This project has been funded in part with federal funds from the National Institute of Allergy and Infectious Diseases, National Institutes of Health, Department of Health and Human Services, under CEIRS contract HHSN272201400008C (F.K.); NIH U19AI109946-01 (F.K.); and P01AI097092-04S1 (P.E.L.).

<ol>
	<li>Shaw, M. L., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Orthomyxoviridae: the viruses and their replication. , (2013).</li><li>Nelson, M. I., Holmes, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolution+of+epidemic+influenza.">The evolution of epidemic influenza.</a> Nat Rev Genet. 8 (3), 196-205 (2007).</li><li>Lauring, A. S., Andino, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quasispecies+Theory+and+the+Behavior+of+RNA+Viruses.">Quasispecies Theory and the Behavior of RNA Viruses.</a> PLoS Pathog. 6 (7), e1001005 (2010).</li><li>Henry Dunand, C. J., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preexisting+human+antibodies+neutralize+recently+emerged+H7N9+influenza+strains.">Preexisting human antibodies neutralize recently emerged H7N9 influenza strains.</a> J Clin Invest. 125 (3), 1255-1268 (2015).</li><li>Dunand, C. J. H., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Both+Neutralizing+and+Non-Neutralizing+Human+H7N9+Influenza+Vaccine-Induced+Monoclonal+Antibodies+Confer+Protection.">Both Neutralizing and Non-Neutralizing Human H7N9 Influenza Vaccine-Induced Monoclonal Antibodies Confer Protection.</a> Cell Host Microbe. 19 (6), 800-813 (2016).</li><li>Tan, G. S., Lee, P. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+Broadly+Neutralizing+Monoclonal+Antibody+That+Targets+the+Fusion+Domain+of+Group+2+Influenza+A+Virus+Hemagglutinin.">Characterization of a Broadly Neutralizing Monoclonal Antibody That Targets the Fusion Domain of Group 2 Influenza A Virus Hemagglutinin.</a> J Virol. 88 (23), 13580-13592 (2014).</li><li>Tan, G. S., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broadly-Reactive+Neutralizing+and+Non-neutralizing+Antibodies+Directed+against+the+H7+Influenza+Virus+Hemagglutinin+Reveal+Divergent+Mechanisms+of+Protection.">Broadly-Reactive Neutralizing and Non-neutralizing Antibodies Directed against the H7 Influenza Virus Hemagglutinin Reveal Divergent Mechanisms of Protection.</a> PLoS Pathog. 12 (4), e1005578 (2016).</li><li>Smith, K., Garman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+generation+of+fully+human+monoclonal+antibodies+specific+to+a+vaccinating+antigen.">Rapid generation of fully human monoclonal antibodies specific to a vaccinating antigen.</a> Nat Protoc. 4 (3), 372-384 (2009).</li><li>Steel, J., Lowen, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influenza+virus+vaccine+based+on+the+conserved+hemagglutinin+stalk+domain.">Influenza virus vaccine based on the conserved hemagglutinin stalk domain.</a> mBio. 1 (1), (2010).</li><li>Krammer, F., Pica, N., Hai, R., Margine, I., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+hemagglutinin+influenza+virus+vaccine+constructs+elicit+broadly+protective+stalk-specific+antibodies.">Chimeric hemagglutinin influenza virus vaccine constructs elicit broadly protective stalk-specific antibodies.</a> J Virol. 87 (12), 6542-6550 (2013).</li><li>Wang, T. T., Tan, G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccination+with+a+synthetic+peptide+from+the+influenza+virus+hemagglutinin+provides+protection+against+distinct+viral+subtypes.">Vaccination with a synthetic peptide from the influenza virus hemagglutinin provides protection against distinct viral subtypes.</a> Proc Natl Acad Sci U S A. 107 (44), 18979-18984 (2010).</li><li>Impagliazzo, A., Milder, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stable+trimeric+influenza+hemagglutinin+stem+as+a+broadly+protective+immunogen.">A stable trimeric influenza hemagglutinin stem as a broadly protective immunogen.</a> Science. 349 (6254), 1301-1306 (2015).</li><li>Krammer, F., Palese, P., Steel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+Universal+Influenza+Virus+Vaccine+Design+and+Antibody+Mediated+Therapies+Based+on+Conserved+Regions+of+the+Hemagglutinin.">Advances in Universal Influenza Virus Vaccine Design and Antibody Mediated Therapies Based on Conserved Regions of the Hemagglutinin.</a> Current Topics in Microbiology and Immunology. , (2014).</li><li>Wohlbold, T. J., Nachbagauer, R., Margine, I., Tan, G. S., Hirsh, A., Krammer, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccination+with+soluble+headless+hemagglutinin+protects+mice+from+challenge+with+divergent+influenza+viruses.">Vaccination with soluble headless hemagglutinin protects mice from challenge with divergent influenza viruses.</a> Vaccine. 33 (29), 3314-3321 (2015).