The authors would like to thank Sophie Castagnet and Nadia Doubli-Bounoua for their technical support. This work received financial support from the General Council of Calvados and the agreement of Region Basse-Normandie and French Government (CPER 2007-2013; project R25 p3). The authors would like to thank the experts of the AFNOR group and particularly Jean-Philippe Buffereau and Eric Dubois.

<ol><li>Brault, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+immune+response+of+foals+to+natural+infection+with+equid+herpesvirus-2+and+its+association+with+febrile+illness%5BTitle%5D)+AND+%22Vet.Immunol.Immunopathol%22%5BJournal%5D)">The immune response of foals to natural infection with equid herpesvirus-2 and its association with febrile illness.</a> Vet.Immunol.Immunopathol. 137 (1-2), 136-141 (2010).</li>
<li>Fortier, G., Van Erck, E., Pronost, S., Lekeux, P., Thiry, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Equine+gammaherpesviruses%3A+pathogenesis%2C+epidemiology+and+diagnosis%5BTitle%5D)+AND+%22Vet.J%22%5BJournal%5D)">Equine gammaherpesviruses: pathogenesis, epidemiology and diagnosis.</a> Vet.J. 186 (2), 148-156 (2010).</li>
<li>Hue, E. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Detection+and+quantitation+of+equid+gammaherpesviruses+%28EHV-2%2C+EHV-5%29+in+nasal+swabs+using+an+accredited+standardised+quantitative+PCR+method%5BTitle%5D)+AND+%22J+Virol.Methods%22%5BJournal%5D)">Detection and quantitation of equid gammaherpesviruses (EHV-2, EHV-5) in nasal swabs using an accredited standardised quantitative PCR method.</a> J Virol.Methods. 198 (1), 18-25 (2014).</li>
<li>Diallo, I. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Multiplex+real-time+PCR+for+the+detection+and+differentiation+of+equid+herpesvirus+1+%28EHV-1%29+and+equid+herpesvirus+4+%28EHV-4%29%5BTitle%5D)+AND+%22Vet.Microbiol%22%5BJournal%5D)">Multiplex real-time PCR for the detection and differentiation of equid herpesvirus 1 (EHV-1) and equid herpesvirus 4 (EHV-4).</a> Vet.Microbiol. 4 (1-3), 93-103 (2007).</li>
<li>Williams, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Equine+multinodular+pulmonary+fibrosis%3A+a+newly+recognized+herpesvirus-associated+fibrotic+lung+disease%5BTitle%5D)+AND+%22Vet.Pathol%22%5BJournal%5D)">Equine multinodular pulmonary fibrosis: a newly recognized herpesvirus-associated fibrotic lung disease.</a> Vet.Pathol. 44 (6), 849-862 (2007).</li>
<li>Mullis, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Specific+enzymatic+amplification+of+DNA+in+vitro%3A+the+polymerase+chain+reaction%5BTitle%5D)+AND+%22Cold+Spring+Harb.Symp.Quant.Biol%22%5BJournal%5D)">Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction.</a> Cold Spring Harb.Symp.Quant.Biol. 51 (1), 263-273 (1986).</li>
<li>EPA Office of Water (4607). <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=%22EPA-815-B-04-001.+Quality+Assurance%2FQuality+Control+Guidance+for+Laboratories+Performing+PCR+Analyses+on+Environmental+Samples%22">EPA-815-B-04-001. Quality Assurance/Quality Control Guidance for Laboratories Performing PCR Analyses on Environmental Samples</a>. , (2004).</li>
<li>Telford, E. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Equine+herpesviruses+2+and+5+are+gamma-herpesviruses%5BTitle%5D)+AND+%22Virology%22%5BJournal%5D)">Equine herpesviruses 2 and 5 are gamma-herpesviruses.</a> Virology. 195 (2), 492-499 (1993).</li>
<li>Fortier, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Identification+of+equid+herpesvirus-5+in+respiratory+liquids%3A+A+retrospective+study+of+785+samples+taken+in+2006-2007%5BTitle%5D)+AND+%22Vet.J%22%5BJournal%5D)">Identification of equid herpesvirus-5 in respiratory liquids: A retrospective study of 785 samples taken in 2006-2007.</a> Vet.J. 182 (2), 346-348 (2009).</li>
<li>Brault, S. A., Bird, B. H., Balasuriya, U. B., MacLachlan, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genetic+heterogeneity+and+variation+in+viral+load+during+equid+herpesvirus-2+infection+of+foals%5BTitle%5D)+AND+%22Vet.Microbiol%22%5BJournal%5D)">Genetic heterogeneity and variation in viral load during equid herpesvirus-2 infection of foals.</a> Vet.Microbiol. 147 (3-4), 253-261 (2011).</li>
<li>Association Francaise de Normalisation. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=%22NFU+47-600-1.+Animal+health+analysis+methods-PCR-Part+1%3A+Requirements+and+recommandations+for+the+implementation+of+veterinary+PCR%22">NFU 47-600-1. Animal health analysis methods-PCR-Part 1: Requirements and recommandations for the implementation of veterinary PCR</a>. , (2015).</li>
<li>Association Francaise de Normalisation. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=%22NFU+47-600-2.+Animal+health+analysis+methods-PCR-Part+2%3A+Requirements+and+recommendations+for+the+development+and+the+validation+of+veterinary+PCR%22">NFU 47-600-2. Animal health analysis methods-PCR-Part 2: Requirements and recommendations for the development and the validation of veterinary PCR</a>. , (2015).</li>
<li>ISO. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=%22EN+ISO-CEI+17025.+General+requirements+for+the+competence+of+testing+and+calibration+laboratories%22">EN ISO-CEI 17025. General requirements for the competence of testing and calibration laboratories</a>. , (2005).</li>
<li><a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=%22Manual+of+Diagnostic+Tests+and+Vaccines+for+Terrestrial+Animals+2010.+Chapter1.1.1.4%2F+5.+Principles+and+Methods+of+Validation+of+Diagnostic+Assay+for+Infectious+Diseases%22">Manual of Diagnostic Tests and Vaccines for Terrestrial Animals 2010. Chapter1.1.1.4/ 5. Principles and Methods of Validation of Diagnostic Assay for Infectious Diseases</a>. , This thoroughly revised chapter replaces Chapter 1.1.4 Principles of validation of diagnostic assays for infectious diseases and Chapter 1.1.5 Validation and quality control of polymerase chain reaction methods used for the diagnosis of infectious diseases from the sixth edition of the OIE Terrestrial Manual (2009).</li>
<li>Apaza, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Detection+and+genogrouping+of+noroviruses+from+children%27s+stools+by+Taqman+One-step+RT-PCR%5BTitle%5D)+AND+%22J+Vis.Exp%22%5BJournal%5D)">Detection and genogrouping of noroviruses from children's stools by Taqman One-step RT-PCR.</a> J Vis.Exp. (65), e3232(2012).</li>
<li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Polymerase+chain+reaction%3A+basic+protocol+plus+troubleshooting+and+optimization+strategies%5BTitle%5D)+AND+%22J+Vis.Exp%22%5BJournal%5D)">Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.</a> J Vis.Exp. (63), e3998(2012).</li>
<li>Sanger, F., Coulson, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+rapid+method+for+determining+sequences+in+DNA+by+primed+synthesis+with+DNA+polymerase%5BTitle%5D)+AND+%22J+Mol.Biol%22%5BJournal%5D)">A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase.</a> J Mol.Biol. 94 (3), 441-448 (1975).</li>
<li>Sanger, F., Nicklen, S., Coulson, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+sequencing+with+chain-terminating+inhibitors%5BTitle%5D)+AND+%22Proc.Natl.Acad.Sci.U.S.A%22%5BJournal%5D)">DNA sequencing with chain-terminating inhibitors.</a> Proc.Natl.Acad.Sci.U.S.A. 74 (12), 5463-5467 (1977).</li>
<li>NCBI. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=%22BLAST+Homepage+and+Selected+Search+Pages.+Introducing+the+BLAST+homepage+and+form+elements%2Ffunctions+of+selected+search+pages%22">BLAST Homepage and Selected Search Pages. Introducing the BLAST homepage and form elements/functions of selected search pages</a>. , (2015).</li>
<li>Greiner, M., Gardner, I. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Application+of+diagnostic+tests+in+veterinary+epidemiologic+studies%5BTitle%5D)+AND+%22Prev.Vet+Med%22%5BJournal%5D)">Application of diagnostic tests in veterinary epidemiologic studies.</a> Prev.Vet Med. 45 (1-2), 43-59 (2000).</li>
<li>Blanchard, P., Regnault, J., Schurr, F., Dubois, E., Ribiere, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Intra-laboratory+validation+of+chronic+bee+paralysis+virus+quantitation+using+an+accredited+standardised+real-time+quantitative+RT-PCR+method%5BTitle%5D)+AND+%22J+Virol.Methods%22%5BJournal%5D)">Intra-laboratory validation of chronic bee paralysis virus quantitation using an accredited standardised real-time quantitative RT-PCR method.</a> J Virol.Methods. 180 (1-2), 26-31 (2012).</li>
</ol>

