이 작품은 NIH (AI119813), 아칸소 대학에서에서 시작 및 아칸소 생명과학 연구소에서 수상에 의해 지원 되었다.

1. 사이트 감독 Mutagenesis 대상 유전자의
참고: MDH T7 발기인 CloDF13 원본 및 복사본 수가 20 ~ 4034 pCDF 1 벡터에서 아래 표시 됩니다.
<ol><li>뇌관에 의해 유전자에 140 위치에서 황색 정지 codon를 소개 (뇌관을 앞으로: GGTGTTTATGAC태그AACAAACTGTTCGGCG 및 뇌관을 역방향: GGCTTTTTTCAGCACTTCAGCAGCAATTGC)의 사이트 지시 된 mutagenesis 키트 명령 다음.</li>
	<li>야생-타입 malate dehydratase의 유전자를 포함 하는 템플릿 플라스 미드를 증폭 하 고 중 합 효소 연쇄 반응 (PCR) 반응에 의해 정지 codon 돌연변이 삽입 합니다. 반응 혼합물에서 포함 2 X DNA 중 합 효소 효소 혼합의 12.5 µ L, 10 µ M 앞으로 뇌관, 10 µ M 역 뇌관의 1.25 µ L, 템플릿 DNA의 1 µ L의 1.25 µ L (20 ng / µ L) (pCDF 1 플라스 미드의 야생-타입 MDH 유전자를 포함), 그리고 9 µ L nuclease 무료 물.<ol>
<li>PCR 반응 매개 변수를 사용 하 여 다음과 같습니다: 30 98 ° C에 변성을 초기 s; 10의 25 주기 98 ° C, 30에서 s s 55 ° C, 및 72 ° C에서 3 분에서 3 분 동안 72 ° C에서 최종 확장. PCR, 후 circularization 및 서식 파일 제거에 대 한 실 온에서 1 h 킷에서 증폭 된 자료 니 리가 DpnI 효소 혼합에 직접 추가 합니다. 참고: 반응 혼합물의 PCR 제품, 반응 버퍼 X 2의 5 µ L, 10 X 키-리가-DpnI 효소 혼합, 1 µ L nuclease 무료 물 3 µ L 1 µ L를 포함합니다.</li>
	</ol>
</li>
	<li>5 µ L 25 µ L의 튜브에 반응 혼합의 유능한 대장균 해 동 추가 키트에서 DH5α 셀. 신중 하 게 혼합, 튜브를 터치 하 고 30 분 열 충격 30 s, 및 추가 5 분 동안 얼음에 42 ° C에 혼합물에 대 한 얼음에 혼합물을 놓습니다.<ol>
<li>혼합물으로 실내 온도 Catabolite 억압 (SOC) 미디어 키트에서와 함께 슈퍼 최적의 국물의 600 µ L를 플라스틱, 250rpm에서 떨고 함께 60 분 동안 37 ° C에서 품 어, 해당 항생제와 lysogeny (파운드)의 국물 한 접시에 100 µ L를 확산 그리고 250 rpm에서 떨고와 37 ° C에서 밤새 품 어.</li>
	</ol>
</li>
	<li>6 mL 신선한 파운드 미디어 해당 항생제로 4-6 한 식민지를 선택 하 고 250 rpm에서 떨고와 하룻밤 37 ° C에서 품 어. 다음 제조 업체의 설명서, 다음 올바른 위치에 정지 codon 돌연변이 확인 하는 서비스 공급자의 프로토콜에 따라 DNA 연속을 위한 송신 플라스 미드 플라스 미드 정화 키트에 의해 각 숙박 문화에서 플라스 미드를 추출 합니다.</li>
	<li>1 mL 하룻밤 문화와 300 µ L 100 %DMSO 혼합 하 여 스트레인-80 ° C에서 올바른 시퀀스를 저장 합니다.</li>
</ol>2입니다. 표현의 Acetylated 단백질
<ol><li>최적화 된 acetyllysyl-tRNA 합성33 의 유전자를 삽입 하 고 최적화 된 tRNAPyl 32 pTech 플라스 미드로. 제정 lpp 발기인에서 tRNA 합성 유전자를 놓습니다. 제정 proK 발기인34에서 tRNA 유전자를 놓습니다.<ol>
<li>공동 변환 식 벡터34 malate 효소의 돌연변이 태그 포함 된 유전자를 포함 하 고 최적화 된 acetyllysine 설립 시스템을 은닉 하는 플라스 미드 25 µ L로 해 동된 유능한 대장균 BL21(DE3) 세포에 의해 10 s, 및 추가 5 분 동안 얼음에 42 ° C에서 열 충격.</li>
