JAS acknowledges support from the Duke Cancer Institute, The Duke University Genitourinary Oncology Laboratory, and the Duke University Department of Orthopaedics. HL was supported by the National Science Foundation (NSF) Center for Theoretical Biological Physics (NSF PHY-1427654) and NSF DMS-1361411, and as a CPRIT (Cancer Prevention and Research Institute of Texas) Scholar in Cancer Research of the State of Texas at Rice University. KEW was supported by the NIH F32 CA192630 MKJ and HL benefited from useful discussions with Mary C. Farach-Carson, J. N. Onuchic, Samir M. Hanash, Kenneth J. Pienta, and Donald S. Coffey.

1. Preparation of Reagents
<ol>
	<li>Prepare DMEM for cell culture by adding 50 mL of fetal bovine serum (FBS) and 5 mL of penicillin-streptomycin (5,000 U/mL) to 500 mL of DMEM. This medium can be stored at 4 &#176;C for up to six months.</li>
	<li>Resuspend lyophilized primers in nuclease-free water to a final concentration of 10 &#181;M. Store re-suspended primers at -20 &#176;C.</li>
	<li>Prepare radioimmunoprecipitation assay (RIPA) buffer (150 mM NaCl, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris, pH 8.0). Supplement with protease inhibitor cocktail before use and keep buffer on ice when in use. Store at 4 &#176;C.</li>
	<li>Prepare 10 mg/mL polybrene (hexadimethrine bromide) in water and syringe filter to sterilize using a 0.45 &#181;m polyethersulfone filter. Solution can be stored at 4 &#176;C for up to six months.</li>
	<li>Prepare a 1 mg/mL working solution of nitro blue tetrazolium chloride by dissolving 10 mg in 10 mL of PBS. Store at 4 &#176;C.</li>
</ol>
2. Lentiviral Transduction of GRHL2
Day 1
<ol>
	<li>Plate 3 x 105 HEK293T cells per well of a 6-well plate in 2 mL of supplemented DMEM. Quantify cells using an automated cell counter. Cells should be 40 - 60% confluent after overnight culture at 37 &#176;C with 5% CO2.</li>
</ol>
Day 2
<ol start="2">
	<li>Dilute 2 &#181;g of empty vector (pCMV-UBC-EGFP) or 2 &#181;g of pCMV-GRHL2-UBC-EGFP24,25 in 200 &#181;L of serum-free media along with 1.8 &#181;g of p&#916;8.9 and 0.2 &#181;g of pCMV-VSV-G helper plasmids. In a separate tube, dilute 4 &#181;L of a lipid-based transfection reagent in 200 &#181;L of serum-free media per transfection (8 &#181;L in 400 &#181;L for two samples). Add 200 &#181;L of transfection reagent mixture to each plasmid solution and incubate for 20 min at room temperature.</li>
	<li>During the incubation, wash HEK293T cells by removing the medium by vacuum aspiration and rinsing cells with 1 mL of PBS. Replace the PBS with 800 &#181;L of serum-free media. After 20 min, add 200 &#181;L of transfection reagent:plasmid mixture from step 2.2 dropwise to each well and incubate cells for 2 h at 37 &#176;C in 5% CO2.</li>
	<li>Carefully remove transfection medium by vacuum aspiration and replace with 2 mL of supplemented DMEM. Return the cells to the incubator for overnight culture. 
	&#8203;NOTE: HEK293T cells are loosely adherent. Media replacement must be performed with caution to limit removal of cells from the bottom of the dish or flask.</li>
</ol>
Day 3
<ol start="5">
	<li>Refresh media on transfected HEK293T cells and plate 3 x 105 RD cells per well of a 6-well plate in 2 mL of supplemented DMEM. Culture cells overnight. RD cells are a commercially-available human rhabdomyosarcoma cell line.</li>
</ol>
Day 4
<ol start="6">
	<li>Collect viral media from HEK293T cells. Pipette the DMEM media from the HEK293T cells and place into a new 15 mL conical. Carefully replace with new DMEM media and place HEK293T cells back in the incubator for the next day.</li>
	<li>Add 2 &#181;L of 10 mg/mL polybrene per mL of viral media into two new 50 mL conical tubes (one for the empty vector transfection and another for the GRHL2 transfection). Syringe filter viral media by removing the plunger from a 3 mL syringe and attach a 0.45 &#181;m polyethersulfone filter to the tip.
	<ol>
		<li>Add the viral media collected in step 2.6 into the barrel of the syringe, and plunge media into the new 50 mL conical tubes containing polybrene. Remove media from RD cells by vacuum aspiration and add filtered viral media to RD cells.</li>
	</ol>
	</li>
</ol>
Day 5
<ol start="8">
	<li>Repeat Day 4. HEK293T cells can be discarded after the viral media has been collected.</li>
</ol>
Day 7
<ol start="9">
	<li>Wash RD cells with 1 mL of PBS and add 200 &#181;L of 0.05% trypsin per well. Incubate at 37 &#176;C for 5 min, add 2 mL of supplemented media, and move cell suspension to a new 15 mL conical. Centrifuge cells at 250 x g for 5 min at room temperature and aspirate media. Resuspend in 1 mL of DMEM (supplemented with 5% FBS and 1% penicillin-streptomycin). 
	&#8203;NOTE: Using a higher percentage of FBS may cause clogging during flow cytometry
	<ol>
		<li>Filter cells for flow cytometry. Use a pipette to apply the 1 mL RD cell suspension through a 30 &#181;m filter into flow cytometry tubes and place tubes on ice.</li>
		<li>Sort EGFP+ cells26 into 1.5 mL microcentrifuge tubes containing 0.5 mL of DMEM supplemented with 10% FBS and 1% penicillin-streptomycin and place on ice. Plate EGFP+ sorted cells in total of 1 mL of supplemented DMEM into a single well of a 12-well plate and place in the incubator for culture. 
		&#8203;NOTE: The yield of EGFP+ cells from flow cytometry after this transduction is usually low (50,000-100,000 cells). Cells may need to be cultured for 10 - 14 days before proceeding to step 3.</li>
	</ol>
	</li>
</ol>
3. Reverse Transfection of miR-200s
<ol>
	<li>Prepare 50 &#181;M stocks of miR-200 mimics using nuclease-free H2O. Aliquot stocks and store at -20 &#176;C to avoid repeated freeze/thaw cycles.</li>
	<li>Add 3 &#181;L of each 50 &#181;M miR-200 mimic (miR-200a, miR-200b, and miR-200c) to 300 &#181;L of serum-free media or 9 &#181;L of 50 &#181;M negative control miRNA to 300 &#181;L serum-free media.</li>
	<li>Add 6 &#181;L of siRNA-specific transfection reagent to 600 &#181;L of serum-free media and divide 300 &#181;L of this mixture into two tubes, one for each of the two miR mixtures from step 3.2. Combine the 300 &#181;L of each miR mixture from step 3.2 with a mix of 300 &#181;L of transfection reagent. Incubate for 20 min at room temperature.</li>
	<li>While incubating, prepare a cell suspension of 600,000 EGFP+ RD cells expressing EV or GRHL2 created in Section 2 in 2.4 mL (250 cells/&#181;L) of serum-free media per treatment.</li>
	<li>In a 24-well plate, add 100 &#181;L per well of miR-200 mix or negative control mix from step 3.3 into six wells, and then add 400 &#181;L of each cell suspension into three wells of each miR mix.</li>
	<li>Incubate cells at 37 &#176;C in 5% CO2 overnight and change media to fully supplemented DMEM the following day. Collect cells 2 days later for analysis using the appropriate buffer (see below). Time-lapse imaging of RD sarcoma cells undergoing MET is available as supplemental material. Image each well every 2 h with a 10X objective using an automated live-cell imager27.</li>
</ol>
4. RNA extraction, Reverse transcription, and qPCR
<ol>
	<li>Extract RNA according to manufacturer&#39;s instructions using a standard RNA extraction kit24. Extracted RNA can be stored at -80 &#176;C.</li>
	<li>Quantify RNA concentration. Thaw and work with RNA on ice. To quantify RNA concentrations, measure UV absorbance at 260 nm with a plate reader spectrophotometer according to the manufacturer&#39;s protocol. Dilute all samples to the lowest concentration with nuclease-free water.</li>
	<li>Perform reverse transcription of total RNA into complementary DNA (cDNA). Combine no less than 100 ng of total RNA with PCR buffer, dNTP mix (100 mM), random hexamer primers, reverse transcriptase and nuclease-free water in a 20 &#181;L reaction volume24. Run RT cycles according to the manufacture&#39;s protocol. cDNA can be stored long-term at -20 &#176;C.</li>