The authors declare that they have no competing financial interests.

Since the 2000s, real-time PCR has been replacing gold standard techniques (cell culture and bacteria culture methods) in an increasing number of laboratories. Implementation of the technique is relatively easy. However validation of laboratory methods is essential for molecular detection and quantification of pathogens to ensure accurate, repeatable and reliable data.
Since the extraction step is the primary source of loss of biological material, it may be considered the main source of error of quantification between one protocol and another. As such, the creation of a standard curve of DNA plasmid during qRT-PCR, mainly reported in the literature, indicates the viral genome load but does not take into account the extraction step.
Description of a de novo strategy for a whole method validation process in the AFNOR norm NF U47-600-2 represents a significant progress in this area. As illustrated in this paper for EHV-2 in horses, or by others in bees21, this necessitates clear differentiation between the development step and the validation step with characterization of the PCR and characterization of the whole method. One limitation in this interesting approach is that any change in the protocol will result in the obligation to revalidate the complete process which could be very costly. This limitation was also highlighted by the fact that the confines of quantification depend on the source from which the virus is extracted (e.g., respiratory fluids, organs, blood or urine). In fact, each matrix presents different specificities in their physico-chemistry characteristics and it is important to define independently each different matrix used for viral detection and quantification by qRT-PCR. Thus, the viral genome load of each biological sample can be quantified more precisely from the extraction. The characterization also takes into account the thermocycler model and when the use of a previously well-characterized method (e.g., the EHV-2 qPCR method described in this paper) necessitates a new type of machine in the parent laboratory or another laboratory, one must confirm the performance of that instrument. The confirmation of the performance of a qPCR assay is a prerequisite for all tests bring into a laboratory. This is normally achieved by analyzing a reference sample with known properties. Such a check is a prerequisite and considered mandatory as requested by the NF 47-600-1 AFNOR norm in order to validate the performance of the qPCR (LOD, LOQ efficiency) and the robustness of the whole method (LOD, LOQ). Not only during the development and characterization steps but also when used in research or for diagnostic purposes, the risk factors can be identified and well controlled to ensure standardization of the protocol. Of particular concern is adequate staff training, highly qualified personnel, quality control of the consumables used and their storage, control of the immediate environmental conditions and awareness of metrological conditions that may affect the performance of the scientific instruments involved in the assay. Use of reference samples for inter-laboratory comparisons could also help control the uncertainties. In this manner, comparison of data between laboratories may be facilitated. Indeed, inter-laboratory proficiency tests are essential to evaluate and confirm the reproducibility of the method.
Viral genome load results which are expressed in international units (IU) of the analyzed biological matrix (IU: copies/ml for fluids or copies/g for tissues) are easier to use in order to compare results between different laboratories. All the results above the LOQ are expressed as copies/ml and a result between the LOD and LOQ is taken as a non-quantifiable positive result. Presenting quantificational data of the genome in this manner conforms more precisely to the process of analyses (amplification of the genome). In fact, in cell culture experiments, expression of the viral load by TCID50 (median tissue culture infective dose) is dependent on the nature of the cells and virus strains. Each strain line possesses its unique infection kinetics and some viruses like EHV-2 can take several days before the first cytopathogenic effect is apparent.
In conclusion, this new method of characterization of qRT-PCR should facilitate the harmonization of data presentation and interpretation between laboratories. This will be very useful for potential new applications of qRT-PCR in the future like the establishment of a cut-off value for declaration of the disease status instead of merely the presence or absence of the pathogen.

