Name: a facile protocol to generate site-specifically acetylated proteins in escherichia coli
Uploaded: 2017-12-09T14:00:00
Description: Watch this Scientific Journal Video about A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli at JoVE.com

This work was supported by the NIH (AI119813), the start-up from the University of Arkansas, and the award from Arkansas Biosciences Institute.

1. Site-Directed Mutagenesis of the Target Gene
Note: MDH is expressed under T7 promoter in the pCDF-1 vector with the CloDF13 origin and a copy number of 20 to 4034.
<ol>
	<li>Introduce the amber stop codon at the position 140 in the gene by primers (forward primer: GGTGTTTATGACTAGAACAAACTGTTCGGCG and reverse primer: GGCTTTTTTCAGCACTTCAGCAGCAATTGC), following the instruction of the site-directed mutagenesis kit.</li>
	<li>Amplify th...

<ol>
	<li>Krishna, R. G., Wold, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Post-translational+modification+of+proteins.">Post-translational modification of proteins.</a> Adv Enzymol Relat Areas Mol Biol. 67, 265-298 (1993).</li><li>Lothrop, A. P., Torres, M. P., Fuchs, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deciphering+post-translational+modification+codes.">Deciphering post-translational modification codes.</a> FEBS Lett. 587 (8), 1247-1257 (2013).</li><li>Walsh, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Posttranslational modification of proteins : expanding nature's inventory. , (2006).</li><li>Khoury, G. A., Baliban, R. C., Floudas, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteome-wide+post-translational+modification+statistics:+frequency+analysis+and+curation+of+the+swiss-prot+database.">Proteome-wide post-translational modification statistics: frequency analysis and curation of the swiss-prot database.</a> Sci Rep. 1, (2011).</li><li>Grotenbreg, G., Ploegh, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+biology:+dressed-up+proteins.">Chemical biology: dressed-up proteins.</a> Nature. 446 (7139), 993-995 (2007).</li><li>Arif, M., Selvi, B. R., Kundu, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+acetylation:+the+tale+of+a+modification+from+transcription+regulation+to+metabolism.">Lysine acetylation: the tale of a modification from transcription regulation to metabolism.</a> Chembiochem. 11 (11), 1501-1504 (2010).</li><li>Cohen, T., Yao, T. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=AcK-knowledge+reversible+acetylation.">AcK-knowledge reversible acetylation.</a> Science's STKE : signal transduction knowledge environment. (245), pe42 (2004).</li><li>Drazic, A., Myklebust, L. M., Ree, R., Arnesen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+world+of+protein+acetylation.">The world of protein acetylation.</a> Biochim Biophys Acta. 1864 (10), 1372-1401 (2016).</li><li>Escalante-Semerena, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N&#949;-acetylation+control+conserved+in+all+three+life+domains.">N&#949;-acetylation control conserved in all three life domains.</a> Microbe. 5, 340-344 (2010).</li><li>Kouzarides, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation:+a+regulatory+modification+to+rival+phosphorylation?.">Acetylation: a regulatory modification to rival phosphorylation?.</a> The EMBO journal. 19 (6), 1176-1179 (2000).</li><li>Soppa, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+acetylation+in+archaea,+bacteria,+and+eukaryotes.">Protein acetylation in archaea, bacteria, and eukaryotes.</a> Archaea. , (2010).</li><li>Verdin, E., Ott, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=50+years+of+protein+acetylation:+from+gene+regulation+to+epigenetics,+metabolism+and+beyond.">50 years of protein acetylation: from gene regulation to epigenetics, metabolism and beyond.</a> Nat Rev Mol Cell Biol. 16 (4), 258-264 (2015).</li><li>Allfrey, V. G., Faulkner, R., Mirsky, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+and+Methylation+of+Histones+and+Their+Possible+Role+in+the+Regulation+of+Rna+Synthesis.">Acetylation and Methylation of Histones and Their Possible Role in the Regulation of Rna Synthesis.</a> P Natl Acad Sci USA. 51, 786-794 (1964).</li><li>Phillips, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+presence+of+acetyl+groups+of+histones.">The presence of acetyl groups of histones.</a> Biochem j. 87, 258-263 (1963).</li><li>Sterner, D. E., Berger, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+of+histones+and+transcription-related+factors.">Acetylation of histones and transcription-related factors.