	<li>Dilute 20 &#181;L reactions to 100 &#181;L with 80 &#181;L of nuclease-free H2O.</li>
	<li>Mix 5 &#181;L of a fluorescence-based intercalating dye 2x qPCR master mix, 0.06 &#181;L of each 10 &#181;M primer, and 2 &#181;L of diluted RT reaction per sample.</li>
	<li>Run qPCR according to manufacturer&#39;s protocol for the fluorescence-based master mix.</li>
	<li>Quantify relative amounts of mRNA by the delta CT method and normalize to GAPDH. Plot the mean mRNA expression of biological replicates &#177; standard deviation for each treatment group. 
	NOTE: Special precautions should be taken when working with RNA to avoid contact with RNases, such as using RNase-free plastics and reagents. Non-disposable equipment should be treated before use to remove RNases.</li>
</ol>
5. Immunofluorescence Staining
<ol>
	<li>Following step 3.6, aspirate media by vacuum aspiration from RD cells in 24-well format.</li>
	<li>Fix cells by adding 500 &#181;L of 4% paraformaldehyde (PFA) per well and incubate for 15 min at room temperature (RT). Following fixation, place cells in phosphate buffered saline (PBS) and store at 4 &#176;C overnight if necessary.</li>
	<li>Permeabilize cells by adding 500 &#181;L of PBS+0.2% Triton-X100 and incubate 30 min at RT. By vacuum aspiration, remove permeabilization buffer and wash three times with PBS.</li>
	<li>Block in 500 &#181;L of 5% bovine serum albumin (BSA)/PBS and incubate cells for 30 min at RT. Cells can be stored at 4 &#176;C overnight if necessary.</li>
	<li>Prepare primary antibody dilution. Pipette 200 &#181;L of 5% BSA/PBS per well into a 15 mL conical (12 wells = 2.4 mL) and add 1 &#181;L of primary antibody per mL of 5%BSA/PBS needed. Remove blocking buffer by vacuum aspiration and dispense 200 &#181;L of diluted primary antibody to each well.
	<ol>
		<li>Incubate cells in 1:1,000 diluted primary antibodies in 5% BSA/PBS for 1 h at RT or overnight at 4 &#176;C. After incubation, wash cells two times with PBS.</li>
	</ol>
	</li>
	<li>Prepare the secondary antibody dilution in the same volume of 5% BSA/PBS as above. Add the far-red dye-conjugated secondary antibody using a 1:2,000 dilution. Additionally add 1 &#181;g/mL of Hoechst dye to the mix. Remove the PBS and add 200 &#181;L of the mix to each well.
	<ol>
		<li>Incubate at RT for 1 h in the dark. Wash 3 times with PBS, leave cells in PBS, and protect cells from light using foil. Cells can be stored at 4 &#176;C if necessary.</li>
	</ol>
	</li>
	<li>Image cells at 400X total magnification on an inverted epifluorescence microscope with excitation wavelength 594 - 650 nm.</li>
</ol>
6. Western Blotting
<ol>
	<li>Wash cells from 3.6 twice with ice-cold PBS. On ice, lyse cells with 50 &#181;L of 1x RIPA buffer supplemented with 1x protease inhibitor cocktail.</li>
	<li>Rock lysates at 4 &#176;C for 15 min, collect lysates into 1.5 mL tubes, and centrifuge at high speed (20,000 x g) for 5 min to clarify samples. Cell lysates can be stored long-term at -80 &#176;C if necessary.</li>
	<li>Quantify total protein using a Bradford assay and aliquot an equal amount of protein into new 1.5 mL microcentrifuge tubes. Bring samples to equal volume using RIPA buffer and 3x Laemmli loading buffer supplemented with 2-mercaptoethanol.</li>
	<li>Incubate samples in 1x Laemmli sample loading buffer for 5 min at 95 &#176;C and run SDS-PAGE using a 4-12% Tris-glycine gel at 200 V for 45 min. The amount of protein loaded ranges depending on the cell line. In some cases, 50-100 &#181;g of total protein is needed to detect E-cadherin in mesenchymal cell lines.</li>
	<li>Transfer proteins onto a nitrocellulose membrane for 2 h at 50 V in 1x Tris-glycine transfer buffer.</li>
	<li>Block membrane for 1 h at room temperature or overnight at 4 &#176;C in a BSA-based blocking buffer.</li>
	<li>Dilute primary antibodies at 1:1,000 concentration in 5 mL of blocking buffer, add dilution to the membrane, and incubate with gentle rocking for 1 h at room temperature or overnight at 4 &#176;C. Wash membrane 3 times in PBS with 0.05% Tween-20.</li>
	<li>Incubate membranes for 1 h at RT with infrared fluorescent-coupled secondary antibody at 1:20,000 dilution in blocking buffer as above.</li>
	<li>Wash membrane two times in PBS with 0.05% Tween-20 and then one time in PBS.</li>
	<li>Image membrane using standard infrared fluorescence detection.</li>
</ol>
7. Anchorage-independent Growth Assays
NOTE: For a detailed soft agar assay protocol, see 28.
<ol>
	<li>Warm sterile 2x DMEM media to 42 &#176;C in hot water bath. During this time, heat pre-autoclaved 1% agarose in the microwave for 3 min. Microwave for an additional 30 s at a time as needed or until completely melted. Move agarose to a 42 &#176;C water bath.</li>
	<li>Place a 50 mL conical tube in a beaker with 42 &#176;C water in a sterile hood and mix 1% agarose and 2x DMEM media in a 1:1 ratio accounting for 1.5 mL of mixture per well in a 6-well plate. Always prepare extra DMEM/agarose to account for pipetting error and to avoid bubbles.</li>
	<li>Add mixture to the sides of the well, ensuring no bubbles form and let stand for 30 min at RT.</li>
	<li>While the bottom layer is solidifying, prepare each group of RD cells transfected in step 3 by aspirating media and washing once with 1 mL PBS. Aspirate PBS and add 0.2 mL of 0.05% trypsin and incubate at 37 &#176;C for 5 min.</li>
	<li>Neutralize trypsin in 0.8 mL of media and triturate cells to form a single-cell suspension. Transfer cell suspension to a 15 mL conical tube.</li>
	<li>Count cells and calculate volume of cell suspension required for 10,000 cells per well.</li>
	<li>Heat 0.6% agarose in the microwave for 3 min followed by 30 s at a time until completely melted. Move agarose to 42 &#176;C water bath.</li>
	<li>Place a 50 mL conical tube in a beaker with 42 &#176;C water in a sterile hood. Mix 0.6% agarose and diluted cell suspension in a 1:1 ratio to prepare 1.5 mL of mixture per well in a 6-well plate. Always prepare extra cell suspension/agarose mix to account for pipetting error and to avoid bubbles. 
	&#8203;NOTE: It is important to work at 42 &#176;C here. If the temperature is too low the mixture will solidify before plating, and temperatures above 42 &#176;C will affect cell viability.</li>
	<li>Mix well by triturating cells several times and add cell mixture to the wells, ensuring no bubbles form, and let solidify for 20 min at RT.</li>
	<li>Add 2 mL of supplemented media to each well and move plates to incubator.
	<ol>
		<li>Change media once a week for 3-4 weeks or until multi-cellular colonies form. Be careful to avoid touching the agar when removing media by vacuum aspiration. Alternatively, use a P1000 to remove the top layer of liquid media.</li>
		<li>Stain soft agar plates by adding 200 &#181;L of Nitro Blue Tetrazolium chloride solution (1 mg/mL in PBS) and incubate the plate overnight at 37 &#176;C. Replace media the next day with PBS for imaging.</li>
		<li>Image wells at 40X total magnification on an inverted microscope.</li>