Equid herpesvirus-2 (EHV-2) is involved in a respiratory syndrome, with potential clinical manifestations such as nasal discharge, pharyngitis and swollen lymph nodes1-3. This virus is also suspected to be associated with the poor-performance of horses, which may result in a significant and negative economic impact for the horse industry2.
Until now, the gold standard for gamma-EHV (&#947;-EHV) detection was the cell culture method. The first inconvenience of this procedure was the absence of discrimination between EHV-2 and other &#947;-EHV&#39;s (e.g., EHV-5). The second inconvenience was the slow development of the cytopathic process, which takes from 12 to 28 days to manifest4,5.
Development of a validated and normalized quantitative real-time polymerase chain reaction (qRT-PCR) method will help to rapidly detect the virus, to discriminate between EHV-2 and EHV-5 and to study the relationship between the viral genome load and the disease thanks to the quantification aspect.
Polymerase chain reaction (PCR) was described for the first time in 1986 by Mullis6 and is about to become the new gold standard in most of the fields of biological diagnosis (human, environment and veterinary). This method, which is based on the amplification of a part of the genome of pathogens, presents many advantages: specificity, sensitivity and rapidity. Moreover, the risk of amplicon contamination receded since the advent of qRT-PCR and quality assurance7. Nevertheless, the recognition of PCR as a new gold standard method necessitated more than just improved performance data but also the demonstration of the control of development and validation steps of the whole method without degradation of the performance over time.
The first molecular tools used for the detection of EHV-2 were time consuming and involved non-specific amplification with nested PCR followed by sequencing8. The targeted genes for herpes viruses were deoxyribonucleic acid (DNA) polymerase and DNA packaging9. However, nested PCR presents a high risk of contamination by amplicons. Since then, conventional PCR tests have been designed to amplify the interleukin 10-like gene or glycoprotein B gene, reviewed in 20092. More recently, real-time PCR characteristics were described for the quantification of EHV-210 but no data were available concerning validation of the whole method including the extraction process.
In this protocol, development and validation procedures are described for a quantitative PCR method for the detection and quantification of EHV-2 DNA in equine respiratory fluids according to the Association fran&#231;aise de normalisation (AFNOR) norm NF U47-6003,11,12, which is the French representative in the international normalization committee. This norm details the &#34;Requirements and recommendations for the implementation, development and validation of veterinary PCR in animal health analysis method&#34;11,12, according to the NF EN ISO/CEI 17025, 200513 and to OIE (World Organization for Animal Health) recommendations, 201014. The EHV-2 qRT-PCR validation protocol involves a three-part procedure: (a) development of the qRT-PCR assay, (b) characterization of qRT-PCR assay alone and (c) characterization of the whole analytical method (from extraction of nucleic acids from the biological sample to PCR analysis).
The characterization of the qRT-PCR assay and of the whole analytical method include the definition of two limits: the limit of detection (LOD) and the limit of quantification (LOQ). The LOD95% PCR represents the lowest number of nucleic acid copies per unit volume that can be detected in 95% of all cases. The LOQ95% PCR represents the lowest quantity of nucleic acid copies that can be determined taking into account the uncertainties.
This qRT-PCR method allows the precise detection and rapid quantification of EHV-2 in respiratory fluids. Furthermore, the method could be applied in other laboratories to ensure a standardized procedure and as general template for the development of other new qRT-PCR assays.

<table><tbody><tr><td>AB-1900 natural color ABgene 96 well plate&amp;nbsp;</td><td>Dutsher</td><td>16924</td><td></td></tr><tr><td>Adhesive film qPCR Absolute&amp;nbsp;</td><td>Dutsher</td><td>16629</td><td>Adhesive film used for sealing the plate prior to the qRT-PCR run</td></tr><tr><td>0.5 ml microtubes, skirted, caps</td><td>Dutsher</td><td>039258</td><td></td></tr><tr><td>Ethanol 98%</td><td>Sodipro</td><td>SAF322941000</td><td></td></tr><tr><td>Primers</td><td>Eurofins</td><td>Custom order</td><td></td></tr><tr><td>Probe</td><td>Life Technologies</td><td>Custom order</td><td></td></tr><tr><td>Plasmid</td><td>Eurofins</td><td>Custom order</td><td></td></tr><tr><td>QIAamp&amp;nbsp; RNA viral Mini Kit&lt;br/&gt; (containing: QIAamp Mini column, AVL&amp;nbsp; buffer,&amp;nbsp; AW1 buffer, AW2 buffer, AVE buffer, collection tubes)&amp;nbsp;</td><td>Qiagen</td><td>52906</td><td>AVL buffer: pre-warm 5 min at 72 &amp;deg;C</td></tr><tr><td>Sequencing by Sanger method</td><td>Eurofins</td><td>Custom order</td><td></td></tr><tr><td>Taqman Universal PCR Master Mix</td><td>Life Technologies</td><td>4364340</td><td></td></tr><tr><td>Tris-EDTA buffer solution</td><td>Santa Cruz</td><td>sc-296653A</td><td></td></tr><tr><td>NanoDrop 2000c Spectrophotometer</td><td>Thermoscientific</td><td>ND-2000C</td><td></td></tr><tr><td>StepOnePlus Real-Time PCR systems</td><td>Life Technologies</td><td>4376600</td><td>pre-warm 15 min&amp;nbsp;</td></tr></tbody></table>

development and validation of a quantitative pcr method for equid herpesvirus-2 diagnostics in respiratory fluids

The protocol describes a quantitative RT-PCR method for the detection and quantification of EHV-2 in equine respiratory fluids according to the NF U47-600 norm. After the development and first validation step, two distinct characterization steps were performed according to the AFNOR norm: (a) characterization of the qRT-PCR assay alone and (b) characterization of the whole analytical method. The validation of the whole analytical method included the portrayal of all steps between the extraction of nucleic acids and the final PCR analysis. 
Validation of the whole method is very important for virus detection by qRT-PCR in order to get an accurate determination of the viral genome load. Since the extraction step is the primary source of loss of biological material, it may be considered the main source of error of quantification between one protocol and another. For this reason, the AFNOR norm NF-U-47-600 recommends including the range of plasmid dilution before the extraction step. In addition, the limits of quantification depend on the source from which the virus is extracted. Viral genome load results, which are expressed in international units (IU), are easier to use in order to compare results between different laboratories. 
This new method of characterization of qRT-PCR should facilitate the harmonization of data presentation and interpretation between laboratories.