</a> Microbiology and molecular biology reviews: MMBR. 64 (2), 435-459 (2000).</li><li>Glozak, M. A., Sengupta, N., Zhang, X., Seto, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+and+deacetylation+of+non-histone+proteins.">Acetylation and deacetylation of non-histone proteins.</a> Gene. 363, 15-23 (2005).</li><li>Close, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+emerging+role+of+lysine+acetylation+of+non-nuclear+proteins.">The emerging role of lysine acetylation of non-nuclear proteins.</a> Cell Mol Life Sci. 67 (8), 1255-1264 (2010).</li><li>Iyer, A., Fairlie, D. P., Brown, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+acetylation+in+obesity,+diabetes+and+metabolic+disease.">Lysine acetylation in obesity, diabetes and metabolic disease.</a> Immunol Cell Biol. 90 (1), 39-46 (2012).</li><li>You, L., Nie, J., Sun, W. J., Zheng, Z. Q., Yang, X. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+acetylation:+enzymes,+bromodomains+and+links+to+different+diseases.">Lysine acetylation: enzymes, bromodomains and links to different diseases.</a> Essays Biochem. 52, 1-12 (2012).</li><li>Bonnaud, E. M., Suberbielle, E., Malnou, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+acetylation+in+neuronal+(dys)function.">Histone acetylation in neuronal (dys)function.</a> Biomol Concepts. 7 (2), 103-116 (2016).</li><li>Fukushima, A., Lopaschuk, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+control+of+cardiac+fatty+acid+beta-oxidation+and+energy+metabolism+in+obesity,+diabetes,+and+heart+failure.">Acetylation control of cardiac fatty acid beta-oxidation and energy metabolism in obesity, diabetes, and heart failure.</a> Biochim Biophys Acta. 1862 (12), 2211-2220 (2016).</li><li>Kaypee, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aberrant+lysine+acetylation+in+tumorigenesis:+Implications+in+the+development+of+therapeutics.">Aberrant lysine acetylation in tumorigenesis: Implications in the development of therapeutics.</a> Pharmacol Ther. 162, 98-119 (2016).</li><li>Tapias, A., Wang, Z. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+Acetylation+and+Deacetylation+in+Brain+Development+and+Neuropathies.">Lysine Acetylation and Deacetylation in Brain Development and Neuropathies.</a> Genomics Proteomics Bioinformatics. 15 (1), 19-36 (2017).</li><li>Hu, L. I., Lima, B. P., Wolfe, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+protein+acetylation:+the+dawning+of+a+new+age.">Bacterial protein acetylation: the dawning of a new age.</a> Molecular microbiology. 77 (1), 15-21 (2010).</li><li>Jones, J. D., O'Connor, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+acetylation+in+prokaryotes.">Protein acetylation in prokaryotes.</a> Proteomics. 11 (15), 3012-3022 (2011).</li><li>Bernal, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+bacterial+physiology+by+lysine+acetylation+of+proteins.">Regulation of bacterial physiology by lysine acetylation of proteins.</a> New biotechnol. 31 (6), 586-595 (2014).</li><li>Hentchel, K. L., Escalante-Semerena, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acylation+of+Biomolecules+in+Prokaryotes:+a+Widespread+Strategy+for+the+Control+of+Biological+Function+and+Metabolic+Stress.">Acylation of Biomolecules in Prokaryotes: a Widespread Strategy for the Control of Biological Function and Metabolic Stress.</a> Microbiology and molecular biology reviews : MMBR. 79 (3), 321-346 (2015).</li><li>Ouidir, T., Kentache, T., Hardouin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+lysine+acetylation+in+bacteria:+Current+state+of+the+art.">Protein lysine acetylation in bacteria: Current state of the art.</a> Proteomics. 16 (2), 301-309 (2016).</li><li>Wolfe, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+protein+acetylation:+new+discoveries+unanswered+questions.">Bacterial protein acetylation: new discoveries unanswered questions.</a> Curr Genet. 62 (2), 335-341 (2016).</li><li>Albaugh, B. N., Arnold, K. M., Lee, S., Denu, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autoacetylation+of+the+histone+acetyltransferase+Rtt109.">Autoacetylation of the histone acetyltransferase Rtt109.</a> J Biol Chem. 286 (28), 24694-24701 (2011).</li><li>Neumann, H., Peak-Chew, S. Y., Chin, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+encoding+N&#949;-acetyllysine+in+recombinant+proteins.">Genetically encoding N&#949;-acetyllysine in recombinant proteins.