		<li>Perform analysis on ImageJ for colony area and number. Plot mean colony number of biological replicates &#177; standard deviation.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition,+TGF-beta,+and+osteopontin+in+wound+healing+and+tissue+remodeling+after+injury.">Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury.</a> J Burn Care Res. 33 (3), 311-318 (2012).</li><li>Galichon, P., Finianos, S., Hertig, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EMT-MET+in+renal+disease:+should+we+curb+our+enthusiasm.">EMT-MET in renal disease: should we curb our enthusiasm.</a> Cancer Lett. 341 (1), 24-29 (2013).</li><li>Carew, R. M., Wang, B., Kantharidis, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+EMT+in+renal+fibrosis.">The role of EMT in renal fibrosis.</a> Cell Tissue Res. 347 (1), 103-116 (2012).</li><li>Willis, B. C., Borok, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TGF-beta-induced+EMT:+mechanisms+and+implications+for+fibrotic+lung+disease.">TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease.</a> Am J Physiol Lung Cell Mol Physiol. 293 (3), L525-L534 (2007).</li><li>Ye, X., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-Mesenchymal+Plasticity:+A+Central+Regulator+of+Cancer+Progression.">Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression.</a> Trends Cell Biol. 25 (11), 675-686 (2015).</li><li>Li, L., Li, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition+in+human+cancer:+comprehensive+reprogramming+of+metabolism,+epigenetics,+and+differentiation.">Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation.</a> Pharmacol Ther. 150, 33-46 (2015).</li><li>Tsai, J. H., Yang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+plasticity+in+carcinoma+metastasis.">Epithelial-mesenchymal plasticity in carcinoma metastasis.</a> Genes Dev. 27 (20), 2192-2206 (2013).</li><li>Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+epithelial+plasticity+in+prostate+cancer+dissemination+and+treatment+resistance.">The role of epithelial plasticity in prostate cancer dissemination and treatment resistance.</a> Cancer Metastasis Rev. 33 (2-3), 441-468 (2014).</li><li>Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+Migration+and+Invasion+Uncoupled:+Increased+Migration+Is+Not+an+Inexorable+Consequence+of+Epithelial-to-Mesenchymal+Transition.">Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition.</a> Mol Cell Biol. 34 (18), 3486-3499 (2014).</li><li>Mathow, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zeb1+affects+epithelial+cell+adhesion+by+diverting+glycosphingolipid+metabolism.">Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism.</a> EMBO Rep. 16 (3), 321-331 (2015).</li><li>Ware, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mechanism+of+resistance+to+gefitinib+mediated+by+cellular+reprogramming+and+the+acquisition+of+an+FGF2-FGFR1+autocrine+growth+loop.">A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop.</a> Oncogenesis. 2, e39 (2013).</li><li>Yauch, R. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial+versus+mesenchymal+phenotype+determines+in+vitro+sensitivity+and+predicts+clinical+activity+of+erlotinib+in+lung+cancer+patients.">Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients.</a> Clin Cancer Res. 11 (24 Pt 1), 8686-8698 (2005).</li><li>Jolly, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+elucidating+the+connection+between+epithelial-mesenchymal+transitions+and+stemness.">Towards elucidating the connection between epithelial-mesenchymal transitions and stemness.</a> J R Soc Interface. 11 (101), 20140962 (2014).</li><li>Mani, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+epithelial-mesenchymal+transition+generates+cells+with+properties+of+stem+cells.">The epithelial-mesenchymal transition generates cells with properties of stem cells.</a> Cell. 133 (4), 704-715 (2008).</li><li>Chen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metastasis+is+regulated+via+microRNA-200/ZEB1+axis+control+of+tumour+cell+PD-L1+expression+and+intratumoral+immunosuppression.">Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression.</a> Nat Commun. 5, 5241 (2014).</li><li>Nicolazzo, C., Gradilone, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Significance+of+circulating+tumor+cells+in+soft+tissue+sarcoma.">Significance of circulating tumor cells in soft tissue sarcoma.</a> Anal Cell Pathol (Amst). , 697395 (2015).</li><li>Somarelli, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal-epithelial+transition+in+sarcomas+is+controlled+by+the+combinatorial+expression+of+miR-200s+and+GRHL2.">Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2.</a> Mol Cell Biol. , (2016).</li><li>Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-Mesenchymal+Transition+Phenotype+Is+Associated+with+Clinicopathological+Factors+That+Indicate+Aggressive+Biological+Behavior+and+Poor+Clinical+Outcomes+in+Invasive+Breast+Cancer.">Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer.</a> J Breast Cancer. 18 (3), 256-263 (2015).</li><li>Humphries, B., Yang, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+microRNA-200+family:+small+molecules+with+novel+roles+in+cancer+development,+progression+and+therapy.">The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy.</a> Oncotarget. 6 (9), 6472-6498 (2015).</li><li>Renner, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+profiling+of+primary+high-grade+soft+tissue+sarcomas.">MicroRNA profiling of primary high-grade soft tissue sarcomas.</a> Genes Chromosomes Cancer. 51 (11), 982-996 (2012).</li><li>Petrof, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+GRHL2+result+in+an+autosomal-recessive+ectodermal+Dysplasia+syndrome.">Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome.</a> Am J Hum Genet. 95 (3), 308-314 (2014).</li><li>Werner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+roles+of+the+transcription+factor+grainyhead-like+2+(GRHL2)+in+breast+cancer.">Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer.</a> J Biol Chem. 288 (32), 22993-23008 (2013).</li><li>Werth, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcription+factor+grainyhead-like+2+regulates+the+molecular+composition+of+the+epithelial+apical+junctional+complex.">The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex.</a> Development. 137 (22), 3835-3845 (2010).</li><li>Somarelli, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal-Epithelial+Transition+in+Sarcomas+Is+Controlled+by+the+Combinatorial+Expression+of+MicroRNA+200s+and+GRHL2.">Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2.</a> Mol Cell Biol. 36 (19), 2503-2513 (2016).</li><li>Varma, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcription+factors+Grainyhead-like+2+and+NK2-homeobox+1+form+a+regulatory+loop+that+coordinates+lung+epithelial+cell+morphogenesis+and+differentiation.">The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation.</a> J Biol Chem. 287 (44), 37282-37295 (2012).</li><li>Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+fluorescent+protein+expressing+cells+by+flow+cytometry.">Analysis of fluorescent protein expressing cells by flow cytometry.</a> Methods Mol Biol. 263, 239-258 (2004).</li><li>Zhao, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+high-content+morphological+screen+identifies+novel+microRNAs+that+regulate+neuroblastoma+cell+differentiation.">A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation.</a> Oncotarget. 5 (9), 2499-2512 (2014).</li><li>Borowicz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+soft+agar+colony+formation+assay.">The soft agar colony formation assay.</a> J Vis Exp. (92), e51998 (2014).</li><li>Yang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+proteomics+and+genomics+analysis+reveals+a+novel+mesenchymal+to+epithelial+reverting+transition+in+leiomyosarcoma+through+regulation+of+slug.">Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug.</a> Mol Cell Proteomics. 9 (11), 2405-2413 (2010).</li><li>Alba-Castellon, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Snail1+expression+is+required+for+sarcomagenesis.">Snail1 expression is required for sarcomagenesis.</a> Neoplasia. 16 (5), 413-421 (2014).</li><li>Takaishi, M., Tarutani, M., Takeda, J., Sano, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal+to+Epithelial+Transition+Induced+by+Reprogramming+Factors+Attenuates+the+Malignancy+of+Cancer+Cells.">Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells.</a> PLoS One. 11 (6), e0156904 (2016).</li></ol>