The quantitative RT-PCR method, as described above, was implemented to detect and quantify equid herpesvirus-2 in respiratory fluids. Figure 1 illustrates a schematic workflow chart for the development and validation of a quantitative RT-PCR method according to the AFNOR norm NF U47-600. Specificity of the primers and probes were validated during the step-by-step development of the PCR. Only EHV-2 strains were amplified in this system. Subsequently, the performance of the qRT-PCR had to be characterized.
Firstly, to estimate the LODPCR, a 6 ten-fold serial dilution was performed to establish the abatement zone (Figure 2). In this example, 6 ten-fold serial dilutions were made between 10-5 and 10-10 (between 26,000 and 0.26 copies/2.5 µl sample) to estimate the LODPCR. The abatement zone lies between dilutions of 10-9 and 10-10 (between 2.6 and 0.26 copies/2.5 µl sample). To determine the LODPCR value in this case, 6 two-fold serial dilutions of the plasmid were made in this abatement zone between 5.2 and 0.16 copies/2.5 µl sample. The LODPCR value was 2.6 copies/2.5 µl sample.
To determine the linearity range and LOQPCR, the LODPCR value was used to start the range of 6 ten-fold serial dilutions, between 2.6 (LODPCR) and 260,000 copies/2.5 µl sample. Figure 3 illustrates a linear regression for the EHV2 qRT-PCR from one trial. The performances of linear regression (Figure 4) are validated in quadruplicate using the calculations described in Table 3. The calculations are performed to define the linearity range according to the criteria absolute Biasi value ≤0.25 log10, whatever the level i of plasmid load. In this case, the linearity range lay between 2.6 and 260,000 copies/2.5 µl sample. The LOQPCR is the lowest concentration in the linearity range (i.e., 2.6 copies/2.5 µl sample in this case). ULIN was determined to be 0.12 log10 in the range 2.6-260,000 copies/2.5 µl of DNA.
After development (Figure 1, blue) and characterization of the qRT-PCR (Figure 1, yellow), the AFNOR NF U47-600 norm recommends characterization of the whole analytical method from DNA extraction to qRT-PCR (Figure 1, orange). The diagnostic sensitivity and specificity were calculated as described in Table 4. The quantitative performances of the qRT-PCR whole analytical method was evaluated and validated with an accuracy profile (Figure 5).
This protocol, which uses state-of-the-art molecular technology, allowed us to detect and quantify the EHV-2 viral genome load in 172 nasal swab samples obtained from horses with respiratory disorders and/or clinical suspicion of infection. The incidence of EHV-2 from field (biological) samples was 50% (86/172) in this population. The quantitative analyses showed that viral genome loads of EHV-2 were significantly higher in young horses and the repartition of viral genome loads decreased with age (Figure 6). In the present study, the highest EHV-2 viral genome load (1.9 x 1011 copies/ml) was detected in foals (Figure 6).
<img alt="qRT-PCR development and validation diagram, covering primer design, method characterization, detection limits, linearity, specificity, and reproducibility analysis." src="/files/ftp_upload/53672/53672fig1.jpg" data-altupdatedat="1747911167000" data-alt="Figure 1"> 
Figure 1: Workflow chart for the development (blue), the characterization of the quantitative RT-PCR (yellow) and the characterization of the whole analytical method from DNA extraction to qRT-PCR (orange) according to the AFNOR norm NF U47-600-2. The workflow chart resumes the different steps for the development, the characterization of the quantitative RT-PCR and the characterization of the whole analytical method from DNA extraction to qRT-PCR. For each step, the workflow chart indicates the number of required runs, dilutions to be perform and the number of required analysts. <a href="https://www.jove.com/files/ftp_upload/53672/53672fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Real-time PCR amplification plot showing DNA concentration curve and negative control comparison." src="/files/ftp_upload/53672/53672fig2.jpg" data-altupdatedat="1747911167000" data-alt="Figure 2"> 
Figure 2: Determination of the abatement zone with representative results from real-time PCR curves obtained with 6 ten-fold serial dilutions of plasmid. To estimate the abatement zone, 6 ten-fold serial dilutions are made between 10-5 (26,000 copies/2.5 µl sample) and 10-10 (0.26 copies/2.5 µl sample). The abatement zone lies between dilutions of 10-9 (2.6 copies/2.5 µl sample) and 10-10 (0.26 copies/2.5 µl sample). In this case, 6 two-fold serial dilutions of plasmid were made in this abatement zone to determine the LOD 95% PCR, between 5.2 and 0.16 copies/2.5 µl sample. <a href="https://www.jove.com/files/ftp_upload/53672/53672fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="qPCR standard curve, linear regression graph, cycle threshold vs. log plasmid copy quantification." src="/files/ftp_upload/53672/53672fig3.jpg" data-altupdatedat="1747911167000" data-alt="Figure 3"> 
Figure 3: Linear regression for EHV2 qRT-PCR. The linearity of quantitative testing is the ability to generate results which are proportional to the concentration of the target present in a specific range. This can be modeled by linear regression (y = ax + b) between the instrumental response (Cycle threshold or Ct) and the logarithm of the quantity of the target (number of target copies/2.5 µl sample). <a href="https://www.jove.com/files/ftp_upload/53672/53672fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Plasmid level vs. mean bias graph, error bars, data analysis in gene expression research." src="/files/ftp_upload/53672/53672fig4.jpg" data-altupdatedat="1747911167000" data-alt="Figure 4"> 
Figure 4: Performance of linear regression of EHV-2 qPCR. Mean bias represent the mean difference between the measured plasmid quantity (<img alt="Mean symbol x̄ in statistics formula; educational math concept." src="/files/ftp_upload/53672/fig4-1.jpg" data-altupdatedat="1747911167000" data-alt="fig4-1">) and the theoretical plasmid quantity (x'i) for each plasmid level. Vertical bars represent the linearity uncertainty (ULINi) given by the formula 
<img alt="Uncertainty equation U_LINI=2√(SD'i²+mean.bias²); statistical analysis formula." src="/files/ftp_upload/53672/fig4-2.jpg" data-altupdatedat="1747911167000" data-alt="fig4-2"> 
where SD'i is the standard deviation of measured plasmid quantity. <a href="https://www.jove.com/files/ftp_upload/53672/53672fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="EHV2 plasmid analysis chart; log scale; bias vs. plasmid level." src="/files/ftp_upload/53672/53672fig5.jpg" data-altupdatedat="1747911167000" data-alt="Figure 5"> 
Figure 5: Accuracy profiles based on the validation results of the EHV-2 qRT-PCR method. The green line (circles) represents the trueness of the data (systematic error, or bias). The acceptability limits are defined at ± 0.75 Log10 by the laboratory (dashed lines). The lower and the upper accuracy limits were determined for each plasmid load level from the mean bias ± twice the standard deviation of the reliability data (red lines). <a href="https://www.jove.com/files/ftp_upload/53672/53672fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="EHV2 viral genome load scatter plot with age group comparison, showing data distribution and variance." src="/files/ftp_upload/53672/53672fig6.jpg" data-altupdatedat="1747911167000" data-alt="Figure 6"> 
