16 These special DNA molecules have been widely examined in recent years as molecular tools for biosensing applications.6-8
Our laboratory has established in vitro selection procedures for isolating RNA-cleaving fluorescent DNAzymes (RFDs; Fig. 1) and investigated the use of RFDs as analytical tools.17-29 RFDs catalyze the cleavage of a DNA-RNA chimeric substrate at a single ribonucleotide junction (R) that is flanked by a fluorophore (F) and a quencher (Q). The close proximity of F and Q renders the uncleaved substrate minimal fluorescence. However, the cleavage event leads to the separation of F and Q, which is accompanied by significant increase of fluorescence intensity.
More recently, we developed a method of isolating RFDs for bacterial detection.5 These special RFDs were isolated to "light up" in the presence of the crude extracellular mixture (CEM) left behind by a specific type of bacteria in their environment or in the media they are cultured (Fig. 1). The use of crude mixture circumvents the tedious process of purifying and identifying a suitable target from the microbe of interest for biosensor development (which could take months or years to complete). The use of extracellular targets means the assaying procedure is simple because there is no need for steps to obtain intracellular targets.
Using the above approach, we derived an RFD that cleaves its substrate (FS1; Fig. 2A) only in the presence of the CEM produced by E. coli (CEM-EC).5 This E. coli-sensing RFD, named RFD-EC1 (Fig. 2A), was found to be strictly responsive to CEM-EC but nonresponsive to CEMs from a host of other bacteria (Fig. 3).
Here we present the key experimental procedures for setting up E. coli detection assays using RFD-EC1 and representative results.

We have recently reported a novel approach for generating fluorogenic DNAzyme probes that can be applied to set up a simple, "mix-and-read" fluorescent assay for bacterial detection. These special DNA probes catalyze the cleavage of a chromophore-modified DNA-RNA chimeric substrate in the presence of crude extracellular mixture (CEM) produced by a specific bacterium, thereby translating bacterial detection into fluorescence signal generation. In this report we will describe key experimental procedures where a specific DNAzyme probe denoted "RFD-EC1" is employed for the detection of the model bacterium, Escherichia coli (E. coli).

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses ...

In Situ Hybridization Techniques for Paraffin-Embedded Adult Coral Samples

Corals are important ocean invertebrates that are critical for overall ocean health as well as human health. However, due to human impacts such as rising ocean temperatures and ocean acidification, corals are increasingly under threat. To tackle these challenges, advances in cell and molecular biology have proven to be crucial for diagnosing the health of corals. Modifying some of the techniques commonly used in human medicine could greatly improve researchers&#39; ability to treat and save corals. To address this, a protocol for in situ hybridization used primarily in human medicine and evolutionary developmental biology has been adapted for use in adult corals under stress.
The purpose of this method is to visualize the spatial expression of an RNA probe in adult coral tissue that has been embedded in paraffin and sectioned onto glass slides. This method focuses on removal of the paraffin and rehydration of the sample, pretreatment of the sample to ensure permeability of the sample, pre-hybridization incubation, hybridization of the RNA probe, and visualization of the RNA probe. This is a powerful method when using non-model organisms to discover where specific genes are expressed, and the protocol can be easily adapted for other non-model organisms. However, the method is limited in that it is primarily qualitative, because expression intensity can vary depending on the amount of time used during the visualization step and the concentration of the probe. Furthermore, patience is required, as this protocol can take up to 5 days (and in many cases, longer) depending on the probe being used. Finally, non-specific background staining is common, but this limitation can be overcome.

In Situ Hybridization Techniques for Paraffin-Embedded Adult Coral Samples

The goal of this protocol is to perform in situ hybridization on adult coral samples that have been embedded in paraffin and sectioned onto glass slides. This is a qualitative method used to visualize the spatial expression of an RNA anti-sense probe in paraffin-embedded tissues.

Corals are important ocean invertebrates that are critical for overall ocean health as well as human health. However, due to human impacts such as rising ...