</li><li>Ekiert, D. C., Bhabha, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibody+recognition+of+a+highly+conserved+influenza+virus+epitope.">Antibody recognition of a highly conserved influenza virus epitope.</a> Science. 324 (5924), 246-251 (2009).</li><li>Ekiert, D. C., Friesen, R. H. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Highly+Conserved+Neutralizing+Epitope+on+Group+2+Influenza+A+Viruses.">A Highly Conserved Neutralizing Epitope on Group 2 Influenza A Viruses.</a> Science. 333 (6044), 843-850 (2011).</li><li>Dreyfus, C., Laursen, N. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+Conserved+Protective+Epitopes+on+Influenza+B+Viruses.">Highly Conserved Protective Epitopes on Influenza B Viruses.</a> Science. 337 (6100), 1343-1348 (2012).</li><li>Tran, E. E. H., Podolsky, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-electron+Microscopy+Structures+of+Chimeric+Hemagglutinin+Displayed+on+a+Universal+Influenza+Vaccine+Candidate.">Cryo-electron Microscopy Structures of Chimeric Hemagglutinin Displayed on a Universal Influenza Vaccine Candidate.</a> mBio. 7 (2), e00257 (2016).</li><li>Wiley, D. C., Wilson, I. A., Skehel, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+identification+of+the+antibody-binding+sites+of+Hong+Kong+influenza+haemagglutinin+and+their+involvement+in+antigenic+variation.">Structural identification of the antibody-binding sites of Hong Kong influenza haemagglutinin and their involvement in antigenic variation.</a> Nature. 289 (5796), 373-378 (1981).</li><li>Gerhard, W., Yewdell, J., Frankel, M. E., Webster, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigenic+structure+of+influenza+virus+haemagglutinin+defined+by+hybridoma+antibodies.">Antigenic structure of influenza virus haemagglutinin defined by hybridoma antibodies.</a> Nature. 290 (5808), 713-717 (1981).</li><li>Jackson, D. C., Murray, J. M., White, D. O., Gerhard, W. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enumeration+of+antigenic+sites+of+influenza+virus+hemagglutinin.">Enumeration of antigenic sites of influenza virus hemagglutinin.</a> Infect Immun. 37 (3), 912-918 (1982).</li><li>Matsuzaki, Y., Sugawara, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epitope+Mapping+of+the+Hemagglutinin+Molecule+of+A/(H1N1)pdm09+Influenza+Virus+by+Using+Monoclonal+Antibody+Escape+Mutants.">Epitope Mapping of the Hemagglutinin Molecule of A/(H1N1)pdm09 Influenza Virus by Using Monoclonal Antibody Escape Mutants.</a> J Virol. 88 (21), 12364-12373 (2014).</li><li>Tan, G. S., Krammer, F., Eggink, D., Kongchanagul, A., Moran, T. M., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+pan-H1+anti-hemagglutinin+monoclonal+antibody+with+potent+broad-spectrum+efficacy+in+vivo.">A pan-H1 anti-hemagglutinin monoclonal antibody with potent broad-spectrum efficacy in vivo.</a> J Virol. 86 (11), 6179-6188 (2012).</li><li>Geneva: World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> WHO manual on animal influenza diagnosis and surveillance. , (2002).</li><li>Brauer, R., Chen, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influenza+Virus+Propagation+in+Embryonated+Chicken+Eggs.">Influenza Virus Propagation in Embryonated Chicken Eggs.</a> J Vis Exp. (97), e52421 (2015).</li><li>Mart&#237;nez-Sobrido, L., Garc&#237;a-Sastre, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+Recombinant+Influenza+Virus+from+Plasmid+DNA.">Generation of Recombinant Influenza Virus from Plasmid DNA.</a> J Vis Exp. (42), e2057 (2010).</li><li>Hoffmann, E., Stech, J., Guan, Y., Webster, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Universal+primer+set+for+the+full-length+amplification+of+all+influenza+A+viruses.">Universal primer set for the full-length amplification of all influenza A viruses.</a> ArchVirol. 146 (12), 2275-2289 (2001).</li><li>Zhou, B., Lin, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Universal+Influenza+B+Virus+Genomic+Amplification+Facilitates+Sequencing,+Diagnostics,+and+Reverse+Genetics.">Universal Influenza B Virus Genomic Amplification Facilitates Sequencing, Diagnostics, and Reverse Genetics.</a> J Clin Microbiol. 52 (5), 1330-1337 (2014).</li><li>Sidhu, S. S., Kossiakoff, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+and+designing+protein+function+with+restricted+diversity.">Exploring and designing protein function with restricted diversity.</a> Curr Opin Chem Biol. 11, 347-354 (2007).</li><li>Chen, C. -. W., Chang, C. -. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peptide+Scanning-assisted+Identification+of+a+Monoclonal+Antibody-recognized+Linear+B-cell+Epitope.">Peptide Scanning-assisted Identification of a Monoclonal Antibody-recognized Linear B-cell Epitope.</a> J Vis Exp. (121), e55417 (2017).</li></ol>