Figure 6: Quantification of viral genome loads of EHV-2 according to age. The viral genome load distribution of EHV-2 detected in nasal swab samples is represented for the different age groups. The horizontal lines represent the median values within the standard deviation (m = months). * Significantly different by ANOVA with Newman-Keuls post-hoc test (p &lt;0.05). <a href="https://www.jove.com/files/ftp_upload/53672/53672fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Target gene</td>
			<td colspan="3">Primers, probe and plasmide sequences (5'-3')</td>
			<td>Nucleotide position</td>
			<td>Product size (nucleotides)</td>
			<td colspan="2">Thermal cycling conditions</td>
			<td>References</td>
		</tr>
		<tr>
			<td rowspan="4">EHV2 gB 
			(HQ247755.1)</td>
			<td colspan="3">Forward: GTGGCCAGCGGGGTGTTC </td>
			<td>2113-2130</td>
			<td rowspan="4">78</td>
			<td>95 °C 5 min</td>
			<td></td>
			<td rowspan="4">11</td>
		</tr>
		<tr>
			<td colspan="3">Reverse: CCCCCAAAGGGATTYTTGAA</td>
			<td>2189-2170</td>
			<td>95 °C 15 sec</td>
			<td rowspan="2">45 cycles</td>
		</tr>
		<tr>
			<td colspan="3">Probe: FAM-CCCTCTTTGGGAGCATAGTCTCGGGG-MGB</td>
			<td>2132-2157</td>
			<td>60 °C 1 min</td>
		</tr>
		<tr>
			<td colspan="3">Plasmid: 
			ACCTGGGCACCATAGGCAAGGTGGTGGTCA 
			ATGTGGCCAGCGGGGTGTTCTCCCTCTTTG 
			GGAGCATAGTCTCGGGGGTGATAAGCTTTTT 
			CAAAAATCCCTTTGGGGGCATGCTGCTCATA 
			GTCCTCATCATAGCCGGGGTAGTGGTGGTG 
			TACCTGTTTATGACCAGGTCCAGGAGCATAT 
			ACTCTGCCCCCATTAGAATGCTCTACCCCGG 
			GGTGGAGAGGGCGGCCCAGGAGCCGGGCG 
			CGCACCCGGTGTCAGAAGACCAAATCAGGA 
			ACATCCTGATGGGAATGCACCAATTTCAG</td>
			<td>2081-2381</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 1: Sequences of primers, probes and positive synthetic DNA controls used in this protocol. The sequence of plasmid (positive synthetic DNA) corresponds to nucleotide positions 2081-2381 of EHV2gB sequence (HQ247755.1). The design of primers and probes used in this protocol was obtained by using specific software.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td rowspan="2">PATHOGENS</td>
			<td rowspan="2">Reference (origin)</td>
			<td rowspan="2">Number of strains</td>
			<td>RESULTS</td>
		</tr>
		<tr>
			<td>EHV-2</td>
		</tr>
		<tr>
			<td rowspan="2">EHV-2</td>
			<td>VR701 (ATCC)</td>
			<td rowspan="2">20</td>
			<td rowspan="2">Positive</td>
		</tr>
		<tr>
			<td>20 samples (FDL collection)</td>
		</tr>
		<tr>
			<td rowspan="2">EHV-5</td>
			<td>KD05 (GERC)</td>
			<td rowspan="2">20</td>
			<td rowspan="2">Negative</td>
		</tr>
		<tr>
			<td>20 samples (FDL collection)</td>
		</tr>
		<tr>
			<td rowspan="2">EHV-3</td>
			<td>VR352 (ATCC)</td>
			<td rowspan="2">2</td>
			<td rowspan="2">Negative</td>
		</tr>
		<tr>
			<td>T934 WSV (GERC)</td>
		</tr>
		<tr>
			<td rowspan="2">EHV-1</td>
			<td>Kentucky strain Ky A (ATCC)</td>
			<td rowspan="2">3</td>
			<td rowspan="2">Negative</td>
		</tr>
		<tr>
			<td>2 samples (FDL collection)</td>
		</tr>
		<tr>
			<td>EHV-4</td>
			<td>VR2230 (ATCC)</td>
			<td>1</td>
			<td>Negative</td>
		</tr>
		<tr>
			<td>Asinine herpesvirus AHV5</td>
			<td>FDL Collection</td>
			<td>1</td>
			<td>Negative</td>
		</tr>
		<tr>
			<td rowspan="2">Equine Influenza Virus </td>
			<td>A/equine/Jouars/4/2006 (H3N8)</td>
			<td rowspan="2">1</td>
			<td rowspan="2">Negative</td>
		</tr>
		<tr>
			<td>(Accession Number JX091752)</td>
		</tr>
		<tr>
			<td>Equine Arteritis Virus</td>
			<td>VR796 (ATCC)</td>
			<td>2</td>
			<td>Negative</td>
		</tr>
		<tr>
			<td>Rhodococcus equi</td>
			<td>FDL Collection</td>
			<td>1</td>
			<td>Negative</td>
		</tr>
		<tr>
			<td>Streptococcus equi subsp. Zooepidemicus</td>
			<td>FDL Collection</td>
			<td>1</td>
			<td>Negative</td>
		</tr>
		<tr>
			<td>Streptococcus equi subsp. equi</td>
			<td>FDL Collection</td>
			<td>1</td>
			<td>Negative</td>
		</tr>
		<tr>
			<td>Coxiella burnetii </td>
			<td>ADI-142-100 (Adiagene)</td>
			<td>1</td>
			<td>Negative</td>
		</tr>
		<tr>
			<td>Chlamydophila abortus</td>
			<td>ADI-211-50 (Adiagene)</td>
			<td>1</td>
			<td>Negative</td>
		</tr>
		<tr>
			<td>Klebsiella pneumoniae</td>
			<td>FDL Collection</td>
			<td>1</td>
			<td>Negative</td>
		</tr>
	</tbody>
</table>
Table 2: Analytical specificity of qRT-PCR for EHV-2.
<img alt="Quantitative PCR data analysis table showing bias calculations, efficiency, and critical values." src="/files/ftp_upload/53672/53672table3.jpg" data-altupdatedat="1747911167000" data-alt="Table 3"> 
Table 3: Calculation of the bias and linearity uncertainty (adapted from NF U47-600-212). For each trial, the performances of linear regression (y = ax+b) are validated using the table where y is the cycle threshold obtained; a is the slope obtained; x is the plasmid level and b is the intercept. i is the plasmid level (i varies from 1 to k levels); k is the number of plasmid levels used (e.g, k = 6 in this table); j is the trial (j varies from 1 to I trials); I is the number of trials, comprised between 3 and 6 trials (e.g. I = 4 in this table). xi is the estimated plasmid quantity for each i plasmid level. x'i  is the theoretical plasmid quantity obtained with equation x'i = log10(xi) for each i plasmid level. During each j trial, the cycle threshold obtained for each i plasmid level is calculated with the linear regression yi,j = ajxi,j + bj. <img alt="Equation variable \(\hat{x}_{i,j}\) symbol representing estimate in statistical analysis and data modeling." src="/files/ftp_upload/53672/table3-1.jpg" data-altupdatedat="1747911167000" data-alt="table3-1"> is the measured plasmid quantity during the trial j. Biasi is the difference observed between the measured plasmid quantity and the theoretical plasmid quantity for each trial and each plasmid level. <img alt="Vector notation, mathematical symbol for average velocity with unit vector, educational diagram" src="/files/ftp_upload/53672/table3-2.jpg" data-altupdatedat="1747911167000" data-alt="table3-2"> is the mean value of <img alt="x̂ᵢⱼ mathematical symbol for statistical data analysis and estimation techniques." src="/files/ftp_upload/53672/table3-3.jpg" data-altupdatedat="1747911167000" data-alt="table3-3"> by each i plasmid level; SD'i is the standard deviation of measured quantity <img alt="Polynomial approximation symbol \(\hat{x}_{i,j}\) in static equilibrium equation analysis." src="/files/ftp_upload/53672/table3-4.jpg" data-altupdatedat="1747911167000" data-alt="table3-4"> for each i plasmid level; Mean bias is the mean of Biasi; ULINi is the linearity uncertainty determined for each i plasmid level calculated from SD'i and mean bias. <a href="https://www.jove.com/files/ftp_upload/53672/53672table3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td></td>
			<td colspan="2">Real status of sample</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>Positive</td>
			<td>Negative</td>
		</tr>
		<tr>
			<td rowspan="3">Results obtained with whole method</td>
			<td>Positive</td>
			<td>RP (real positive)</td>
			<td>FP (false positive)</td>
		</tr>
		<tr>
			<td>Negative</td>
			<td>FN (false negative)</td>
			<td>RN (real negative)</td>
		</tr>
		<tr>
			<td>Total</td>
			<td>RP+FN</td>
			<td>FP+RN</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>Se = RP/(RP+FN)</td>
			<td>Sp = RN/(RN+FP)</td>
		</tr>
	</tbody>
</table>
Table 4: Calculation of diagnostic sensitivity (Se) and specificity (Sp) of the whole method. A Schwartz table was used to calculate the confidence interval at 95% of sensitivity and specificity of the whole method as described in NF U47-600-2.