Environment

Enhancing FISH Analysis for Oncogenic Drivers in Cancer Tissue Samples

Robust Detection of Gene Amplification in Formalin-Fixed Paraffin-Embedded Samples by Fluorescence In Situ Hybridization

Focal gene amplification, such as extrachromosomal DNA (ecDNA), plays an important role in cancer development and therapy resistance. While sequencing-based methodologies enable an unbiased identification of ecDNA, cytogenetic-based techniques, such as fluorescence in situ hybridization (FISH), remain time and cost-effective for identifying ecDNA in clinical specimens. The application of FISH in formalin-fixed paraffin-embedded (FFPE) tissue samples offers a unique avenue for detecting amplified genes, particularly when viable specimens are not available for karyotype examination. However, there is a lack of consensus procedures for this technique. This protocol provides comprehensive, fully optimized, step-by-step instructions for conducting FISH to detect gene amplification, including ecDNA, in FFPE tissue samples which present unique challenges that this protocol aims to overcome and standardize. By following this protocol, researchers can reproducibly acquire high-quality imaging data to assess gene amplification.

Author Spotlight: FISH as a Tool for Precise Gene Amplification Assessment in Cancer Specimens

This protocol provides a reproducible method to visualize gene amplification in formalin-fixed paraffin-embedded (FFPE) tissue specimens.

Focal gene amplification, such as extrachromosomal DNA (ecDNA), plays an important role in cancer development and therapy resistance. While ...

Cancer Research

Whole Mount RNA Fluorescent in situ Hybridization of Drosophila Embryos

Assessing the expression pattern of a gene, as well as the subcellular localization properties of its transcribed RNA, are key features for understanding its biological function during development. RNA in situ hybridization (RNA-ISH) is a powerful method used for visualizing RNA distribution properties, be it at the organismal, cellular or subcellular levels 1. RNA-ISH is based on the hybridization of a labeled nucleic acid probe (e.g. antisense RNA, oligonucleotides) complementary to the sequence of an mRNA or a non-coding RNA target of interest 2. As the procedure requires primary sequence information alone to generate sequence-specific probes, it can be universally applied to a broad range of organisms and tissue specimens 3. Indeed, a number of large-scale ISH studies have been implemented to document gene expression and RNA localization dynamics in various model organisms, which has led to the establishment of important community resources 4-11. While a variety of probe labeling and detection strategies have been developed over the years, the combined usage of fluorescently-labeled detection reagents and enzymatic signal amplification steps offer significant enhancements in the sensitivity and resolution of the procedure 12. Here, we describe an optimized fluorescent in situ hybridization method (FISH) employing tyramide signal amplification (TSA) to visualize RNA expression and localization dynamics in staged Drosophila embryos. The procedure is carried out in 96-well PCR plate format, which greatly facilitates the simultaneous processing of large numbers of samples.

Whole Mount RNA Fluorescent in situ Hybridization of Drosophila Embryos

Here we describe a whole-mount fluorescent in situ hybridization (FISH) protocol for determining the expression and localization properties of RNAs expressed during embryogenesis in the fruit fly, Drosophila melanogaster.

Assessing  the expression pattern of a gene, as well as the subcellular localization  properties of its transcribed RNA, are key features for ...

Biology

Visualization of Gut Microbiota-host Interactions via Fluorescence In Situ Hybridization, Lectin Staining, and Imaging

Measuring the localization of microbes within their in vivo context is an essential step in revealing the functional relationships between the microbiota and the vertebrate gut. The spatial landscape of the gut microbiota is tightly controlled by physical features - intestinal mucus, crypts, and folds - and is affected by host-controlled properties such as pH, oxygen availability, and immune factors. These properties limit the ability of commensal microbes and pathogens alike to colonize the gut stably. At the micron-scale, microbial organization determines the close-range interactions between different microbes as well as the interactions between microbes and their host. These interactions then affect large-scale organ function and host health.
This protocol enables the visualization of the gut microbiota spatial organization from distances between cells to organ-wide scales. The method is based on fixing gut tissues while preserving intestinal structure and mucus properties. The fixed samples are then embedded, sectioned, and stained to highlight specific bacterial species through fluorescence in situ hybridization (FISH). Host features, such as mucus and host cell components, are labeled with fluorescently labeled lectins. Finally, the stained sections are imaged using a confocal microscope utilizing tile-scan imaging at high magnification to bridge the micron to centimeter length scales. This type of imaging can be applied to intestinal sections from animal models and biopsies from human tissues to determine the biogeography of the microbiota in the gut in health and disease.

Visualization of Gut Microbiota-host Interactions via Fluorescence In Situ Hybridization, Lectin Staining, and Imaging

This streamlined protocol details a workflow to detect and image bacteria in complex tissue samples, from fixing the tissue to staining microbes with fluorescent in situ hybridization.