The authors declare no conflicts of interest.

Although the majority of residues identified via escape mutants have been accurate, one of the major caveats of this approach is that point mutations of escape variants may not necessarily map within the molecular footprint of the antibody as determined by structural analyses. This is due to the ability of a mutation at a certain residue to lead to a conformational change distal to the location of the mutated residue, analogous to an allosteric effect. Another limitation is that this methodology can only be implemented for neutralizing antibodies; antibodies that lack in vitro selective pressure will not lead to escape mutants. However, this limitation can be overcome with the use of a panel of escape variants generated by previously characterized neutralizing antibodies. Tan et al. used an escape variant of a neutralizing mAb to the H7N9 virus to map the epitope of a non-neutralizing antibody7.
Nonetheless, elucidating the epitopes of antibodies through the generation of escape variants provides a viable alternative to crystallography and cryo-electron microscopy, both of which require an extensive investment of equipment. Other alternatives are to determine the minimal binding region of mAbs using alanine scanning or peptide scanning/truncation mutants. Alanine scanning mutagenesis may require a significant amount of work in generating a large number of variants during screening29, while peptide scanning is limited to linear epitopes30. The method described in this protocol requires no special equipment or technique and in fact, makes use of existing in vitro neutralization assays modified to generate escape variants of the antibodies of interest.
The protocol for generating escape variants that require multiple passages (e.g., stalk-specific antibodies) is highly dependent on the starting concentration of antibody in passage 0. It is better to err on the side of caution and start at a log to half a log lower than the half maximal inhibitory concentration of an antibody and allow for robust virus growth. The researcher can speculate that a high titer virus culture in the presence of low immunological pressure will have a large genetic variation in the viral population. Escape variants can be selected for by gradually increasing the antibody concentration in the following passages. In the event that the virus growth decreases, the amount of viral supernatant can be increased in the next passage while maintaining the same amount of antibody concentration in the previous passage.
The aim of a majority of universal influenza vaccines is to elicit a robust antibody response towards the stalk region of the HA. The analyses of escape variants to stalk-specific antibodies are important in defining the relationship between influenza virus fitness and immunological pressure. Interestingly, escape mutant viruses resulting from stalk-specific mAbs were all attenuated in vivo in murine LD50 studies4. These studies provide a strong case for stalk-based vaccination platforms. Additionally, this protocol could be used to identify escape mutants to other anti-viral compounds, such as small molecule inhibitors. Finally, this methodology is not limited to influenza virus surface glycoproteins, but may also be more widely applied to determine the epitopes of other viral glycoproteins.

Similar to other RNA viruses, influenza A viruses possess an error-prone polymerase that allows for the generation of a multitude of antigenic variants with each round of replication1,2,3. The influenza A virus has an astonishing ability to adapt and evade the human immune response via antigenic drift, which is achieved through an accumulation of mutations on the surface glycoproteins that leads to the loss of antibody binding. Antigenic drift of the viral surface glycoproteins, HA and neuraminidase (NA), necessitates the need to reformulate and administer the vaccine annually.
Technological advancements in the isolation and generation of antigen-specific antibodies have yielded a high number of vaccine-induced mAbs4,5,6,7,8. In turn, the characterization of the epitopes of mAbs that broadly neutralize influenza A viruses has greatly aided the development of several universal influenza vaccine candidates9,10,11,12,13,14. Elucidating the antigenic footprint of a mAb reveals the structural determinants of neutralization and allows for an informed approach towards vaccine design. However, it is neither realistic nor cost-effective for laboratories to structurally characterize extensive panels of mAbs through x-ray crystallography or cryo-electron microscopy in order to map epitopes on the viral antigen15,16,17,18.
X-ray crystallography or cryo-electron microscopy requires expensive equipment, specialized techniques and potentially an extensive amount of time to generate data. An alternative and faster approach is utilizing the rapid generation of diverse viral populations via the error-prone RNA-dependent RNA polymerase to generate escape mutants to determine the epitopes of mAbs19,20,21,22,23. The generation of escape variants does not require any special equipment or technique and can be performed with conventional laboratory reagents and equipment.
Here, we describe a method that allows for the mapping of critical residues required for mAb binding that recognize the influenza HA.