Watch this Scientific Journal Video about Development and Validation of a Quantitative PCR Method for Equid Herpesvirus-2 Diagnostics in Respiratory Fluids at JoVE.com

Development and Validation of a Quantitative PCR Method for Equid Herpesvirus-2 Diagnostics in Respiratory Fluids

Here, we present a protocol for the development and validation of a quantitative PCR method used for the detection and quantification of EHV-2 DNA in equine respiratory fluids. The EHV-2 qRT-PCR validation protocol involves a three-part procedure: development, characterization of qRT-PCR assay alone, and characterization of the whole analytical method.

The protocol describes a quantitative RT-PCR method for the detection and quantification of EHV-2 in equine respiratory fluids according to the NF U47-600 ...

development-validation-quantitative-pcr-method-for-equid-herpesvirus

Research

JoVE Journal

Immunology and Infection

28.3K Views.  LABÉO Frank Duncombe. Here, we present a protocol for the development and validation of a quantitative PCR method used for the detection and quantification of EHV-2 DNA in equine respiratory fluids. The EHV-2 qRT-PCR validation protocol involves a three-part procedure: development, characterization of qRT-PCR assay alone, and characterization of the whole analytical method.

Video: Development and Validation of a Quantitative PCR Method for Equid Herpesvirus-2 Diagnostics in Respiratory Fluids

Cost-effective Method for Microbial Source Tracking Using Specific Human and Animal Viruses

Microbial contamination of the environment represents a significant health risk. Classical bacterial fecal indicators have shown to have significant limitations, viruses are more resistant to many inactivation processes and standard fecal indicators do not inform on the source of contamination. The development of cost-effective methods for the concentration of viruses from water and molecular assays facilitates the applicability of viruses as indicators of fecal contamination and as microbial source tracking (MST) tools. Adenoviruses and polyomaviruses are DNA viruses infecting specific vertebrate species including humans and are persistently excreted in feces and/or urine in all geographical areas studied. In previous studies, we suggested the quantification of human adenoviruses (HAdV) and JC polyomaviruses (JCPyV) by quantitative PCR (qPCR) as an index of human fecal contamination. Recently, we have developed qPCR assays for the specific quantification of porcine adenoviruses (PAdV) and bovine polyomaviruses (BPyV) as animal fecal markers of contamination with sensitivities of 1-10 genome copies per test tube. In this study, we present the procedure to be followed to identify the source of contamination in water samples using these tools. As example of representative results, analysis of viruses in ground water presenting high levels of nitrates is shown.
Detection of viruses in low or moderately polluted waters requires the concentration of the viruses from at least several liters of water into a much smaller volume, a procedure that usually includes two concentration steps in series. This somewhat cumbersome procedure and the variability observed in viral recoveries significantly hamper the simultaneous processing of a large number of water samples.
In order to eliminate the bottleneck caused by the two-step procedures we have applied a one-step protocol developed in previous studies and applicable to a diversity of water matrices. The procedure includes: acidification of ten-liter water samples, flocculation by skimmed milk, gravity sedimentation of the flocculated materials, collection of the precipitate and centrifugation, resuspension of the precipitate in 10 ml phosphate buffer. The viral concentrate is used for the extraction of viral nucleic acids and the specific adenoviruses and polyomaviruses of interest are quantified by qPCR. High number of samples may be simultaneously analyzed using this low-cost concentration method.
The procedure has been applied to the analysis of bathing waters, seawater and river water and in this study, we present results analyzing groundwater samples. This high-throughput quantitative method is reliable, straightforward, and cost-effective.

The study describes a cost-effective method for the identification of the source of fecal/urine contamination or contamination by nitrates in water using qPCR for the specific quantification of human/porcine/bovine DNA viruses, adenoviruses and polyomaviruses, proposed as MST tools.

Microbial contamination of the environment represents a significant health risk. Classical bacterial fecal indicators have shown to have significant ...

Rapid Diagnosis of Avian Influenza Virus in Wild Birds: Use of a Portable rRT-PCR and Freeze-dried Reagents in the Field

Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAI) of the H5N1 subtype, prompting surveillance along migratory flyways. Sampling of wild birds for avian influenza virus (AIV) is often conducted in remote regions, but results are often delayed because of the need to transport samples to a laboratory equipped for molecular testing. Real-time reverse transcriptase polymerase chain reaction (rRT-PCR) is a molecular technique that offers one of the most accurate and sensitive methods for diagnosis of AIV. The previously strict lab protocols needed for rRT-PCR are now being adapted for the field. Development of freeze-dried (lyophilized) reagents that do not require cold chain, with sensitivity at the level of wet reagents has brought on-site remote testing to a practical goal.
Here we present a method for the rapid diagnosis of AIV in wild birds using an rRT-PCR unit (Ruggedized Advanced Pathogen Identification Device or RAPID, Idaho Technologies, Salt Lake City, UT) that employs lyophilized reagents (Influenza A Target 1 Taqman; ASAY-ASY-0109, Idaho Technologies). The reagents contain all of the necessary components for testing at appropriate concentrations in a single tube: primers, probes, enzymes, buffers and internal positive controls, eliminating errors associated with improper storage or handling of wet reagents. The portable unit performs a screen for Influenza A by targeting the matrix gene and yields results in 2-3 hours. Genetic subtyping is also possible with H5 and H7 primer sets that target the hemagglutinin gene.
The system is suitable for use on cloacal and oropharyngeal samples collected from wild birds, as demonstrated here on the migratory shorebird species, the western sandpiper (Calidrus mauri) captured in Northern California. Animal handling followed protocols approved by the Animal Care and Use Committee of the U.S. Geological Survey Western Ecological Research Center and permits of the U.S. Geological Survey Bird Banding Laboratory. The primary advantage of this technique is to expedite diagnosis of wild birds, increasing the chances of containing an outbreak in a remote location. On-site diagnosis would also prove useful for identifying and studying infected individuals in wild populations. The opportunity to collect information on host biology (immunological and physiological response to infection) and spatial ecology (migratory performance of infected birds) will provide insights into the extent to which wild birds can act as vectors for AIV over long distances.