</a> Nat chem biol. 4 (4), 232-234 (2008).</li><li>Fan, C., Xiong, H., Reynolds, N. M., Soll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rationally+evolving+tRNAPyl+for+efficient+incorporation+of+noncanonical+amino+acids.">Rationally evolving tRNAPyl for efficient incorporation of noncanonical amino acids.</a> Nucleic Acids Res. 43 (22), e156 (2015).</li><li>Bryson, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Continuous+directed+evolution+of+aminoacyl-tRNA+synthetases+to+alter+amino+acid+specificity+and+enhance+activity.">Continuous directed evolution of aminoacyl-tRNA synthetases to alter amino acid specificity and enhance activity.</a> Nat Chem Biol. , (2017).</li><li>Venkat, S., Gregory, C., Sturges, J., Gan, Q., Fan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studying+the+Lysine+Acetylation+of+Malate+Dehydrogenase.">Studying the Lysine Acetylation of Malate Dehydrogenase.</a> J Mol Biol. 429 (9), 1396-1405 (2017).</li><li>Venkat, S., Gregory, C., Gan, Q., Fan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+characterization+of+the+lysine+acetylation+of+tyrosyl-tRNA+synthetase+in+Escherichia+coli.">Biochemical characterization of the lysine acetylation of tyrosyl-tRNA synthetase in Escherichia coli.</a> Chembiochem. 18 (19), 1928-1934 (2017).</li><li>Liu, C. C., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adding+new+chemistries+to+the+genetic+code.">Adding new chemistries to the genetic code.</a> Annu Rev Biochem. 79, 413-444 (2010).</li><li>Mukai, T., Lajoie, M. J., Englert, M., Soll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rewriting+the+Genetic+Code.">Rewriting the Genetic Code.</a> Annu Rev Microbiol. , (2017).</li><li>O'Donoghue, P., Ling, J., Wang, Y. S., Soll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Upgrading+protein+synthesis+for+synthetic+biology.">Upgrading protein synthesis for synthetic biology.</a> Nat Chem Biol. 9 (10), 594-598 (2013).</li><li>Chin, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expanding+and+reprogramming+the+genetic+code+of+cells+and+animals.">Expanding and reprogramming the genetic code of cells and animals.</a> Annu Rev Biochem. 83, 379-408 (2014).</li><li>O'Donoghue, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Near-cognate+suppression+of+amber,+opal+and+quadruplet+codons+competes+with+aminoacyl-tRNAPyl+for+genetic+code+expansion.">Near-cognate suppression of amber, opal and quadruplet codons competes with aminoacyl-tRNAPyl for genetic code expansion.</a> FEBS Lett. 586 (21), 3931-3937 (2012).</li><li>Aerni, H. R., Shifman, M. A., Rogulina, S., O'Donoghue, P., Rinehart, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Revealing+the+amino+acid+composition+of+proteins+within+an+expanded+genetic+code.">Revealing the amino acid composition of proteins within an expanded genetic code.</a> Nucleic Acids Res. 43 (2), e8 (2015).</li><li>Huang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+convenient+method+for+genetic+incorporation+of+multiple+noncanonical+amino+acids+into+one+protein+in+Escherichia+coli.">A convenient method for genetic incorporation of multiple noncanonical amino acids into one protein in Escherichia coli.</a> Mol Biosyst. 6 (4), 683-686 (2010).</li><li>Venkat, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+encoding+thioacetyl-lysine+as+a+nondeacetylatable+analog+of+lysine+acetylation+in+Escherichia+coli.">Genetically encoding thioacetyl-lysine as a nondeacetylatable analog of lysine acetylation in Escherichia coli.</a> FEBS Open. , (2017).</li><li>Wan, W., Tharp, J. M., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysyl-tRNA+synthetase:+an+ordinary+enzyme+but+an+outstanding+genetic+code+expansion+tool.">Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool.</a> Biochim Biophys Acta. 1844 (6), 1059-1070 (2014).</li><li>Gregoretti, I. V., Lee, Y. M., Goodson, H. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+evolution+of+the+histone+deacetylase+family:+functional+implications+of+phylogenetic+analysis.">Molecular evolution of the histone deacetylase family: functional implications of phylogenetic analysis.</a> J Mol Biol. 338 (1), 17-31 (2004).</li><li>Weinert, B. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetyl-phosphate+is+a+critical+determinant+of+lysine+acetylation+in+E.+coli.">Acetyl-phosphate is a critical determinant of lysine acetylation in E. coli.</a> Mol cell. 51 (2), 265-272 (2013).</li></ol>