<table border="0" cellpadding="0" cellspacing="0" width="1159">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Falcon 96-well clear flat bottom TC-treated culture microplate with Lid</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353072</td>
			<td style="width:429px;">Assay plate use for the microneutralization assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Falcon 96-well clear V-bottom plate</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353263</td>
			<td>Assay plate use for the hemagglutination inhibition assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">1X Minimal Essential Medium (MEM)</td>
			<td style="width:197px;">Gibco</td>
			<td align="right" style="width:119px;">11095080</td>
			<td>Infection medium</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;">Tosyl phenylalanyl chloromethyl (TPCK)-treated trypsin</td>
			<td>Sigma-Aldrich</td>
			<td style="width:119px;">T8802</td>
			<td>Cleaves immature HA0 to HA1 and HA2</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Biotinylated anti-NP primary antibody (IAV)</td>
			<td>EMD Millipore</td>
			<td style="width:119px;">MAB8258B</td>
			<td>An antibody that recognizes the NP protein of influenza A viruses</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Biotinylated anti-NP primary antibody (IBV)</td>
			<td style="width:197px;">EMD Millipore</td>
			<td style="width:119px;">MAB8260B-5</td>
			<td>An antibody that recognizes the NP protein of influenza B viruses</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Streptavidin-HRP antibody</td>
			<td>EMD Millipore</td>
			<td style="width:119px;">18-152</td>
			<td>This is used as a secondary antibody for the biotinylated anti-NP antibody</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">HRP substrate (SIGMAFAST-OPD)</td>
			<td style="width:197px;">Sigma-Aldrich</td>
			<td style="width:119px;">P9187-5SET</td>
			<td>o-phenylenediamine dihydrochloride water soluble substrate for HRP</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">96-well V-bottom plate</td>
			<td style="width:197px;">Nunc</td>
			<td align="right" style="width:119px;">249662</td>
			<td>Assay plate used for the hemagglutination assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Chicken red blood cells</td>
			<td>Lampire Biological Laboratories</td>
			<td align="right" style="width:119px;">7201403</td>
			<td>Used to assess the ability of influenza virus to agglutinate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">TRIzol</td>
			<td style="width:197px;">Ambion</td>
			<td align="right" style="width:119px;">15596026</td>
			<td>Extraction of RNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Superscript III</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">12574018</td>
			<td>Reverse transcriptase</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Gel Extraction Kit</td>
			<td style="width:197px;">Qiagen</td>
			<td align="right" style="width:119px;">28704</td>
			<td>Isolation of amplified PCR product</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Lipofectamine 2000</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">11668027</td>
			<td>Transfection reagent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Anti-human IgG (H+L) Alexa Fluor 488</td>
			<td style="width:197px;">Invitrogen</td>
			<td style="width:119px;">A-11013</td>
			<td>Fluorescent secondary antibody for human antibodies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Anti-mouse IgG (H+L) Alexa Fluor 488</td>
			<td style="width:197px;">Invitrogen</td>
			<td style="width:119px;">A-11001</td>
			<td>Fluorescent secondary antibody for murine antibodies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">6-well polystyrene microplate</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353934</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">UltraPure Agarose</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">16500500</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Nalgene long term storage Cryo-tubes</td>
			<td style="width:197px;">ThermoFisher Scientific</td>
			<td style="width:119px;">5012-0020</td>
			<td>Freezing of viral culture supernatant</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">reassortant A/California/04/09 (H1)</td>
			<td style="width:197px;">Palese Laboratory</td>
			<td style="width:119px;"></td>
			<td>reassortant virus expressing the HA and NA of A/California/04/09 (H1N1) with the internal segments of A/Puerto Rico/8/34 (H1N1)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">reassortant A/Shanghai/1/13 (H7)</td>
			<td style="width:197px;">Palese Laboratory</td>
			<td style="width:119px;"></td>
			<td>reassortant virus expressing the HA and NA of A/Shanghai/1/13 (H7N9) with the internal segments of A/Puerto Rico/8/34 (H1N1)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Bovine serum albumin solution (35%)</td>
			<td style="width:197px;">Sigma-Aldrich</td>
			<td style="width:119px;">A7979</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Qiagen gel extration kit</td>
			<td style="width:197px;">Qiagen</td>
			<td align="right" style="width:119px;">28704</td>
			<td>Silica-membrane-based purification of DNA fragments</td>
		</tr>
	</tbody>
</table>

generation of escape variants of neutralizing influenza virus monoclonal antibodies

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface glycoproteins of the virus. The generation of escape variants is a powerful method in elucidating how viruses escape immune detection and in identifying critical residues required for antibody binding. Here, we describe a protocol on how to generate influenza A virus escape variants by utilizing human or murine monoclonal antibodies (mAbs) directed against the viral hemagglutinin (HA). With the use of our technique, we previously characterized critical residues required for the binding of antibodies targeting either the head or stalk of the novel avian H7N9 HA. The protocol can be easily adapted for other virus systems. Analyses of escape variants are important for modeling antigenic drift, determining single nucleotide polymorphisms (SNPs) conferring resistance and virus fitness, and in the designing of vaccines and/or therapeutics.

