Name: analysis of termination of transcription using brutp-strand-specific transcription run-on (tro) approach
Uploaded: 2017-03-12T15:00:00
Description: Watch this Scientific Journal Video about Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach at JoVE.com

Research in Ansari lab was supported by the research grant (No. MCB 1020911) from National Science Foundation.

NOTE: This method was used in the research article reported in Medler, S and Ansari, A.2.
1. Culturing and Harvesting the Cells
<ol>
	<li>Start a 5 mL culture of cells in YPD medium (10 g/L yeast extract, 20 g/L peptone, 2% dextrose) from a freshly streaked Saccharomyces cerevisiae plate.</li>
	<li>Grow the cells overnight in an orbital shaker at 30 &#176;C and 250 rpm.</li>
	<li>Dilute the overnight grown culture 100 times to a final volume of 100 mL in YPD ...

<ol>
	<li>Birse, C. E., Minvielle-Sebastia, L., Lee, B. A., Keller, W., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coupling+termination+of+transcription+to+messenger+RNA+maturation+in+yeast.">Coupling termination of transcription to messenger RNA maturation in yeast.</a> Science. 280 (5361), 298-301 (1998).</li><li>Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+looping+facilitates+TFIIH+kinase-mediated+termination+of+transcription.">Gene looping facilitates TFIIH kinase-mediated termination of transcription.</a> Sci Rep. 5, 12586 (2015).</li><li>Richard, P., Manley, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+by+nuclear+RNA+polymerases.">Transcription termination by nuclear RNA polymerases.</a> Genes Dev. 23 (11), 1247-1269 (2009).</li><li>Mischo, H. E., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disengaging+polymerase:+terminating+RNA+polymerase+II+transcription+in+budding+yeast.">Disengaging polymerase: terminating RNA polymerase II transcription in budding yeast.</a> Biochim Biophys Acta. 1829 (1), 174-185 (2013).</li><li>Porrua, O., Libri, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+and+the+control+of+the+transcriptome:+why,+where+and+how+to+stop.">Transcription termination and the control of the transcriptome: why, where and how to stop.</a> Nat Rev Mol Cell Biol. 16 (3), 190-202 (2015).</li><li>Jacquier, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+complex+eukaryotic+transcriptome:+unexpected+pervasive+transcription+and+novel+small+RNAs.">The complex eukaryotic transcriptome: unexpected pervasive transcription and novel small RNAs.</a> Nat Rev Genet. 10 (12), 833-844 (2009).</li><li>Xu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bidirectional+promoters+generate+pervasive+transcription+in+yeast.">Bidirectional promoters generate pervasive transcription in yeast.</a> Nature. 457 (7232), 1033-1037 (2009).</li><li>Neil, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+bidirectional+promoters+are+the+major+source+of+cryptic+transcripts+in+yeast.">Widespread bidirectional promoters are the major source of cryptic transcripts in yeast.</a> Nature. 457 (7232), 1038-1042 (2009).</li><li>Clark, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+reality+of+pervasive+transcription.">The reality of pervasive transcription.</a> PLoS Biol. 9 (7), e1000625 (2011).</li><li>Goodman, A. J., Daugharthy, E. R., Kim, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pervasive+antisense+transcription+is+evolutionarily+conserved+in+budding+yeast.">Pervasive antisense transcription is evolutionarily conserved in budding yeast.</a> Mol Biol Evol. 30 (2), 409-421 (2013).</li><li>El Kaderi, B., Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+interactions+between+genomic+loci+through+Chromosome+Conformation+Capture+(3C).">Analysis of interactions between genomic loci through Chromosome Conformation Capture (3C).</a> Curr Protoc Cell Biol. Chapter 22, Unit22 15 (2012).</li><li>Core, L. J., Waterfall, J. J., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nascent+RNA+sequencing+reveals+widespread+pausing+and+divergent+initiation+at+human+promoters.">Nascent RNA sequencing reveals widespread pausing and divergent initiation at human promoters.</a> Science. 322 (5909), 1845-1848 (2008).</li></ol>

The strand-specific TRO protocol used here was adapted from the protocol used for GRO-Seq (Global Run On-Sequencing) analysis in mammalian cells12. We successfully modified the protocol to study nascent transcription in budding yeast. To specifically analyze the transcription termination defect, we adjusted the protocol further by getting rid of the RNA hydrolysis step. This allowed us to specifically detect the full length nascent transcripts that initiated from the transcription start site near ...