The authors have nothing to disclose.

Sarcomas are rare, but highly aggressive cancers of a mesenchymal lineage. Despite their mesenchymal lineage, a subset of sarcomas appears to undergo a phenotypic transition to a more epithelial-like state. This MET-like switch has prognostic relevance, as patients with more epithelial-like tumors are less aggressive24. Despite their clinical relevance, there are few studies addressing the molecular mechanisms driving these phenotypic transitions in sarcomas.
To examine...

An erratum was issued for: <a href="https://www.jove.com/video/55520/induction-of-mesenchymal-epithelial-transitions-in-sarcoma-cells">Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells</a>. An author name was updated.
One of the authors&#39; names was corrected from:
Shenghan Xu
to:
Shengnan Xu

An erratum was issued for: <a href="https://www.jove.com/video/55520/induction-of-mesenchymal-epithelial-transitions-in-sarcoma-cells">Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells</a>. An author name was updated.

Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells

Phenotypic plasticity refers to a reversible transition between cellular phenotypes, and is commonly divided into two types, epithelial-to-mesenchymal (EMT) transitions and mesenchymal-to-epithelial transitions (MET). This phenotypic plasticity plays an important role in normal processes of multicellular organisms, such as development and wound healing1; however, these same pathways and gene expression programs can also lead to disease, such as fibrosis (reviewed in2,3,4) and carcinoma metastasis (reviewed in references5,6,7,8). During metastasis, for example, EMT disrupts cell polarity, cell-cell interactions, and promotes invasion9,10. Together, EMT contributes to a phenotypic state that facilitates cancer cell dissemination. In addition, EMT also leads to a host of other phenotypic alterations that drive an aggressive phenotype, including deregulation of cancer cell metabolism6, development of drug resistance11,12, increased tumor-initiation ability13,14 and host immune evasion15.
Phenotypic plasticity has been well studied in carcinoma progression; however, sarcomas also exhibit phenotypic plasticity. Interestingly, it appears as if some of the same drivers of phenotypic plasticity in carcinomas also contribute to sarcoma plasticity and aggressiveness. For instance, circulating tumor cells (CTCs) from sarcoma patients have been shown to express EpCAM, a cell surface protein that is typically found on epithelial cells16. Additionally, 250 soft tissue sarcoma samples were categorized as epithelial-like or mesenchymal-like based on gene expression. Patients in the epithelial-like biomarker signature had a better prognosis than patients with the mesenchymal-like biomarker signature17. This is consistent with many carcinomas, in which patients with more epithelial-like carcinomas have better outcomes compared with patients with more mesenchymal-like tumors18.
While some sarcomas display biomarkers and gene expression pathways consistent with MET, the molecular underpinnings of this phenotypic plasticity remain poorly understood. To study the mechanisms and drivers of MET in sarcoma we developed a model of MET induction using two epithelial-specific factors, the microRNA (miR)-200 family and grainyhead-like 2 (GRHL2). The miR-200s are a family of small non-coding RNAs that regulate gene expression by binding to the 3&#39; UTRs of messenger RNA and preventing translation into protein. The miR-200 family consists of two subgroups - one containing miR-141 and miR-200a, and the other including&#160;miR-200b, miR-200c, and miR-429. Members of the miR-200 family are enriched in epithelial tissues, and the loss of miR-200s is associated with metastasis in carcinomas19. The miR-200 family is also downregulated in soft tissue sarcomas compared to normal tissue20. Similar to the miR-200s, GRHL2 is a key regulator that is important for epithelial development21. The GRHL2 transcription factor acts in two ways to upregulate epithelial genes, such as E-cadherin: 1) In epithelial cells, GRHL2 directly represses the EMT master regulator, ZEB122; and 2) GRHL2 directly activates transcription of epithelial genes23. Our previous investigations have shown that combined expression of miR-200s and GRHL2 in sarcoma cells induces an MET-like phenotype24. Here, we present a detailed protocol to create an in vitro model of MET induction in sarcoma cells using ectopic expression of miR-200s and GRHL2.