We have previously used variations of this method to generate escape variants to human and murine mAbs induced by the seasonal influenza virus vaccine, H7N9 vaccination, or sequential DNA/recombinant HA protein vaccination4,5,6,7. As described above, antibodies were first characterized using the HI and microneutralization assays in order to inform us of which specific protocol to continue with next4,5. Antibodies 07-5D03, 07-5F01, 07-5G01, 07-4B03, 07-4E02 and 07-4D05 were found to have HI and neutralization activities against the avian H7N9 virus (A/Shanghai/1/2013) (Table 1), and thus protocol 1 (step 2.1) was utilized. For mAbs with neutralizing that lack HI activity, such as 41-5E04, 045-051310-2B06, 042-100809-2F04 and S6-B01 (Table 1), protocol 2 (step 2.2) was used to generate escape variants. Escape mutant mapping revealed that many of the antibodies recognize critical residues in distinct locations on the viral HA4,5 (Figure 4). While the majority of the HI-positive antibodies have escape mutant residues near previously reported antigenic sites of the H7 HA, the HI-negative antibodies generated escape mutants with point mutations in the stalk region4,5.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Antibody</td>
			<td>HI Activity</td>
			<td>NEUT Activity</td>
		</tr>
		<tr>
			<td>07-5D03</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-5F01</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-5G01</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4B03</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4E02</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4D05</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>41-5E04</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>045-051310-2B06</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>042-100809-2F04</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>S6-B01</td>
			<td>-</td>
			<td>+</td>
		</tr>
	</tbody>
</table>
Table 1: Table of antibody HI and neutralization activity. Ten H7-specific mAbs isolated from individuals vaccinated with an experimental H7N9 vaccine exhibit different in vitro antiviral activities5.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td colspan="4">Forward Primer (5&#39; to 3&#39;)</td>
			<td colspan="4">Reverse Primer&#160; (5&#39; to 3&#39;)</td>
			<td colspan="2">Thermocylcer conditions</td>
		</tr>
		<tr>
			<td>IAV</td>
			<td colspan="4">TATTCGTCTCAGGGAGCAAAAGCAGGGG</td>
			<td colspan="4">ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT</td>
			<td colspan="2">42 &#186;C for 60 min, 94 &#186;C for 2 min/5 cycles of 94 &#186;C for 20 s, 50 &#186;C for 30 s and 68 &#186;C for 3 min 30 s, followed by 40&#160; cycles of 94 &#186;C for 20 s, 58 &#186;C for 30 s, and 68 &#186;C for 3 min 30 s with a final extension time at 68 &#186;C for 10 min</td>
		</tr>
		<tr>
			<td>IBV</td>
			<td colspan="4">GGGGGGAGCAGAAGCAGAGC</td>
			<td colspan="4">CCGGGTTATTAGTAGTAACAAGAGC</td>
			<td colspan="2">45 &#186;C for 60 min, 55 &#186;C for 30 min, 94 &#186;C for 2 min/5 cycles of 94 &#186;C for 20 s, 40 &#186;C for 30 s and 68 &#186;C for 3 min 30 s, followed by 40&#160; cycles of 94 &#186;C for 20 s, 58 &#186;C for 30 s, and 68 &#186;C for 3 min 30 s with a final extension time at 68 &#186;C for 10 min</td>
		</tr>
	</tbody>
</table>
Table 2: Universal influenza virus primers. Primer pairs for the amplification of the HA segments of influenza A27 and B28 viruses and their respective thermocycler conditions.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56067/56067fig1.jpg" /> 
Figure 1: HI assay. (A) A schematic for the setting up a HI assay to test the activity of two mouse H1-specific mAbs 7B2 (head-specific) and 6F12 (stalk-specific) using a 96-well V-bottom plate, and (B) an example of the results of an HI assay23. <a href="https://cloudflare.jove.com/files/ftp_upload/56067/56067fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56067/56067fig2.jpg" /> 
Figure 2: Microneutralization assay. A schematic for setting up a microneutralization assay to test the activity of two human mAbs 4D055 and CR911417. <a href="https://cloudflare.jove.com/files/ftp_upload/56067/56067fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56067/56067fig3.jpg" /> 
Figure 3: Generation of escape mutants. The methodology suggested will be dependent on the HI and the microneutralization activity exhibited by the antibody. The generation of escape mutants against (A) neutralizing HI-positive antibodies may require a single passage in eggs, while (B) neutralizing HI-negative antibodies may involve multiple passages with increasing antibody amounts in cell tissue culture. <a href="https://cloudflare.jove.com/files/ftp_upload/56067/56067fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56067/56067fig4.jpg" /> 
Figure 4: An example of an epitope map of the novel avian H7N9 HA generated with escape mutant variants. Vaccine-induced antibodies isolated from individuals vaccinated with a candidate H7N9 influenza A vaccine were used to generate escape mutant variants. Each residue indicated in red represents the location of critical amino acids required for efficient binding of a mAb. Data were adapted from Dunand-Henry et al., 20154. <a href="https://cloudflare.jove.com/files/ftp_upload/56067/56067fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies at JoVE.com

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

We describe a method by which we identify critical residues required for the binding of human or murine monoclonal antibodies that target the viral hemagglutinin of influenza A viruses. The protocol can be adapted to other virus surface glycoproteins and their corresponding neutralizing antibodies.

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...

generation-escape-variants-neutralizing-influenza-virus-monoclonal

Research

JoVE Journal

Immunology and Infection

11.6K Views.  Icahn School of Medicine at Mount Sinai. We describe a method by which we identify critical residues required for the binding of human or murine monoclonal antibodies that target the viral hemagglutinin of influenza A viruses. The protocol can be adapted to other virus surface glycoproteins and their corresponding neutralizing antibodies.

Video: Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

Generation of Recombinant Influenza Virus from Plasmid DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally established in 1999 1,2 plasmid-based reverse genetic techniques to generate recombinant viruses have revolutionized the influenza research field because specific questions have been answered by genetically engineered, infectious, recombinant influenza viruses. Such studies include virus replication, function of viral proteins, the contribution of specific mutations in viral proteins in viral replication and/or pathogenesis and, also, viral vectors using recombinant influenza viruses expressing foreign proteins 3.

Rescue of influenza A viruses from plasmid DNA is a basic and essential experimental technique that allows influenza researchers to generate recombinant viruses to study multiple aspects in the biology of influenza virus, and to be used as potential vectors or vaccines.