The genetic incorporation of noncanonical amino acids (ncAAs) is based on the suppression of an assigned codon, mostly the amber stop codon UAG36,37,38,39, by the ncAA-charged tRNA containing the corresponding anticodon. As is known, the UAG codon is recognized by the release factor-1 (RF1) in bacteria, and it can also be suppressed by near cognate tRNAs from hosts charged by canonical amino ac...

Post-translational modifications (PTMs) of proteins occur after the translation process, and arise from covalent addition of functional groups to amino acid residues, playing important roles in almost all the biological processes, including gene transcription, stress response, cellular differentiation, and metabolism1,2,3. To date, about 400 distinctive PTMs have been identified4. The intricacy of the genome and the proteome is amplified to a great extent by protein PTMs, as they regulate protein activity and localization, and affect the interaction with other molecules such as proteins, nucleic acids, lipids, and cofactors5.
Protein acetylation has been at the forefront of PTMs studies in the last two decades6,7,8,9,10,11,12. Lysine acetylation was first discovered in histones more than 50 years ago13,14, has been well scrutinized, and is known to exist in more than 80 transcription factors, regulators, and various proteins15,16,17. Studies on protein acetylation have not only provided us with a deeper understanding of its regulatory mechanisms, but also guided treatments for a number of diseases caused by dysfunctional acetylation18,19,20,21,22,23. It was believed that lysine acetylation only happens in eukaryotes, but recent studies have shown that protein acetylation also plays key roles in bacterial physiology, including chemotaxis, acid resistance, activation, and stabilization of pathogenicity islands and other virulence related proteins24,25,26,27,28,29.
A commonly used method to biochemically characterize lysine acetylation is using site-directed mutagenesis. Glutamine is used as a mimic of acetyllysine because of its similar size and polarity. Arginine is utilized as a non-acetylated lysine mimic, since it preserves its positive charge under physiological conditions but cannot be acetylated. However, both mimics are not real isosteres and do not always yield the expected results30. The most rigorous approach is to generate homogeneously acetylated proteins at specific lysine residues, which is difficult or impossible for most classical methods due to the low stoichiometry of lysine acetylation in nature7,11. This challenge has been unraveled by the genetic code expansion strategy, which employs an engineered pyrrolysyl-tRNA synthetase variant from Methanosarcinaceae species to charge tRNAPyl with acetyllysine, utilizes the host translational machinery to suppress the UAG stop codon in the mRNA, and directs the incorporation of acetyllysine in the designed position of the target protein31. Recently, we have optimized this system with an improved EF-Tu-binding tRNA32 and an upgraded acetyllysyl-tRNA synthetase33. Furthermore, we have applied this enhanced incorporation system in acetylation studies of malate dehydrogenase34 and tyrosyl-tRNA synthetase35. Herein, we demonstrate the protocol for generating purely acetylated proteins from the molecular cloning to biochemical identification by using malate dehydrogenase (MDH), which we have extensively studied as a demonstrative example.