This study describes diagnosis of avian influenza in wild birds using a portable rRT-PCR system. The method takes advantage of freeze-dried reagents to screen wild birds in a non-laboratory setting, typical of an outbreak scenario. Use of molecular tools provides accurate and sensitive alternatives for rapid diagnosis.

Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAI) of the H5N1 subtype, prompting surveillance along migratory ...

Evaluation of a Universal Nested Reverse Transcription Polymerase Chain Reaction for the Detection of Lyssaviruses

To detect rabies virus and other member species of the genus Lyssavirus within the family Rhabdoviridae, the pan-lyssavirus nested reverse transcription polymerase chain reaction (nested RT-PCR) was developed to detect the conserved region of the nucleoprotein (N) gene of lyssaviruses. The method applies reverse transcription (RT) using viral RNA as template and oligo (dT)15 and random hexamers as primers to synthesize the viral complementary DNA (cDNA). Then, the viral cDNA is used as a template to amplify an 845 bp N gene fragment in first-round PCR using outer primers, followed by second-round nested PCR to amplify the final 371 bp fragment using inner primers. This method can detect different genetic clades of rabies viruses (RABV). The validation, using 9,624 brain specimens from eight domestic animal species in 10 years of clinical rabies diagnoses and surveillance in China, showed that the method has 100% sensitivity and 99.97% specificity in comparison with the direct fluorescent antibody test (FAT), the gold standard method recommended by the World Health Organization (WHO) and the World Organization for Animal Health (OIE). In addition, the method could also specifically amplify the targeted N gene fragment of 15 other approved and two novel lyssavirus species in the 10th Report of the International Committee on Taxonomy of Viruses (ICTV) as evaluated by a mimic detection of synthesized N gene plasmids of all lyssaviruses. The method provides a convenient alternative to FAT for rabies diagnosis and has been approved as a National Standard (GB/T36789-2018) of China.

A pan-lyssavirus nested reverse transcription polymerase chain reaction has been developed to detect specifically all known lyssaviruses. Validation using rabies brain samples of different animal species showed that this method has a sensitivity and specificity equivalent to the gold standard fluorescent antibody test and could be used for routine rabies diagnosis.

To detect rabies virus and other member species of the genus Lyssavirus within the family Rhabdoviridae, the pan-lyssavirus nested reverse transcription ...

Genetics

Production and Purification of Non Replicative Canine Adenovirus Type 2 Derived Vectors

Adenovirus (Ad) derived vectors have been widely used for short or long-term gene transfer, both for gene therapy and vaccine applications. Because of the frequent pre-existing immunity against the classically used human adenovirus type 5, canine adenovirus type 2 (CAV2) has been proposed as an alternative vector for human gene transfer. The well-characterized biology of CAV2, together with its ease of genetic manipulation, offer major advantages, notably for gene transfer into the central nervous system, or for inducing a wide range of protective immune responses, from humoral to cellular immunity. Nowadays, CAV2 represents one of the most appealing nonhuman adenovirus for use as a vaccine vector. This protocol describes a simple method to construct, produce and titer recombinant CAV2 vectors. After cloning the expression cassette of the gene of interest into a shuttle plasmid, the recombinant genomic plasmid is obtained by homologous recombination in the E. coli BJ5183 bacterial strain. The resulting genomic plasmid is then transfected into canine kidney cells expressing the complementing CAV2-E1 genes (DK-E1). A viral amplification enables the production of a large viral stock, which is purified by ultracentrifugation through cesium chloride gradients and desalted by dialysis. The resulting viral suspension routinely has a titer of over 1010 infectious particles per ml and can be directly administrated in vivo.

These past 15 years, canine adenovirus type 2 (CAV2)-derived vectors have proven their efficiency to transduce cells in vitro&#160;and in vivo and are widely used for vaccination and gene therapy. Here, we describe a procedure to construct, produce and purify CAV2 vectors, giving rise to high-titer viral suspensions.

Adenovirus (Ad) derived vectors have been widely used for short or long-term gene transfer, both for gene therapy and vaccine applications. Because of the ...

High-throughput Detection of Respiratory Pathogens in Animal Specimens by Nanoscale PCR

Nanoliter scale real-time PCR uses spatial multiplexing to allow multiple assays to be run in parallel on a single plate without the typical drawbacks of combining reactions together. We designed and evaluated a panel based on this principle to rapidly identify the presence of common disease agents in dogs and horses with acute respiratory illness. This manuscript describes a nanoscale diagnostic PCR workflow for sample preparation, amplification, and analysis of target pathogen sequences, focusing on procedures that are different from microliter scale reactions. In the respiratory panel presented, 18 assays were each set up in triplicate, accommodating up to 48 samples per plate. A universal extraction and pre-amplification workflow was optimized for high-throughput sample preparation to accommodate multiple matrices and DNA and RNA based pathogens. Representative data are presented for one RNA target (influenza A matrix) and one DNA target (equine herpesvirus 1). The ability to quickly and accurately test for a comprehensive, syndrome-based group of pathogens is a valuable tool for improving efficiency and ergonomics of diagnostic testing and for acute respiratory disease diagnosis and management.

High-throughput testing of DNA and RNA based pathogens by nanoscale PCR is described using a syndromic canine and equine respiratory PCR panel.

Nanoliter scale real-time PCR uses spatial multiplexing to allow multiple assays to be run in parallel on a single plate without the typical drawbacks of ...

Generation, Amplification, and Titration of Recombinant Respiratory Syncytial Viruses

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, both to decipher viral replication mechanisms and to study antivirals or provide development platform for vaccines. The construction and manipulation of a reverse genetic system for a negative-strand RNA virus such as a respiratory syncytial virus (RSV), however, remains delicate and requires special know-how. The RSV genome is a single-strand, negative-sense RNA of about 15 kb that serves as a template for both viral RNA replication and transcription. Our reverse genetics system uses a cDNA copy of the human RSV long strain genome (HRSV). This cDNA, as well as cDNAs encoding viral proteins of the polymerase complex (L, P, N, and M2-1), are placed in individual expression vectors under T7 polymerase control sequences. The transfection of these elements in BSR-T7/5 cells, which stably express T7 polymerase, allows the cytoplasmic replication and transcription of the recombinant RSV, giving rise to genetically modified virions. A new RSV, which is present at the cell surface and in the culture supernatant of BSRT7/5, is gathered to infect human HEp-2 cells for viral amplification. Two or three rounds of amplification are needed to obtain viral stocks containing 1 x 106 to 1 x 107 plaque-forming units (PFU)/mL. Methods for the optimal harvesting, freezing, and titration of viral stocks are described here in detail. We illustrate the protocol presented here by creating two recombinant viruses respectively expressing free green fluorescent protein (GFP) (RSV-GFP) or viral M2-1 fused to GFP (RSV-M2-1-GFP). We show how to use RSV-GFP to quantify RSV replication and the RSV-M2-1-GFP to visualize viral structures, as well as viral protein dynamics in live cells, by using video microscopy techniques.