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the generation of extreme population diversity that facilitates virus adaptation and evolution. Increasing evidence shows that the intrinsic error rates, and the resulting mutation frequencies, of RNA viruses can be modulated by subtle amino acid changes to the viral polymerase. Although biochemical assays exist for some viral RNA polymerases that permit quantitative measure of incorporation fidelity, here we describe a simple method of measuring mutation frequencies of RNA viruses that has proven to be as accurate as biochemical approaches in identifying fidelity altering mutations. The approach uses conventional virological and sequencing techniques that can be performed in most biology laboratories. Based on our experience with a number of different viruses, we have identified the key steps that must be optimized to increase the likelihood of isolating fidelity variants and generating data of statistical significance. The isolation and characterization of fidelity altering mutations can provide new insights into polymerase structure and function1-3. Furthermore, these fidelity variants can be useful tools in characterizing mechanisms of virus adaptation and evolution4-7.

The present article describes the steps required to isolate and characterize RNA polymerase fidelity variants of RNA viruses and how to use mutation frequency data to confirm fidelity changes in tissue culture.

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

High-throughput Detection Method for Influenza Virus

Influenza virus is a respiratory pathogen that causes a high degree of morbidity and mortality every year in multiple parts of the world. Therefore, precise diagnosis of the infecting strain and rapid high-throughput screening of vast numbers of clinical samples is paramount to control the spread of pandemic infections. Current clinical diagnoses of influenza infections are based on serologic testing, polymerase chain reaction, direct specimen immunofluorescence and cell culture 1,2.
Here, we report the development of a novel diagnostic technique used to detect live influenza viruses. We used the mouse-adapted human A/PR/8/34 (PR8, H1N1) virus 3 to test the efficacy of this technique using MDCK cells 4. MDCK cells (104 or 5 x 103 per well) were cultured in 96- or 384-well plates, infected with PR8 and viral proteins were detected using anti-M2 followed by an IR dye-conjugated secondary antibody. M2 5 and hemagglutinin 1 are two major marker proteins used in many different diagnostic assays. Employing IR-dye-conjugated secondary antibodies minimized the autofluorescence associated with other fluorescent dyes. The use of anti-M2 antibody allowed us to use the antigen-specific fluorescence intensity as a direct metric of viral quantity. To enumerate the fluorescence intensity, we used the LI-COR Odyssey-based IR scanner. This system uses two channel laser-based IR detections to identify fluorophores and differentiate them from background noise. The first channel excites at 680 nm and emits at 700 nm to help quantify the background. The second channel detects fluorophores that excite at 780 nm and emit at 800 nm. Scanning of PR8-infected MDCK cells in the IR scanner indicated a viral titer-dependent bright fluorescence. A positive correlation of fluorescence intensity to virus titer starting from 102-105 PFU could be consistently observed. Minimal but detectable positivity consistently seen with 102-103 PFU PR8 viral titers demonstrated the high sensitivity of the near-IR dyes. The signal-to-noise ratio was determined by comparing the mock-infected or isotype antibody-treated MDCK cells.
Using the fluorescence intensities from 96- or 384-well plate formats, we constructed standard titration curves. In these calculations, the first variable is the viral titer while the second variable is the fluorescence intensity. Therefore, we used the exponential distribution to generate a curve-fit to determine the polynomial relationship between the viral titers and fluorescence intensities. Collectively, we conclude that IR dye-based protein detection system can help diagnose infecting viral strains and precisely enumerate the titer of the infecting pathogens.

This method describes the use of Infrared dye based imaging system for detection of H1N1 in bronchioalveolar lavage (BAL) fluid of infected mice at a high sensitivity. This methodology can be performed in a 96- or 384-well plate, requires &lt;10 &mu;l volume of test material and has the potential for concurrent screening of multiple pathogens.

Influenza virus is a respiratory pathogen that causes a high degree of morbidity and mortality every year in multiple parts of the world. Therefore, ...

Influenza Virus Propagation in Embryonated Chicken Eggs

Influenza infection is associated with about 36,000 deaths and more than 200,000 hospitalizations every year in the United States. The continuous emergence of new influenza virus strains due to mutation and re-assortment complicates the control of the virus and necessitates the permanent development of novel drugs and vaccines. The laboratory-based study of influenza requires a reliable and cost-effective method for the propagation of the virus. Here, a comprehensive protocol is provided for influenza A virus propagation in fertile chicken eggs, which consistently yields high titer viral stocks. In brief, serum pathogen-free (SPF) fertilized chicken eggs are incubated at 37 &#176;C and 55-60% humidity for 10 &#8211; 11 days. Over this period, embryo development can be easily monitored using an egg candler. Virus inoculation is carried out by injection of virus stock into the allantoic cavity using a needle. After 2 days of incubation at 37 &#176;C, the eggs are chilled for at least 4 hr at 4 &#176;C. The eggshell above the air sac and the chorioallantoic membrane are then carefully opened, and the allantoic fluid containing the virus is harvested. The fluid is cleared from debris by centrifugation, aliquoted and transferred to -80 &#176;C for long-term storage. The large amount (5-10 ml of virus-containing fluid per egg) and high virus titer which is usually achieved with this protocol has made the usage of eggs for virus preparation our favorable method, in particular for in vitro studies which require large quantities of virus in which high dosages of the same virus stock are needed.