<table border="0" cellpadding="0" cellspacing="0" width="615">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Bradford protein assay</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">5000006</td>
			<td style="width:167px;">Protein concentration</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">4x Laemmli Sample Buffer</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">1610747</td>
			<td style="width:167px;">SDS sample buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Coomassie G-250 Stain</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">1610786</td>
			<td style="width:167px;">SDS-PAGE gel staining</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">4-20% SDS-PAGE ready gel</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">4561093</td>
			<td style="width:167px;">Protein determination</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Ac-K-100 (HRP Conjugate)</td>
			<td style="width:113px;">Cell Signaling</td>
			<td style="width:119px;">6952</td>
			<td style="width:167px;">Antibody</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">IPTG</td>
			<td style="width:113px;">CHEM-IMPEX</td>
			<td style="width:119px;">194</td>
			<td style="width:167px;">Expression inducer</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:216px;">N&#949;-Acetyl-L-lysine</td>
			<td style="width:113px;">CHEM-IMPEX</td>
			<td style="width:119px;">5364</td>
			<td style="width:167px;">Noncanonical amino acid</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">PD-10 desalting column</td>
			<td style="width:113px;">GE Healthcare</td>
			<td style="width:119px;">17085101</td>
			<td style="width:167px;">Desalting</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">Q5 Site-Directed Mutagenesis Kit</td>
			<td style="width:113px;">NEB</td>
			<td style="width:119px;">E0554</td>
			<td style="width:167px;">Introducing the stop codon</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">BL21 (DE3) cells</td>
			<td style="width:113px;">NEB</td>
			<td style="width:119px;">C2527</td>
			<td style="width:167px;">Expressing strain</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:113px;">QIAGEN</td>
			<td style="width:119px;">27106</td>
			<td style="width:167px;">Extracting plasmids</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Ni-NTA resin</td>
			<td style="width:113px;">QIAGEN</td>
			<td style="width:119px;">30210</td>
			<td style="width:167px;">Affinity purification resin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">nicotinamide</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">N3376</td>
			<td style="width:167px;">Deacetylase inhibitor</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">&#946;-Mercaptoethanol</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">M6250</td>
			<td style="width:167px;">Reducing agent</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">BugBuster Protein Extraction Reagent</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">70584</td>
			<td style="width:167px;">Breaking cells</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Benzonase nuclease</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">E1014</td>
			<td style="width:167px;">DNase</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">ECL Western Blotting Substrate</td>
			<td style="width:113px;">ThermoFisher</td>
			<td style="width:119px;">32106</td>
			<td style="width:167px;">Chemiluminescence</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Premixed LB Broth</td>
			<td style="width:113px;">VWR</td>
			<td style="width:119px;">97064</td>
			<td style="width:167px;">Cell growth medium</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Bovine serum albumin</td>
			<td style="width:113px;">VWR</td>
			<td style="width:119px;">97061-416</td>
			<td style="width:167px;">western blots blocking</td>
		</tr>
	</tbody>
</table>

a facile protocol to generate site-specifically acetylated proteins in escherichia coli