		<li>혼합물으로 실내 온도 SOC 미디어의 600 µ L를 플라스틱, 275 rpm 동요와 함께 60 분 동안 37 ° C에서 품 어, 100 µ g/mL 스와 50 µ g/mL 페니, 한 접시에 100 µ L를 확산 그리고 275 rpm에서 떨고와 37 ° C에서 밤새 품 어.</li>
	</ol>
</li>
	<li>접시에서 단 하나 식민지를 선택 하 고 15 mL 신선한 파운드 미디어 100 µ g/mL 스와 250 rpm의 속도로 흔들어 하룻밤 37 ° C에서 50 mL 튜브에 50 µ g/mL 페니로 예방. 1 L 플라스 크에 항생제와 300 mL 신선한 파운드 미디어 15 mL 숙박 문화를 전송 하 고 250 rpm에서 떨고와 37 ° C에서 품 어.</li>
	<li>Acetyllysine 100 m m 재고 솔루션, 4 ° c.에 저장 물으로 분해 흡 광도 600 0.5에 도달 하는 때 성장 매체를 5mm acetyllysine 및 20mm 니코틴 (deacetylases의 억제제)를 추가 nm.<ol>
<li>37 ° c, 250 rpm에서 떨고 추가 1 시간에 대 한 세포 성장 다음 0.5 m m IPTG 단백질 표정, 추가 하 고 180 rpm에서 떨고, 25 ° C에서 세포 성장. 참고: 식 조건이 다른 단백질에 대 한 최적화를 할 수 있습니다.</li>
	</ol>
</li>
	<li>15 분 동안 4 ° C에서 3000 x g에서 centrifuging 여 세포를 수집 하 고 상쾌한, 삭제 셀 인산 염 버퍼 식 염 수 (PBS) 버퍼 (10 m m 나2HPO4, 1.8 m m KH2포4, 137 m m NaCl, 2.7 m m KCl)와 펠 릿을 세척. 5 분 동안 4 ° C에서 10000 x g에서 씻어 세포를 수집, 상쾌한, 삭제 및 셀 알 약-80 ° c.에 저장</li>
</ol>3입니다. Acetylated 단백질의 정화
<ol><li>얼음, 냉동된 셀 펠 릿을 녹여 그리고 다시 (50 mM tris (hydroxymethyl) aminomethane (Tris) pH 7.8, 300 mM NaCl, 20mm 이미, 그리고 20mm 니코틴아미드), 세포의 용 해 버퍼의 15 mL와 β-mercaptoethanol와 1 µ L Benzonase nuclease (250 대)의 5 µ L 일시 중단.</li>
	<li>40 kHz 쥡니다 70% 파워 10 사이클 간격 30 다음 10 s 짧은 파열의 출력에 의해 세포를 휴식 양식 원유 추출에 대 한 s. 4 ° c.에 25 분 20000 x g에서 원심 분리기 원유 추출 상쾌한 0.45 μ 막 필터를 필터링 하 고 니켈 nitrilotriacetic 산 (Ni-NTA) 수 지 물과 세포의 용 해 버퍼의 20 mL 20 mL와 equilibrated의 1 mL를 포함 하는 열에 로드 합니다. 참고: 쥡니다 사용할 수 없는 경우에 셀 온화한 세제에 의해 깨진 수 있습니다.</li>
	<li>20 mL (50 mM Tris pH 7.8, 300 mM NaCl, 50mm 이미, 및 20 m m 니코틴아미드) 워시 버퍼의 열 세척 하 고의 차입 버퍼 (50 mM Tris pH 7.8, 300 mM NaCl, 150mm 이미, 및 20 m m 니코틴아미드) 2 mL와 함께 elute.</li>
	<li>제조업체의 설명서에 따라 PD-10 열 버퍼 (25mm Tris pH 7.8와 10 mM NaCl) 담와 차입 분수 desalt. Bradford 단백질 분석 실험 시 약의 지시에 따라 eluted 단백질의 농도 측정 합니다. Desalted 단백질은 추가 실험을 위한 준비 이다. 참고: 단백질의 50% 글리세롤 재고 확인 하 고 저장을 위한-80 ° C에서 유지.</li>
</ol>4. 생 화 확 적인 특성 Acetylated 단백질의
<ol><li>
SDS 페이지 및 질량 분석 분석입니다.