Fertile chicken eggs are widely used to produce large amounts of human influenza A virus as they provide a convenient and cost-effective system to prove high yields of virus.

Influenza infection is associated with about 36,000 deaths and more than 200,000 hospitalizations every year in the United States. The continuous ...

Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, including the development of immunotherapeutics. However, the techniques to identify and produce such antibodies tend to be arduous and sometimes the heavy and light chain pair of the antibodies are dissociated. Here, we describe a relatively simple, straightforward protocol to produce human recombinant monoclonal antibodies from human peripheral blood mononuclear cells using immortalization with Epstein-Barr Virus (EBV) and Toll-like receptor 9 activation. With an adequate staining, B cells producing antibodies can be isolated for subsequent immortalization and clonal expansion. The antibody transcripts produced by the immortalized B cell clones can be amplified by PCR, sequenced as corresponding heavy and light chain pairs and cloned into immunoglobulin expression vectors. The antibodies obtained with this technique can be powerful tools to study relevant human immune responses, including autoimmunity, and create the basis for new therapeutics.

Synthesis of human monoclonal antibodies is the first step in studies aimed at unraveling the pathophysiological mechanisms of auto-antibody-mediated immune responses. We have developed a protocol to generate recombinant human immunoglobulin G (IgG) monoclonal antibodies from blood sorted B cells, including B-cell isolation, antibody cloning and in vitro synthesis.

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, ...

Generation of Murine Monoclonal Antibodies by Hybridoma Technology

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding molecules is time-consuming and laborious due to the complicated handling and lack of alternatives. The aim of this protocol is to provide one standard method for the generation of monoclonal antibodies using hybridoma technology. This technology combines two steps. Step 1 is an appropriate immunization of the animal and step 2 is the fusion of B lymphocytes with immortal myeloma cells in order to generate hybrids possessing both parental functions, such as the production of antibody molecules and immortality. The generated hybridoma cells were then recloned and diluted to obtain stable monoclonal cell cultures secreting the desired monoclonal antibody in the culture supernatant. The supernatants were tested in enzyme-linked immunosorbent assays (ELISA) for antigen specificity. After the selection of appropriate cell clones, the cells were transferred to mass cultivation in order to produce the desired antibody molecule in large amounts. The purification of the antibodies is routinely performed by affinity chromatography. After purification, the antibody molecule can be characterized and validated for the final test application. The whole process takes 8 to 12 months of development, and there is a high risk that the antibody will not work in the desired test system.

An optimized protocol is presented for the generation of monoclonal antibodies based on the hybridoma technology. Mice were immunized with an immunoconjugate. Spleen cells were fused by PEG and an electric impulse with immortal myeloma cells. Antibody-producing hybridoma cells were selected by HAT and antigen-specific ELISA screening.

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding ...

Influenza A Virus Studies in a Mouse Model of Infection

Influenza viruses cause over 500,000 deaths worldwide1 and are associated with an annual cost of 12 - 14 billion USD in the United States alone considering direct medical and hospitalization expenses and work absenteeism2. Animal models are crucial in Influenza A virus (IAV) studies to evaluate viral pathogenesis, host-pathogen interactions, immune responses, and the efficacy of current and/or novel vaccine approaches as well as antivirals. Mice are an advantageous small animal model because their immune system is evolutionarily similar to that found in humans, they are available from commercial vendors as genetically identical subjects, there are multiple strains that can be exploited to evaluate the genetic basis of infections, and they are relatively inexpensive and easy to manipulate. To recapitulate IAV infection in humans via the airways, mice are first anesthetized prior to intranasal inoculation with infectious IAVs under proper biosafety containment. After infection, the pathogenesis of IAVs is determined by monitoring daily the morbidity (body weight loss) and mortality (survival) rate. In addition, viral pathogenesis can also be evaluated by assessing virus replication in the upper (nasal mucosa) or lower (lungs) respiratory tract of infected mice. Humoral responses upon IAV infection can be rapidly evaluated by non-invasive bleeding and secondary antibody detection assays aimed at detecting the presence of total or neutralizing antibodies. Here, we describe the common methods used to infect mice intranasally (i.n) with IAV and evaluate pathogenesis, humoral immune responses and protection efficacy.

Influenza A viruses (IAVs) are important human respiratory pathogens. To understand the pathogenicity of IAVs and to perform preclinical testing of novel vaccine approaches, animal models mimicking human physiology are required. Here, we describe techniques to evaluate IAV pathogenesis, humoral responses and vaccine efficacy using a mouse model of infection.

Influenza viruses cause over 500,000 deaths worldwide1 and are associated with an annual cost of 12 - 14 billion USD in the United States alone ...