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. Among them, reversible lysine acetylation is one of the most widely distributed in all domains of life. Although numerous mass spectrometry-based acetylome studies have been performed, further characterization of these putative acetylation targets has been limited. One possible reason is that it is difficult to generate purely acetylated proteins at desired positions by most classic biochemical approaches. To overcome this challenge, the genetic code expansion technique has been applied to use the pair of an engineered pyrrolysyl-tRNA synthetase variant, and its cognate tRNA from Methanosarcinaceae species, to direct the cotranslational incorporation of acetyllysine at the specific site in the protein of interest. After first application in the study of histone acetylation, this approach has facilitated acetylation studies on a variety of proteins. In this work, we demonstrated a facile protocol to produce site-specifically acetylated proteins by using the model bacterium Escherichia coli as the host. Malate dehydrogenase was used as a demonstration example in this work.

The yield of acetylated MDH protein was 15 mg per 1 L culture, while that of wild-type MDH was 31 mg per 1 L culture. Purified proteins were analyzed by SDS-PAGE as shown in Figure 1. The wild-type MDH was used as a positive control34. The protein purified from cells harboring the acetyllysine (AcK) incorporation system and the mutant mdh gene, but without AcK in growth media, was used as a negative control. Lysine acetylation...

Watch this Scientific Journal Video about A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli at JoVE.com

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Genetic code expansion serves as a powerful tool to study a wide range of biological processes, including protein acetylation. Here we demonstrate a facile protocol to exploit this technique for generating homogeneously acetylated proteins at specific sites in Escherichia coli cells.

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. ...

Research

JoVE Journal

Immunology and Infection

Using Fluorescent Proteins to Visualize and Quantitate Chlamydia Vacuole Growth Dynamics in Living Cells

Using Fluorescent Proteins to Visualize and Quantitate Chlamydia Vacuole Growth Dynamics in Living Cells

The obligate intracellular bacterium Chlamydia elicits a great burden on global public health. C.&#160;trachomatis is the leading bacterial cause of ...

Non-Invasive Model of Neuropathogenic Escherichia coli Infection in the Neonatal Rat

Non-Invasive Model of Neuropathogenic Escherichia coli Infection in the Neonatal Rat

Investigation of the interactions between animal host and bacterial pathogen is only meaningful if the infection model employed replicates the principal ...

Phage Phenomics: Physiological Approaches to Characterize Novel Viral Proteins

Current investigations into phage-host interactions are dependent on extrapolating knowledge from (meta)genomes. Interestingly, 60 - 95% of all phage ...

One-step Negative Chromatographic Purification of Helicobacter pylori Neutrophil-activating Protein Overexpressed in Escherichia coli in Batch Mode

One-step Negative Chromatographic Purification of Helicobacter pylori Neutrophil-activating Protein Overexpressed in Escherichia coli in Batch Mode

Helicobacter pylori neutrophil-activating protein (HP-NAP) is a major virulence factor of Helicobacter pylori (H. pylori). It plays a critical role in H. ...

A Protocol to Characterize the Morphological Changes of Clostridium difficile in Response to Antibiotic Treatment

A Protocol to Characterize the Morphological Changes of Clostridium difficile in Response to Antibiotic Treatment

Assessment of antibiotic action with new drug development directed towards anaerobic bacteria is difficult and technically demanding. To gain insight into ...

Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

Enterohemorrhagic E. coli (EHEC) O157:H7, which is a foodborne pathogen that causesdiarrhea, hemorrhagic colitis (HS), and hemolytic uremic syndrome ...

Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri

Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri

Transposon mutagenesis is a method that allows gene disruption via the random genomic insertion of a piece of DNA called a transposon. The protocol below ...

Overexpression and Purification of Human Cis-prenyltransferase in Escherichia coli

Overexpression and Purification of Human Cis-prenyltransferase in Escherichia coli

Prenyltransferases (PT) are a group of enzymes that catalyze chain elongation of allylic diphosphate using isopentenyl diphosphate (IPP) via multiple ...

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

Cutaneous antigen-recall models allow for studies of human memory responses in vivo. When combined with skin suction blister (SB) induction, this model ...