<table><tbody><tr><td>Countess automated counter</td><td>Life technologies</td><td>AMQAX1000</td><td></td></tr><tr><td>Countess cell counting chamber slides</td><td>Invitrogen</td><td>C10283</td><td></td></tr><tr><td>SimpliAmp Thermal Cycler</td><td>Thermo Fisher</td><td>A24811</td><td></td></tr><tr><td>Odyssey Fc</td><td>LI-COR Inc</td><td></td><td></td></tr><tr><td>ViiA7 Real Time PCR System</td><td>Thermo Fisher</td><td>4453536</td><td></td></tr><tr><td>PCR microplate</td><td>Corning</td><td>321-29-051</td><td></td></tr><tr><td>KAPA SYBR Fast Universal qPCR Kit</td><td>KAPA Biosystems</td><td>KK4602</td><td></td></tr><tr><td>Starting Block (PBS) Blocking Buffer</td><td>Thermo Fisher</td><td>37538</td><td>BSA-based blocking buffer</td></tr><tr><td>Agarose General Purpose LE</td><td>Genesee Scientific</td><td>20-102</td><td></td></tr><tr><td>10x Tris/Glycine/SDS Buffer</td><td>Bio-Rad Laboratories Inc</td><td>161-0732</td><td>Running buffer</td></tr><tr><td>10x Tris/Glycine Buffer</td><td>Bio-Rad Laboratories Inc</td><td>161-0734</td><td>Transfer buffer</td></tr><tr><td>RIPA Buffer</td><td>Sigma Life Sciences</td><td>SLBG8489</td><td></td></tr><tr><td>Amersham Protran 0.45 &amp;mu;m nitrocellulose</td><td>GE Healthcare Lifesciences</td><td>10600012</td><td></td></tr><tr><td>Quick-RNA MiniPrep Kit</td><td>Genesee Scientific</td><td>11-358</td><td></td></tr><tr><td>Laemmli Sample Buffer (4X)</td><td>Bio-Rad Laboratories Inc</td><td>1610747</td><td></td></tr><tr><td>Mini Trans-Blot Cell</td><td>Bio-Rad Laboratories Inc</td><td>1703930</td><td></td></tr><tr><td>Mini-Protean Tetra Cell</td><td>Bio-Rad Laboratories Inc</td><td>1658005EDU</td><td></td></tr><tr><td>DPBS</td><td>Life technologies</td><td>14190-144</td><td></td></tr><tr><td>0.05% Trypsin-EDTA</td><td>Life technologies</td><td>11995-065</td><td></td></tr><tr><td>DMEM</td><td>Life technologies</td><td>11995-065</td><td></td></tr><tr><td>Lipofectamine RNAi Max</td><td>Thermo Fisher</td><td>13778150</td><td></td></tr><tr><td>Lipofectamine 2000 Ragents</td><td>Thermo Fisher</td><td>11668019</td><td></td></tr><tr><td>Penicillin Streptomycin</td><td>Life technologies</td><td>15140-122</td><td></td></tr><tr><td>miRVana miRNA mimic negative control #1</td><td>Thermo Fisher</td><td>4464058</td><td>neg miRNA</td></tr><tr><td>hsa-miR-200 mirVana miRNA mimic</td><td>Thermo Fisher</td><td>4464066</td><td>miR200A</td></tr><tr><td>has-miR-200 mirVana miRNA mimic</td><td>Thermo Fisher</td><td>4404066</td><td>miR200B</td></tr><tr><td>has-miR-200 mirVana miRNA mimic</td><td>Thermo Fisher</td><td>4404066</td><td>miR200C</td></tr><tr><td>Opti-MEM</td><td>Life technologies</td><td>11088-021</td><td>serum-free media</td></tr><tr><td>anti-Ecadherin antibody</td><td>BD Bioscience</td><td>610182</td><td></td></tr><tr><td>anti-beta actin</td><td>Santa Cruz Biotechnology</td><td>sc-69879</td><td></td></tr><tr><td>anti-EpCam</td><td>Ab Serotec</td><td>MCA18706</td><td></td></tr><tr><td>anti-ZO1</td><td>Invitrogen</td><td>402200</td><td></td></tr><tr><td>IRDye 800W</td><td>LI-COR Inc</td><td>925-32210</td><td></td></tr><tr><td>IRDye 680</td><td>LI-COR Inc</td><td>926-32223</td><td></td></tr><tr><td>anti-mouse AlexaFluor 647</td><td>Thermo Fisher</td><td>A211241</td><td></td></tr><tr><td>anti-rabbit AlexaFluor 647</td><td>Thermo Fisher</td><td>ab150075</td><td></td></tr><tr><td>Halt Protease and Phosphatesse Inhibitor</td><td>Thermo Fisher</td><td>1861281</td><td></td></tr><tr><td>Precision Plus Protein Dual Color</td><td>Bio-Rad Laboratories Inc</td><td>161-0374</td><td></td></tr><tr><td>Partec CellTrics</td><td>Sysmex</td><td>04-004-2326</td><td>30 &amp;mu;m filter for flow</td></tr><tr><td>GAPDH-F</td><td>IDT</td><td></td><td>AGCCACATCGCTCAGACAC</td></tr><tr><td>GAPDH-R</td><td>IDT</td><td></td><td>GCCCAATACGACCAAATCC</td></tr><tr><td>Ecadherin-F</td><td>IDT</td><td></td><td>TGGAGGAATTCTTGCTTTGC</td></tr><tr><td>Ecadherin-R</td><td>IDT</td><td></td><td>CGCTCTCCTCCGAAGAAAC</td></tr><tr><td>ZEB1-F</td><td>IDT</td><td></td><td>GCATACAGAACCCAACTTGAACGTC</td></tr><tr><td>ZEB1-R</td><td>IDT</td><td></td><td>CGATTACACCCAGACTGC</td></tr><tr><td>NOTCH-F</td><td>IDT</td><td></td><td>GGCAATCCGAGGACTATGAG</td></tr><tr><td>NOTCH-R</td><td>IDT</td><td></td><td>CTCAGAACGCACTCGTTGAT</td></tr><tr><td>nitro blue tetrazolium&amp;nbsp;</td><td>Sigma</td><td>N5514</td><td></td></tr><tr><td>hexadimethrine bromide</td><td>Sigma</td><td>H9268</td><td>polybrene</td></tr><tr><td>3 mL syringe</td><td>BD Bioscience</td><td>309657</td><td></td></tr><tr><td>Sterile syringe filter</td><td>VWR</td><td>28145-505</td><td></td></tr><tr><td>5mL polypropylene round-bottom tube</td><td>352063</td><td></td><td>flow cytometry tubes</td></tr><tr><td>High-Capacity cDNA Reverse Transcription Kit</td><td>Thermo Fisher</td><td>4368814</td><td>reverse transcription kit</td></tr><tr><td>4% paraformaldyhyde</td><td>Santa Cruz Biotechnology</td><td>sc-281612</td><td></td></tr><tr><td>Triton-X100</td><td>Sigma</td><td>93443</td><td></td></tr><tr><td>bovine serum albumin</td><td>Sigma</td><td>A7906</td><td></td></tr></tbody></table>

induction of mesenchymal-epithelial transitions in sarcoma cells

Phenotypic plasticity refers to a phenomenon in which cells transiently gain traits of another lineage. During carcinoma progression, phenotypic plasticity drives invasion, dissemination and metastasis. Indeed, while most of the studies of phenotypic plasticity have been in the context of epithelial-derived carcinomas, it turns out sarcomas, which are mesenchymal in origin, also exhibit phenotypic plasticity, with a subset of sarcomas undergoing a phenomenon that resembles a mesenchymal-epithelial transition (MET). Here, we developed a method comprising the miR-200 family and grainyhead-like 2 (GRHL2) to mimic this MET-like phenomenon observed in sarcoma patient samples.We sequentially express GRHL2 and the miR-200 family using cell transduction and transfection, respectively, to better understand the molecular underpinnings of these phenotypic transitions in sarcoma cells. Sarcoma cells expressing miR-200s and GRHL2 demonstrated enhanced epithelial characteristics in cell morphology and alteration of epithelial and mesenchymal biomarkers. Future studies using these methods can be used to better understand the phenotypic consequences of MET-like processes on sarcoma cells, such as migration, invasion, metastatic propensity, and therapy resistance.