Measuring Influenza Neutralizing Antibody Responses to A(H3N2) Viruses in Human Sera by Microneutralization Assays Using MDCK-SIAT1 Cells

Neutralizing antibodies against hemagglutinin (HA) of influenza viruses are considered the main immune mechanism that correlates with protection for influenza infections. Microneutralization (MN) assays are often used to measure neutralizing antibody responses in human sera after influenza vaccination or infection. Madine Darby Canine Kidney (MDCK) cells are the commonly used cell substrate for MN assays. However, currently circulating 3C.2a and 3C.3a A(H3N2) influenza viruses have acquired altered receptor binding specificity. The MDCK-SIAT1 cell line with increased &#945;-2,6 sialic galactose moieties on the surface has proven to provide improved infectivity and more faithful replications than conventional MDCK cells for these contemporary A(H3N2) viruses. Here, we describe a MN assay using MDCK-SIAT1 cells that has been optimized to quantify neutralizing antibody titers to these contemporary A(H3N2) viruses. In this protocol, heat inactivated sera containing neutralizing antibodies are first serially diluted, then incubated with 100 TCID50/well of influenza A(H3N2) viruses to allow antibodies in the sera to bind to the viruses. MDCK-SIAT1 cells are then added to the virus-antibody mixture, and incubated for 18 - 20 h at 37 &#176;C, 5% CO2 to allow A(H3N2) viruses to infect MDCK-SIAT1 cells. After overnight incubation, plates are fixed and the amount of virus in each well is quantified by an enzyme-linked immunosorbent assay (ELISA) using anti-influenza A nucleoprotein (NP) monoclonal antibodies. Neutralizing antibody titer is defined as the reciprocal of the highest serum dilution that provides &#8805;50% inhibition of virus infectivity.

Measuring Influenza Neutralizing Antibody Responses to AH3N2 Viruses in Human Sera by Microneutralization Assays Using MDCK-SIAT1 Cells

Influenza neutralizing antibodies correlate with protection of influenza infections. Microneutralization assays measure neutralizing antibodies in human sera and are often used for influenza human serology. We describe a microneutralization assay using MDCK-SIAT1 cells to measure neutralizing antibody titers to contemporary 3C.2a and 3C.3a A(H3N2) viruses following influenza vaccination or infection.

Neutralizing antibodies against hemagglutinin (HA) of influenza viruses are considered the main immune mechanism that correlates with protection for ...

Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the antibody needs to distinguish between highly related structures (e.g., a normal protein and a mutated version thereof). The current way of generating such discriminative mAbs involves extensive screening of multiple Ab-producing B cells, which is both costly and time consuming. We propose here a rapid and cost-effective method for the generation of discriminative, fully human mAbs starting from human blood circulating B lymphocytes. The originality of this strategy is due to the selection of specific antigen binding B cells combined with the counter-selection of all other cells, using readily available Peripheral Blood Mononuclear Cells (PBMC). Once specific B cells are isolated, cDNA (complementary deoxyribonucleic acid) sequences coding for the corresponding mAb are obtained using single cell Reverse Transcription-Polymerase Chain Reaction (RT-PCR) technology and subsequently expressed in human cells. Within as little as 1 month, it is possible to produce milligrams of highly discriminative human mAbs directed against virtually any desired antigen naturally detected by the B cell repertoire.

We describe a method for the production of human antibodies specific for an antigen of interest, starting from rare B cells circulating in human blood. Generation of these natural antibodies is efficient and rapid, and the antibodies obtained can discriminate between highly related antigens.

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the ...

Generation of Monoclonal Antibodies Against Natural Products

The analysis of the bioactive components present in foods and natural products has become a popular area of study in many fields, including traditional Chinese medicine and food safety/toxicology. Many of the classical analysis techniques require expensive equipment and/or expertise. Notably, enzyme-linked immunosorbent assays (ELISAs) have become an emerging method for the analysis of foods and natural products. This method is based on antibody-mediated detection of the target components. However, as many of the bioactive components in natural products are small (&lt;1,000 Da) and do not induce an immune response, creating monoclonal antibodies (mAbs) against them is often difficult. In this protocol, we provide a detailed explanation of the steps required to generate mAbs against target molecules as well as those needed to create the associated indirect competitive (ic)ELISA for the rapid analysis of the compound in multiple samples. The procedure describes the synthesis of the artificial antigen (i.e., the hapten-carrier conjugate), immunization, cell fusion, monoclonal hybridoma preparation, characterization of the mAb, and the ELISA-based application of the mAb. The hapten-carrier conjugate was synthesized by the sodium periodate method and evaluated by MALDI-TOF-MS. After immunization, splenocytes were isolated from the immunized mouse with the highest antibody titer and fused with the hypoxanthine-aminopterin-thymidine (HAT)-sensitive mouse myeloma cell line Sp2/0 -Ag14 using a polyethylene glycol (PEG)-based method. The hybridomas secreting mAbs reactive to the target antigen were screened by icELISA for specificity and cross-reactivity. Furthermore, the limiting dilution method was applied to prepare monoclonal hybridomas. The final mAbs were further characterized by icELISA and then utilized in an ELISA-based application for the rapid and convenient detection of the example hapten (naringin (NAR)) in natural products.

This article provides a detailed protocol for the preparation and evaluation of monoclonal antibodies against natural products for use in various immunoassays. This procedure includes immunization, cell fusion, indirect competitive ELISA for positive clone screening, and monoclonal hybridoma preparation. The specifications for antibody characterization using MALDI-TOF-MS and ELISA analyses are also provided.

The analysis of the bioactive components present in foods and natural products has become a popular area of study in many fields, including traditional ...