The eukaryotic transcription cycle consists of three major steps; initiation, elongation and termination. The termination of transcription by RNA polymerase II consists of two distinct, interdependent steps3. The first step involves cleavage, polyadenylation and release of mRNA from the template, and is immediately followed by the second step, marked by disengagement of polymerase from the template. Proper termination is crucial for the recycling of the polymerase during initiation/reinitiation of transcription, for preventing interference with the transcription of downstream genes, and for keeping aberrant transcription in check by limiting transcription of pervasive non-coding RNA4,5. Despite recent advances, termination is by far the least understood step of the RNA polymerase II transcription cycle. A reliable termination assay is essential for studying the mechanism underlying termination of transcription by RNA polymerase II in vivo.
A number of experimental approaches are used to detect the termination defect in an actively transcribing gene under physiological conditions. These include Northern blot, termination factor ChIP (Chromatin Immunoprecipitation) and the traditional TRO assay. Each of these techniques have some advantages and disadvantages. The traditional TRO assay used to be the most reliable and sensitive approach for detection of a transcription termination defect in vivo1. This assay localizes the transcriptionally active polymerase molecules on different regions of a gene inside the cell. Under normal conditions, the assay shows transcriptionally engaged polymerase molecules strictly distributed between the promoter and terminator region of the gene (Figure 1A). Upon defective termination, however, the polymerase is unable to read the termination signal and is detected in the region downstream of the 3&#8242; end of the gene (Figure 1B).
A transcription termination defect is manifested in the presence of a sense-transcribing polymerase that initiated from the promoter-proximal region, and being unable to read the termination signal, continues transcribing the region downstream of the 3&#8242; end of a gene as shown in Figure 2A. With the realization that the eukaryotic genome exhibits overwhelming pervasive transcription in sense as well as anti-sense directions in and around a gene 6,7,8,9,10, it soon became clear that the traditional TRO assay cannot detect if the polymerase signal downstream of a gene represents a promoter-initiated transcript (Figure 2A) or an aberrant RNA that initiated somewhere in the middle of the gene or downstream of the terminator element (Figure 2B), or the polymerase transcribing in the anti-sense direction from the 3&#8242; end of the gene (Figure 2C). The strand-specific TRO assay using BrUTP described here can distinguish if the observed readthrough polymerase signal represents promoter-initiated extended sense mRNA or an anti-sense transcript that initiated downstream of the gene under examination. We have successfully used this approach to demonstrate the role of Kin28 kinase in termination of transcription in budding yeast2. Employing the approach here we show that Rna14 is required for termination of transcription of ASC1 in budding yeast.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Phenol -chloroform-isoamyl alcohol mixture</td>
			<td>Sigma-Aldrich</td>
			<td>77619</td>
			<td>pH 4-5</td>
		</tr>
		<tr>
			<td>TRIzol reagent</td>
			<td>Life technologies</td>
			<td>15596-026</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase Inhibitor, human placenta</td>
			<td>New England Biolabs</td>
			<td>M0307S</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-BrdU beads</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-32323AC</td>
			<td></td>
		</tr>
		<tr>
			<td>Protoscript II</td>
			<td>New England Biolabs</td>
			<td>M03368L</td>
			<td>or an equivalent enzyme</td>
		</tr>
		<tr>
			<td>Advantage 2 polymerase Mix</td>
			<td>Clontech</td>
			<td>639201</td>
			<td>or an equivalent enzyme</td>
		</tr>
		<tr>
			<td>5-Bromouridine 5&#39; triphosphate sodium salt</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-214314A</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini kit</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>ATP</td>
			<td>New England Biolabs</td>
			<td>N0451AA</td>
			<td></td>
		</tr>
		<tr>
			<td>CTP</td>
			<td></td>
			<td>N0454AA</td>
			<td></td>
		</tr>
		<tr>
			<td>GTP</td>
			<td></td>
			<td>N0452AA</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultra-pure bovine serum albumin (BSA)</td>
			<td>MC Labs</td>
			<td>UBSA-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Asc1 B</td>
			<td></td>
			<td></td>
			<td>AGATTCGTCGGTCACAAGTCC</td>
		</tr>
		<tr>
			<td>Asc1 C</td>
			<td></td>
			<td></td>
			<td>GAACTTTATACATATTCTTAGTT 
			AGCAGTC</td>
		</tr>
		<tr>
			<td>Asc1 D</td>
			<td></td>
			<td></td>
			<td>TGTACATATGTATTTTCGCAGCA</td>
		</tr>
		<tr>
			<td>Asc1 E</td>
			<td></td>
			<td></td>
			<td>GCCAAGGAGACTGAATTTAATG</td>
		</tr>
		<tr>
			<td>Asc1 F</td>
			<td></td>
			<td></td>
			<td>CTATGGAATGGGGGTTTTAAG</td>
		</tr>
		<tr>
			<td>Asc1 G</td>
			<td></td>
			<td></td>
			<td>GGTTATGGCAGACATGCCAC</td>
		</tr>
		<tr>
			<td>5s cDNA</td>
			<td></td>
			<td></td>
			<td>AGATTGCAGCACCTGAGT</td>
		</tr>
		<tr>
			<td>5&#8217; 5s reverse</td>
			<td></td>
			<td></td>
			<td>GGTTGCGGCCATATCTAC</td>
		</tr>
		<tr>
			<td>3&#8217; 5s reverse</td>
			<td></td>
			<td></td>
			<td>TGAGTTTCGCGTATGGTC</td>
		</tr>
	</tbody>
</table>