Measuring the localization of microbes within their in vivo context is an essential step in revealing the functional relationships between the microbiota ...

RNA Fluorescence in situ Hybridization (FISH) to Visualize Microbial Colonization and Infection in Caenorhabditis elegans Intestines

The intestines of wild Caenorhabditis nematodes are inhabited by a variety of microorganisms, including gut microbiome bacteria and pathogens, such as microsporidia and viruses. Because of the similarities between Caenorhabditis elegans and mammalian intestinal cells, as well as the power of the C. elegans system, this host has emerged as a model system to study host intestine-microbe interactions in vivo. While it is possible to observe some aspects of these interactions with bright-field microscopy, it is difficult to accurately classify microbes and characterize the extent of colonization or infection without more precise tools. RNA fluorescence in situ hybridization (FISH) can be used as a tool to identify and visualize microbes in nematodes from the wild or to experimentally characterize and quantify infection in nematodes infected with microbes in the lab. FISH probes, labeling the highly abundant small subunit ribosomal RNA, produce a bright signal for bacteria and microsporidian cells. Probes designed to target conserved regions of ribosomal RNA common to many species can detect a broad range of microbes, whereas targeting divergent regions of the ribosomal RNA is useful for narrower detection. Similarly, probes can be designed to label viral RNA. A protocol for RNA FISH staining with either paraformaldehyde (PFA) or acetone fixation is presented. PFA fixation is ideal for nematodes associated with bacteria, microsporidia, and viruses, whereas acetone fixation is necessary for the visualization of microsporida spores. Animals were first washed and fixed in paraformaldehyde or acetone. After fixation, FISH probes were incubated with samples to allow for the hybridization of probes to the desired target. The animals were again washed and then examined on microscope slides or using automated approaches. Overall, this FISH protocol enables detection, identification, and quantification of the microbes that inhabit the C. elegans intestine, including microbes for which there are no genetic tools available.

RNA Fluorescence in situ Hybridization FISH to Visualize Microbial Colonization and Infection in Caenorhabditis elegans Intestines

Intestinal microbes, including extracellular bacteria and intracellular pathogens like the Orsay virus and microsporidia (fungi), are often associated with wild Caenorhabditis nematodes. This article presents a protocol for detecting and quantifying microbes that colonize and/or infect C. elegans nematodes, and for measuring pathogen load after controlled infections in the lab.

The intestines of wild Caenorhabditis nematodes are inhabited by a variety of microorganisms, including gut microbiome bacteria and pathogens, such as ...

Employing Digital Droplet PCR to Detect BRAF V600E Mutations in Formalin-fixed Paraffin-embedded Reference Standard Cell Lines

ddPCR is a highly sensitive PCR method that utilizes a water-oil emulsion system. Using a droplet generator, an extracted nucleic acid sample is partitioned into ~20,000 nano-sized, water-in-oil droplets, and PCR amplification occurs in individual droplets. The ddPCR approach is in identifying sequence mutations, copy number alterations, and select structural rearrangements involving targeted genes. Here, we demonstrate the use of ddPCR as a powerful technique for precisely quantitating rare BRAF V600E mutations in FFPE reference standard cell lines, which is helpful in identifying individuals with cancer. In conclusion, ddPCR technique offers the potential to precisely profile the specific rare mutations in different genes in various types of FFPE samples.

The goal of this video is to demonstrate how to perform&#160;automated DNA extraction from formalin-fixed paraffin-embedded (FFPE) reference standard cell lines and digital droplet PCR&#160;(ddPCR) analysis to detect rare mutations in a clinical setting. Detecting mutations in FFPE samples demonstrates the clinical utility of ddPCR in FFPE samples.

ddPCR is a highly sensitive PCR method that utilizes a water-oil emulsion system. Using a droplet generator, an extracted nucleic acid sample is ...