Schema for MET induction in sarcoma cells
A general timeline for the induction of MET-like changes in sarcoma cells is shown in Figure 1. The protocol begins by transducing GRHL2 (Figure 1A), followed by transfection of the miR-200 family (Figure 1B). GRHL2 or miR-200 family members were not able to impact the appearance of RD cells when expressed alone, but ectopic expression of G...

Watch this Scientific Journal Video about Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells at JoVE.com

Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells

We present here a cell culture method for inducing mesenchymal-epithelial transitions (MET) in sarcoma cells based on combined ectopic expression of microRNA-200 family members and grainyhead-like 2 (GRHL2). This method is suitable for better understanding the biological impact of phenotypic plasticity on cancer aggressiveness and treatments.

Phenotypic plasticity refers to a phenomenon in which cells transiently gain traits of another lineage. During carcinoma progression, phenotypic ...

induction-of-mesenchymal-epithelial-transitions-in-sarcoma-cells

Research

JoVE Journal

Developmental Biology

9.3K Views.  Duke University. We present here a cell culture method for inducing mesenchymal-epithelial transitions (MET) in sarcoma cells based on combined ectopic expression of microRNA-200 family members and grainyhead-like 2 (GRHL2). This method is suitable for better understanding the biological impact of phenotypic plasticity on cancer aggressiveness and treatments.

Video: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells

A Real-time Electrical Impedance Based Technique to Measure Invasion of Endothelial Cell Monolayer by Cancer Cells

Metastatic dissemination of malignant cells requires degradation of basement membrane, attachment of tumor cells to vascular endothelium, retraction of endothelial junctions and finally invasion and migration of tumor cells through the endothelial layer to enter the bloodstream as a means of transport to distant sites in the host1-3. Once in the circulatory system, cancer cells adhere to capillary walls and extravasate to the surrounding tissue to form metastatic tumors4,5. The various components of tumor cell-endothelial cell interaction can be replicated in vitro by challenging a monolayer of human umbilical vein endothelial cells (HUVEC) with cancer cells. Studies performed with electron and phase-contrast microscopy suggest that the in vitro sequence of events fairly represent the in vivo metastatic process6. Here, we describe an electrical-impedance based technique that monitors and quantifies in real-time the invasion of endothelial cells by malignant tumor cells.
Giaever and Keese first described a technique for measuring fluctuations in impedance when a population of cells grow on the surface of electrodes7,8. The xCELLigence instrument, manufactured by Roche, utilizes a similar technique to measure changes in electrical impedance as cells attach and spread in a culture dish covered with a gold microelectrode array that covers approximately 80% of the area on the bottom of a well. As cells attach and spread on the electrode surface, it leads to an increase in electrical impedance9-12. The impedance is displayed as a dimensionless parameter termed cell-index, which is directly proportional to the total area of tissue-culture well that is covered by cells. Hence, the cell-index can be used to monitor cell adhesion, spreading, morphology and cell density.
The invasion assay described in this article is based on changes in electrical impedance at the electrode/cell interphase, as a population of malignant cells invade through a HUVEC monolayer (Figure 1). The disruption of endothelial junctions, retraction of endothelial monolayer and replacement by tumor cells lead to large changes in impedance. These changes directly correlate with the invasive capacity of tumor cells, i.e., invasion by highly aggressive cells lead to large changes in cell impedance and vice versa. This technique provides a two-fold advantage over existing methods of measuring invasion, such as boyden chamber and matrigel assays: 1) the endothelial cell-tumor cell interaction more closely mimics the in vivo process, and 2) the data is obtained in real-time and is more easily quantifiable, as opposed to end-point analysis for other methods.

This article describes an in vitro technique for monitoring cancer cells invading through a monolayer of endothelial cells. The data is acquired in real-time as a function of changes in impedance on the surface of electrodes at the well bottom.

Metastatic dissemination of malignant cells requires degradation of basement membrane, attachment of tumor cells to vascular endothelium, retraction of ...

Medicine

A Preclinical Mouse Model of Osteosarcoma to Define the Extracellular Vesicle-mediated Communication Between Tumor and Mesenchymal Stem Cells

Within the tumor microenvironment, resident or recruited mesenchymal stem cells (MSCs) contribute to malignant progression in multiple cancer types. Under the influence of specific environmental signals, these adult stem cells can release paracrine mediators leading to accelerated tumor growth and metastasis. Defining the crosstalk between tumor and MSCs is of primary importance to understand the mechanisms underlying cancer progression and identify novel targets for therapeutic intervention. 
Cancer cells produce high amounts of extracellular vesicles (EVs), which can profoundly affect the behavior of target cells in the tumor microenvironment or at distant sites. Tumor EVs enclose functional biomolecules, including inflammatory RNAs and (onco)proteins, that can educate stromal cells to enhance the metastatic behavior of cancer cells or to participate in the pre-metastatic niche formation. In this article, we describe the development of a preclinical cancer mouse model that enables specific evaluation of the EV-mediated crosstalk between tumor and mesenchymal stem cells. First, we describe the purification and characterization of tumor-secreted EVs and the assessment of the EV internalization by MSCs. We then make use of a multiplex bead-based immunoassay to evaluate the alteration of the MSC cytokine expression profile induced by cancer EVs. Finally, we illustrate the generation of a bioluminescent orthotopic xenograft mouse model of osteosarcoma that recapitulates the tumor-MSC interaction, and show the contribution of EV-educated MSCs to tumor growth and metastasis formation. 
Our model provides the opportunity to define how cancer EVs shape a tumor-supporting environment, and to evaluate whether blockade of the EV-mediated communication between tumor and MSCs prevents cancer progression.

Direct injection of cancer-derived extracellular vesicles (EVs) leads to reprogramming of bone marrow supporting tumor progression; however, which cells mediate this effect is unclear. Herein, we describe a step-by-step protocol to investigate EV-mediated tumor-mesenchymal stem cell (MSC) interactions in vivo, revealing a crucial role for EV-educated MSCs in metastasis.

Within the tumor microenvironment, resident or recruited mesenchymal stem cells (MSCs) contribute to malignant progression in multiple cancer types. Under ...

Cancer Research

Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

Fibrosis is often involved in the pathogenesis of various chronic progressive diseases such as interstitial pulmonary disease. Pathological hallmark is the formation of fibroblastic foci, which is associated with the disease severity. Mesenchymal cells consisting of the fibroblastic foci are proposed to be derived from several cell sources, including originally resident intrapulmonary fibroblasts and circulating fibrocytes from bone marrow. Recently, mesenchymal cells that underwent epithelial-mesenchymal transition (EMT) have been also supposed to contribute to the pathogenesis of fibrosis. In addition, EMT can be induced by transforming growth factor &#946;, and EMT can be enhanced by pro-inflammatory cytokines like tumor necrosis factor &#945;. The gel contraction assay is an ideal in vitro model for the evaluation of contractility, which is one of the characteristic functions of fibroblasts and contributes to wound repair and fibrosis. Here, the development of a gel contraction assay is demonstrated for evaluating contractile ability of mesenchymal cells that underwent EMT.

Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

Here, we describe the development and application of a gel contraction assay for evaluating contractile function in mesenchymal cells that underwent epithelial-mesenchymal transition.

Fibrosis is often involved in the pathogenesis of various chronic progressive diseases such as interstitial pulmonary disease. Pathological hallmark is ...

An Enzyme- and Serum-free Neural Stem Cell Culture Model for EMT Investigation Suited for Drug Discovery

Epithelial to mesenchymal transition (EMT) describes the process of epithelium transdifferentiating into mesenchyme. EMT is a fundamental process during embryonic development that also commonly occurs in glioblastoma, the most frequent malignant brain tumor. EMT has also been observed in multiple carcinomas outside the brain including breast cancer, lung cancer, colon cancer, gastric cancer. EMT is centrally linked to malignancy by promoting migration, invasion and metastasis formation. The mechanisms of EMT induction are not fully understood. Here we describe an in vitro system for standardized isolation of cortical neural stem cells (NSCs) and subsequent EMT-induction. This system provides the flexibility to use either single cells or explant culture. In this system, rat or mouse embryonic forebrain NSCs are cultured in a defined medium, devoid of serum and enzymes. The NSCs expressed Olig2 and Sox10, two transcription factors observed in oligodendrocyte precursor cells (OPCs). Using this system, interactions between FGF-, BMP- and TGF&#946;-signaling involving Zeb1, Zeb2, and Twist2 were observed where TGF&#946;-activation significantly enhanced cell migration, suggesting a synergistic BMP-/TGF&#946;-interaction. The results point to a network of FGF-, BMP- and TGF&#946;-signaling to be involved in EMT induction and maintenance. This model system is relevant to investigate EMT in vitro. It is cost-efficient and shows high reproducibility. It also allows for the comparison of different compounds with respect to their migration responses (quantitative distance measurement), and high-throughput screening of compounds to inhibit or enhance EMT (qualitative measurement). The model is therefore well suited to test drug libraries for substances affecting EMT.

Epithelial to mesenchymal transition (EMT) allows cancers to become invasive. To investigate EMT, a neural stem cell (NSC)-based in vitro model devoid of serum and enzymes is described. This standardized system allows quantitative and qualitative assessment of cell migration, gene and protein expression. The model is suited for drug discovery.

Epithelial to mesenchymal transition (EMT) describes the process of epithelium transdifferentiating into mesenchyme. EMT is a fundamental process during ...

Three-Dimensional Bone Extracellular Matrix Model for Osteosarcoma

Osteosarcoma (OS) is the most common and a highly aggressive primary bone tumor. It is characterized with anatomic and histologic variations along with diagnostic or prognostic difficulties. OS comprises genotypically and phenotypically heterogeneous cancer cells. Bone microenvironment elements are proved to account for tumor heterogeneity and disease progression. Bone extracellular matrix (BEM) retains the microstructural matrices and biochemical components of native extracellular matrix. This tissue-specific niche provides a favorable and long-term scaffold for OS cell seeding and proliferation. This article provides a protocol for the preparation of BEM model and its further experimental application. OS cells can grow and differentiate into multiple phenotypes consistent with the histopathological complexity of OS clinical specimens. The model also allows visualization of diverse morphologies and their association with genetic alterations and underlying regulatory mechanisms. As homologous to human OS, this BEM-OS model can be developed and applied to the pathology and clinical research of OS.

The bone extracellular matrix (BEM) model for osteosarcoma (OS) is well established and shown here. It can be used as a suitable scaffold for mimicking primary tumor growth in vitro and providing an ideal model for studying the histologic and cytogenic heterogeneity of OS.

Osteosarcoma (OS) is the most common and a highly aggressive primary bone tumor. It is characterized with anatomic and histologic variations along with ...

Tissue Engineering of Tumor Stromal Microenvironment with Application to Cancer Cell Invasion

3D organotypic cultures of epithelial cells on a matrix embedded with mesenchymal cells are widely used to study epithelial cell differentiation and invasion. Rat tail type I collagen and/or matrix derived from Engelbreth-Holm-Swarm mouse sarcoma cells have been traditionally employed as the substrates to model the matrix or stromal microenvironment into which mesenchymal cells (usually fibroblasts) are populated. Although experiments using such matrices are very informative, it can be argued that due to an overriding presence of a single protein (such as in type I Collagen) or a high content of basement membrane components and growth factors (such as in matrix derived from mouse sarcoma cells), these substrates do not best reflect the contribution to matrix composition made by the stromal cells themselves. To study native matrices produced by primary dermal fibroblasts isolated from patients with a tumor prone, genetic blistering disorder (recessive dystrophic epidermolysis bullosa), we have adapted an existing native matrix protocol to study tumor cell invasion. Fibroblasts are induced to produce their own matrix over a prolonged period in culture. This native matrix is then detached from the culture dish and epithelial cells are seeded onto it before the entire coculture is raised to the air-liquid interface. Cellular differentiation and/or invasion can then be assessed over time. This technique provides the ability to assess epithelial-mesenchymal cell interactions in a 3D setting without the need for a synthetic or foreign matrix with the only disadvantage being the prolonged period of time required to produce the native matrix. Here we describe the application of this technique to assess the ability of a single molecule expressed by fibroblasts, type VII collagen, to inhibit tumor cell invasion.

Tissue engineered fibroblast-derived native matrix is an emerging tool to generate a stromal substrate which supports epithelial cell proliferation and differentiation. Here a protocol applying this methodology to assess the impact of different stromal cell types on tumor cell biology is presented.

3D organotypic cultures of epithelial cells on a matrix embedded with mesenchymal cells are widely used to study epithelial cell differentiation and ...