We describe a method for generating and amplifying genetically modified respiratory syncytial viruses (RSVs) and an optimized plaque assay for RSVs. We illustrate this protocol by creating two recombinant viruses that respectively allow quantification of RSV replication and live analysis of RSV inclusion bodies and inclusion bodies-associated granules dynamics.

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, ...

Field Postmortem Rabies Rapid Immunochromatographic Diagnostic Test for Resource-Limited Settings with Further Molecular Applications

Functional rabies surveillance systems are crucial to provide reliable data and increase the political commitment necessary for disease control. To date, animals suspected as rabies-positive must be submitted to a postmortem confirmation using classical or molecular laboratory methods. However, most endemic areas are in low- and middle-income countries where animal rabies diagnosis is restricted to central veterinary laboratories. Poor availability of surveillance infrastructure leads to serious disease underreporting from remote areas. Several diagnostic protocols requiring low technical expertise have been recently developed, providing opportunity to establish rabies diagnosis in decentralized laboratories. We present here a complete protocol for field postmortem diagnosis of animal rabies using a rapid immunochromatographic diagnostic test (RIDT), from brain biopsy sampling to the final interpretation. We complete the protocol by describing a further use of the device for molecular analysis and viral genotyping. RIDT easily detects rabies virus and other lyssaviruses in brain samples. The principle of such tests is simple: brain material is applied on a test strip where gold conjugated antibodies bind specifically to rabies antigens. The antigen-antibody complexes bind further to fixed antibodies on the test line, resulting in a clearly visible purple line. The virus is inactivated in the test strip, but viral RNA can be subsequently extracted. This allows the test strip, rather than the infectious brain sample, to be safely and easily sent to an equipped laboratory for confirmation and molecular typing. Based on a modification of the manufacturer&#39;s protocol, we found increased test sensitivity, reaching 98% compared to the gold standard reference method, the direct immunofluorescence antibody test. The advantages of the test are numerous: rapid, easy-to-use, low cost and no requirement for laboratory infrastructure, such as microscopy or cold-chain compliance. RIDTs represent a useful alternative for areas where reference diagnostic methods are not available.

We present a complete protocol for postmortem diagnosis of animal rabies under field conditions using a rapid immunochromatographic diagnostic test (RIDT), from brain biopsy sampling to final interpretation. We also describe further applications using the device for molecular analysis and viral genotyping.

Functional rabies surveillance systems are crucial to provide reliable data and increase the political commitment necessary for disease control. To date, ...

Quantitation of Rabies Virus in Various Bovine Brain Structures

Bovine paralytic rabies (BPR) is a form of viral encephalitis that is of substantial economic importance throughout Latin America, where it poses a major zoonotic risk. Here, our objective was to utilize a laboratory protocol to determine the relative copy number of the rabies virus (RABV) genome in different bovine brain anatomical structures using quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR). qRT-PCR quantifies the specific number of gene copies present in a sample based on fluorescence emitted after amplification that is directly proportional to the amount of target nucleic acid present in the sample. This method is advantageous owing to its short duration, reduced risk of contamination, and potential to detect viral nucleic acids in different samples more easily compared to other techniques. The brains of six rabid animals were divided into six anatomical structures, namely the Ammon&#8217;s horn, cerebellum, cortex, medulla, pons, and thalamus. All brains were identified as positive for RABV antigens based on a direct immunofluorescence test. The same anatomical structures from the brains of four RABV-negative bovines were also assessed. RNA was extracted from each structure and used for qRT-PCR. An assay was performed to determine the copy numbers of RABV genes using an in vitro transcribed nucleoprotein gene. The standard curve used to quantify viral RNA exhibited an efficiency of 100% and linearity of 0.99. Analysis revealed that the cortex, medulla, and thalamus were the ideal CNS portions for use in RABV detection, based on the observation that these structures possessed the highest levels of RABV. The test specificity was 100%. All samples were positive, no false positives were detected. This method can be used to detect RABV in samples that contain low levels of RABV during diagnosis of BPR.

This protocol presents a qRT-PCR-based approach for determining the rabies virus nucleoprotein (N) gene copy number within various bovine brain anatomical structures using in vitro transcription.

Bovine paralytic rabies (BPR) is a form of viral encephalitis that is of substantial economic importance throughout Latin America, where it poses a major ...

An Improved and High Throughput Respiratory Syncytial Virus (RSV) Micro-neutralization Assay

Respiratory syncytial virus-specific neutralizing antibodies (RSV NAbs) are an important marker of protection against RSV. A number of different assay formats are currently in use worldwide so there is a need for an accurate and high-throughput method for measuring RSV NAbs. We describe here an imaging-based micro-neutralization assay that has been tested on RSV subgroup A and can also be adapted for RSV subgroup B and different sample types. This method is highly reproducible, with inter-assay variations for the reference antiserum being less than 10%. We believe this assay can be readily established in many laboratories worldwide at relatively low cost. Development of an improved, high-throughput assay that measures RSV NAbs represents a significant step forward for the standardization of this method internationally as well as being critical for the evaluation of novel RSV vaccine candidates in the future.

An Improved and High Throughput Respiratory Syncytial Virus RSV Micro-neutralization Assay

This study describes a high throughput, imaging-based micro-neutralization assay to determine the titer of neutralizing antibodies specific for respiratory syncytial virus (RSV). This assay format has been tested on different sample types.

Respiratory syncytial virus-specific neutralizing antibodies (RSV NAbs) are an important marker of protection against RSV. A number of different assay ...

Medicine

Quantification of Viral Vectors in Tears Using ddPCR for Bioshedding Studies

A Validatable Droplet Digital Polymerase Chain Reaction Assay for the Detection of Adeno-Associated Viral Vectors in Bioshedding Studies of Tears

The use of viral vectors to treat genetic diseases has increased substantially in recent years, with over 2,000 studies registered to date. Adeno-associated viral (AAV) vectors have found particular success in the treatment of eye related diseases, as exemplified by the approval of voretigene neparvovec-rzyl. To bring new therapies to market, regulatory agencies typically request qualified or validated bioshedding studies to evaluate release of the vector into the environment. However, no official guidelines for the development of molecular based assays to support such shedding studies have been released by the United States Food and Drug Administration, leaving developers to determine best practices for themselves. The purpose of this protocol is to present a validatable protocol for the detection of AAV vectors in human tears by droplet digital polymerase chain reaction (ddPCR) in support of clinical bioshedding studies. This manuscript discusses current industry approaches to molecular assay validation and demonstrates that the method exceeds the target assay acceptance criteria currently proposed in white papers. Finally, steps critical in the performance of any ddPCR assay, regardless of application, are discussed.

Author Spotlight: Addressing Regulatory Gaps in Molecular Studies by Quantifying Viral Vectors in Complex Matrices 

Here, we present a protocol for the development and validation of good laboratory practices in the compliant detection of adeno-associated viral vectors in human tears by droplet digital polymerase chain reaction in support of clinical development of gene therapy vectors.