Detection of Tissue-resident Bacteria in Bladder Biopsies by 16S rRNA Fluorescence In Situ Hybridization

Visualization of the interaction of bacteria with host mucosal surfaces and tissues can provide valuable insight into mechanisms of pathogenesis. While visualization of bacterial pathogens in animal models of infection can rely on bacterial strains engineered to express fluorescent proteins such as GFP, visualization of bacteria within the mucosa of biopsies or tissue obtained from human patients requires an unbiased method. Here, we describe an efficient method for the detection of tissue-associated bacteria in human biopsy sections. This method utilizes fluorescent in situ hybridization (FISH) with a fluorescently labeled universal oligonucleotide probe for 16S rRNA to label tissue-associated bacteria within bladder biopsy sections acquired from patients suffering from recurrent urinary tract infection. Through use of a universal 16S rRNA probe, bacteria can be detected without prior knowledge of species, genera, or biochemical characteristics, such as lipopolysaccharide (LPS), that would be required for detection by immunofluorescence experiments. We describe a complete protocol for 16S rRNA FISH from biopsy fixation to imaging by confocal microscopy. This protocol can be adapted for use in almost any type of tissue and represents a powerful tool for the unbiased visualization of clinically-relevant bacterial-host interactions in patient tissue. Furthermore, using species or genera-specific probes, this protocol can be adapted for the detection of specific bacterial pathogens within patient tissue.

This protocol is for the unbiased detection of tissue-associated bacteria in patient biopsies by 16S rRNA in situ hybridization and confocal microscopy.

Visualization of the interaction of bacteria with host mucosal surfaces and tissues can provide valuable insight into mechanisms of pathogenesis. While ...

Dot-Blot Assay for Detection of Leptospira DNA in Water Samples

Polymerase Chain Reaction and Dot-Blot Hybridization for Leptospira Detection in Water Samples

The dot-blot is a simple, fast, sensitive, and versatile technique that enables the identification of minimal quantities of DNA specifically targeted by probe hybridization in the presence of carrier DNA. It is based on the transfer of a known amount of DNA onto an inert solid support, such as a nylon membrane, utilizing the dot-blot apparatus and without electrophoretic separation. Nylon membranes have the advantage of high nucleic acid binding capacity (400 &#181;g/cm2), high strength, and are positively or neutrally charged. The probe used is a highly specific ssDNA fragment of 18 to 20 bases long labeled with digoxigenin (DIG). The probe will conjugate with the Leptospira DNA. Once the probe has hybridized with the target DNA, it is detected by an anti-digoxigenin antibody, allowing its easy detection through its emissions revealed in an X-ray film. The dots with an emission will correspond to the DNA fragments of interest. This method employs the non-isotopic labeling of the probe, which may have a very long half-life. The drawback of this standard immuno-label is a lower sensitivity than isotopic probes. Nevertheless, it is mitigated by coupling polymerase chain reaction (PCR) and dot-blot assays. This approach enables the enrichment of the target sequence and its detection. Additionally, it may be used as a quantitative application when compared against a serial dilution of a well-known standard. A dot-blot application to detect Leptospira from the three main clades in water samples is presented here. This methodology can be applied to large amounts of water once they have been concentrated by centrifugation to provide evidence of the presence of Leptospiral DNA. This is a valuable and satisfactory tool for general screening purposes, and may be used for other non-culturable bacteria that may be present in water, enhancing the comprehension of the ecosystem.

Author Spotlight: Leptospira DNA Detection in Water for Environmental Analysis and Disease Surveillance

In this study, a dot-blot application was designed to detect Leptospira from the three main clades in water samples. This method allows for the identification of minimal DNA quantities specifically targeted by a digoxigenin-labeled probe, easily detected by an anti-digoxigenin antibody. This approach is a valuable and satisfactory tool for screening purposes.

The dot-blot is a simple, fast, sensitive, and versatile technique that enables the identification of minimal quantities of DNA specifically targeted by ...

In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA

Summary

Explore More Videos

Chapters in this video

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Detection of Bacteria Using Fluorogenic DNAzymes

In Situ Hybridization Techniques for Paraffin-Embedded Adult Coral Samples

Robust Detection of Gene Amplification in Formalin-Fixed Paraffin-Embedded Samples by Fluorescence In Situ Hybridization

Whole Mount RNA Fluorescent in situ Hybridization of Drosophila Embryos

Visualization of Gut Microbiota-host Interactions via Fluorescence In Situ Hybridization, Lectin Staining, and Imaging

RNA Fluorescence in situ Hybridization (FISH) to Visualize Microbial Colonization and Infection in Caenorhabditis elegans Intestines

Employing Digital Droplet PCR to Detect BRAF V600E Mutations in Formalin-fixed Paraffin-embedded Reference Standard Cell Lines

Detection of Tissue-resident Bacteria in Bladder Biopsies by 16S rRNA Fluorescence In Situ Hybridization

Polymerase Chain Reaction and Dot-Blot Hybridization for Leptospira Detection in Water Samples