Bioengineering

Studying TGF-&#946; Signaling and TGF-&#946;-induced Epithelial-to-mesenchymal Transition in Breast Cancer and Normal Cells

Transforming growth factor-&#946; (TGF-&#946;) is a secreted multifunctional factor that plays a key role in intercellular communication. Perturbations of TGF-&#946; signaling can lead to breast cancer. TGF-&#946; elicits its effects on proliferation and differentiation via specific cell surface TGF-&#946; type I and type II receptors (i.e., T&#946;RI and T&#946;RII) that contain an intrinsic serine/threonine kinase domain. Upon TGF-&#946;-induced heteromeric complex formation, activated T&#946;RI elicits intracellular signaling by phosphorylating SMAD2 and SMAD3. These activated SMADs form heteromeric complexes with SMAD4 to regulate specific target genes, including plasminogen activation inhibitor 1 (PAI-1, encoded by the SERPINE1 gene). The induction of epithelial-to-mesenchymal transition (EMT) allows epithelial cancer cells at the primary site or during colonization at distant sites to gain an invasive phenotype and drive tumor progression. TGF-&#946; acts as a potent inducer of breast cancer invasion by driving EMT. Here, we describe systematic methods to investigate TGF-&#946; signaling and EMT responses using premalignant human MCF10A-RAS (M2) cells and mouse NMuMG epithelial cells as examples. We describe methods to determine TGF-&#946;-induced SMAD2 phosphorylation by Western blotting, SMAD3/SMAD4-dependent transcriptional activity using luciferase reporter activity and SERPINE1 target gene expression by quantitative real-time-polymerase chain reaction (qRT-PCR). In addition, methods are described to examine TGF-&#946;-induced EMT by measuring changes in morphology, epithelial and mesenchymal marker expression, filamentous actin staining and immunofluorescence staining of E-cadherin. Two selective small molecule TGF-&#946; receptor kinase inhibitors, GW788388 and SB431542, were used to block TGF-&#946;-induced SMAD2 phosphorylation, target genes and changes in EMT marker expression. Moreover, we describe the transdifferentiation of mesenchymal breast Py2T murine epithelial tumor cells into adipocytes. Methods to examine TGF-&#946;-induced signaling and EMT in breast cancer may contribute to new therapeutic approaches for breast cancer.

We describe a systematic workflow to investigate TGF-&#946; signaling and TGF-&#946;-induced EMT by studying the protein and gene expression involved in this signaling pathway. The methods include Western blotting, a luciferase reporter assay, qPCR, and immunofluorescence staining.

Transforming growth factor-&#946; (TGF-&#946;) is a secreted multifunctional factor that plays a key role in intercellular communication. Perturbations of ...

Heteromulticellular Stromal Cells in Scaffold-free 3D Cultures of Epithelial Cancer Cells to Drive Invasion

Breast cancer is the second leading cause of cancer-related death among women in the U.S. Organoid models of solid tumors have been shown to faithfully recapitulate aspects of cancer progression such as proliferation and invasion. Although patient-derived organoids and patient-derived xenograft organoids are pathophysiologically relevant, they are costly to propagate, difficult to manipulate, and comprised primarily of the most proliferative cell types within the tumor microenvironment (TME). These limitations prevent their use for elucidating cellular mechanisms of disease progression that depend upon tumor-associated stromal cells which are found within the TME and known to contribute to metastasis and therapy resistance. 
Here, we report on methods for cultivating epithelial-stromal multicellular 3D cultures. The advantages of these methods include a cost-effective system for rapidly generating organoid-like 3D cultures within scaffold-free environments that can be used to track invasion at single-cell resolution within hydrogel scaffolds. Specifically, we demonstrate how to generate these heteromulticellular 3D cultures using BT-474 breast cancer cells in combination with fibroblasts (BJ-5ta), monocyte-like cells (THP-1), and/or endothelial cells (EA.hy926). Additionally, differential fluorescent labeling of cell populations enables time-lapse microscopy to define 3D culture assembly and invasion dynamics. 
Notably, the addition of any two stromal cell combinations to 3D cultures of BT-474 cells significantly reduces circularity of the 3D cultures, consistent with the presence of organoid-like or secondary spheroid structures. In tracker dye experiments, fibroblasts and endothelial cells co-localize in the peripheral organoid-like protrusions and are spatially segregated from the primary BT-474 spheroid. Finally, heteromulticellular 3D cultures of BT-474 cells have increased hydrogel invasion capacity. Since we observed these protrusive structures in heteromulticellular 3D cultures of both non-tumorigenic and tumorigenic breast epithelial cells, this work provides an efficient and reproducible method for generating organoid-like 3D cultures in a scaffold-free environment for subsequent analyses of phenotypes associated with solid tumor progression.

There is a critical need for 3D cancer models that capture heterocellular crosstalk to study cancer metastasis. Our study presents the generation of heteromulticellular stromal-epithelial in a scaffold and scaffold-free environment that can be used to study invasion and cellular spatial distributions.

Breast cancer is the second leading cause of cancer-related death among women in the U.S. Organoid models of solid tumors have been shown to faithfully ...

Induction and Analysis of Epithelial to Mesenchymal Transition

Epithelial to mesenchymal transition (EMT) is essential for proper morphogenesis during development. Misregulation of this process has been implicated as a key event in fibrosis and the progression of carcinomas to a metastatic state. Understanding the processes that underlie EMT is imperative for the early diagnosis and clinical control of these disease states. Reliable induction of EMT in vitro is a useful tool for drug discovery as well as to identify common gene expression signatures for diagnostic purposes. Here we demonstrate a straightforward method for the induction of EMT in a variety of cell types. Methods for the analysis of cells pre- and post-EMT induction by immunocytochemistry are also included. Additionally, we demonstrate the effectiveness of this method through antibody-based array analysis and migration/invasion assays.

A straightforward method is described for the induction of epithelial to mesenchymal transition (EMT) in a variety of cell types. Methods for the analysis of cells in EMT states by immunocytochemistry are included.

Epithelial  to mesenchymal transition (EMT) is essential for proper morphogenesis during  development. Misregulation of this  process has been implicated ...

Biology

Detection of Alternative Splicing During Epithelial-Mesenchymal Transition

Alternative splicing plays a critical role in the epithelial-mesenchymal transition (EMT), an essential cellular program that occurs in various physiological and pathological processes. Here we describe a strategy to detect alternative splicing during EMT using an inducible EMT model by expressing the transcription repressor Twist. EMT is monitored by changes in cell morphology, loss of E-cadherin localization at cell-cell junctions, and the switched expression of EMT markers, such as loss of epithelial markers E-cadherin and &#947;-catenin and gain of mesenchymal markers N-cadherin and vimentin. Using isoform-specific primer sets, the alternative splicing of interested mRNAs are analyzed by quantitative RT-PCR. The production of corresponding protein isoforms is validated by immunoblotting assays. The method of detecting splice isoforms described here is also suitable for the study of alternative splicing in other biological processes.

Alternative splicing regulation has been shown to contribute to the epithelial-mesenchymal transition (EMT), an essential cellular program in various physiological and pathological processes. Here we describe a method utilizing an inducible EMT model for the detection of alternative splicing during EMT.

Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells

Summary

Explore More Videos

Chapters in this video

A Real-time Electrical Impedance Based Technique to Measure Invasion of Endothelial Cell Monolayer by Cancer Cells

A Preclinical Mouse Model of Osteosarcoma to Define the Extracellular Vesicle-mediated Communication Between Tumor and Mesenchymal Stem Cells

Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

An Enzyme- and Serum-free Neural Stem Cell Culture Model for EMT Investigation Suited for Drug Discovery

Three-Dimensional Bone Extracellular Matrix Model for Osteosarcoma

Tissue Engineering of Tumor Stromal Microenvironment with Application to Cancer Cell Invasion

Studying TGF-β Signaling and TGF-β-induced Epithelial-to-mesenchymal Transition in Breast Cancer and Normal Cells

Heteromulticellular Stromal Cells in Scaffold-free 3D Cultures of Epithelial Cancer Cells to Drive Invasion

Induction and Analysis of Epithelial to Mesenchymal Transition

Detection of Alternative Splicing During Epithelial-Mesenchymal Transition