analysis of termination of transcription using brutp-strand-specific transcription run-on (tro) approach

This manuscript describes a protocol for detecting transcription termination defect in vivo. The strand-specific TRO protocol using BrUTP described here is a powerful experimental approach for analyzing the transcription termination defect under physiological conditions. Like the traditional TRO assay, it relies on the presence of a transcriptionally active polymerase beyond the 3&#8242; end of the gene as an indicator of a transcription termination defect1. It overcomes two major problems encountered with the traditional TRO assay. First, it can detect if the polymerase reading through the termination signal is the one that initiated transcription from the promoter-proximal region, or if it is simply representing a pervasively transcribing polymerase that initiated non-specifically from somewhere in the body or the 3&#8242; end of the gene. Secondly, it can distinguish if the transcriptionally active polymerase signal beyond the terminator region is truly the readthrough sense mRNA transcribing polymerase or a terminator-initiated non-coding anti-sense RNA signal. Briefly, the protocol involves permeabilizing the exponentially growing yeast cells, allowing the transcripts that initiated in vivo to elongate in the presence of the BrUTP nucleotide, purifying BrUTP-labelled RNA by the affinity approach, reverse transcribing the purified nascent RNA and amplifying the cDNA using strand-specific primers flanking the promoter and the terminator regions of the gene2.

To demonstrate the applicability of the BrUTP-strand-specific TRO procedure in detecting a transcription termination defect, we used a termination-defective, temperature-sensitive mutant of RNA14 called rna14-1. The role of Rna14 in termination of transcription by RNA polymerase II was demonstrated using the traditional TRO assay that detected RNA in the terminator-proximal region of selected genes1. The detection of RNA signal beyond the terminat...

Watch this Scientific Journal Video about Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach at JoVE.com

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes.

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on (TRO) Approach

This manuscript describes a protocol for detecting transcription termination defect in vivo. The strand-specific TRO protocol using BrUTP described here ...

Research

JoVE Journal

Genetics

In Vitro Transcription Assays and Their Application in Drug Discovery

In Vitro Transcription Assays and Their Application in Drug Discovery

In vitro transcription assays have been developed and widely used for many years to study the molecular mechanisms involved in transcription. This process ...

Analysis of the Ambient Particulate Matter-induced Chromosomal Aberrations Using an In Vitro System

Analysis of the Ambient Particulate Matter-induced Chromosomal Aberrations Using an In Vitro System

Exposure to particulate matter (PM) is a major world health concern, which may damage various cellular components, including the nuclear genetic material. ...

Analysis of the c-KIT Ligand Promoter Using Chromatin Immunoprecipitation

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. ...

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In ...

Real-time Analysis of Transcription Factor Binding, Transcription, Translation, and Turnover to Display Global Events During Cellular Activation

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for ...

Genome-wide Surveillance of Transcription Errors in Eukaryotic Organisms

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that ...

A Novel Saturation Mutagenesis Approach: Single Step Characterization of Regulatory Protein Binding Sites in RNA Using Phosphorothioates

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to ...

Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

Reverse Transcription-Loop-mediated Isothermal Amplification RT-LAMP Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

Infection with Zika virus (ZIKV) can be asymptomatic in adults, however, infection during pregnancy can lead to miscarriage and severe neurological birth ...

Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells

Monitoring of nucleic acid intermediates during virus replication provides insights into the effects and mechanisms of action of antiviral compounds and ...

Determining the Likelihood of Variant Pathogenicity Using Amino Acid-level Signal-to-Noise Analysis of Genetic Variation

Advancements in the cost and speed of next generation genetic sequencing have generated an explosion of clinical whole exome and whole genome testing. ...