	<ol>
<li>나트륨 라우릴 황산 염 (SDS) 샘플 버퍼 (SDS 샘플 버퍼 X 2 µ L 4와 5 µ L 단백질 견본) 5 분 동안 105 ° C에서 2 mL 튜브와 단백질 변성, 2000 x g 10에서 혼합물을 원심 s, 4-20% 나트륨 라우릴 황산 polyacrylamide 젤 electroph에 로드 oresis (SDS-PAGE) 젤, 고 200 V 30 분 실행 합니다.</li>
		<li>증류수와 젤을 세척 하 고 3 번 과정을 반복 5 분 동안 부드럽게 흔들어. 물, 삭제 하 고 젤 부드러운 동요와 1 h Coomassie 파란 얼룩과 얼룩. 증류수와 젤 드 얼룩, 30 분, 그리고 반복이 드 3 번 얼룩에 부드럽게 흔들어.</li>
		<li>Coomassie 파란 얼룩이 SDS 페이지 젤에 33 kDa에 밴드를 잘라내어 질량 분석 시설 또는 회사는 acetyllysine 디자인 된 위치에서 통합 되었다 확인 하. 참고: 질량 분석 분석의 프로토콜은 이전 실험34을 따 랐 다.</li>
	</ol>
</li>
	<li>
서 부 럽
	<ol>
<li>4.1 단계에서 동일한 프로토콜 SDS 페이지 젤을 실행 합니다. 실행 젤, 후 15 분에 대 한 전송 버퍼 (25mm Tris, 192 m m 글리신, pH 8.3 및 20% 메탄올) 젤을 담근 다.</li>
		<li>0.2 µ m, 1 분에 대 한 메탄올을 가진 7 cm x 8.5 c m polyvinylidene difluoride (PVDF) 막 활성화 되 고 전송 샌드위치를 준비 하기 전에 전송 버퍼와 린스. 참고: 메탄올은 피부 접촉, 눈 접촉, 섭취, 또는 흡입 위험. 심한 노출은 죽음에 발생할 수 있습니다.</li>
		<li>음극에서 양극 (스폰지 필터 종이, SDS 페이지 젤, PVDF 막, 필터 종이, 스폰지)에 전송 샌드위치를 확인 합니다. 스택의 350의 정 전류에서 실행 전송 탱크에 넣어 45 분 mA. 참고: 전송 시간 최적화를 할 수 있습니다.</li>
		<li>씻어 25 mL Tris 버퍼 식 염 수, 0.1 %PVDF 막 트윈 20 (TBST) (137 m m NaCl, 20 mM Tris, 0.1% 트윈 20, pH 7.6) 부드러운 떨고와 5 분에 대 한 버퍼. 5% 소 혈 청 알 부 민 (BSA) 실 온에서 1 h TBST 버퍼에서와 막을 차단 합니다.</li>
		<li>HRP 활용 된 acetyllysine-항 체로 부드러운 떨고와 하룻밤 4 ° C에서 5% BSA TBST에 희석 1 µ g/mL의 최종 농도와 막 품 어. 참고: 빠른 결과 위해 1 시간 실 온에서이 단계를 수행 수 있습니다. 항 체의 희석 최적화를 할 수 있습니다.</li>
		<li>부드러운 진동으로 5 분 동안 20 mL TBST 버퍼와 막 씻어 4 번 단계를 반복. 제조업체의 지침에 따라 화학 기질 막에 적용 합니다. 와 전 하 결합 소자 (CCD) 카메라 기반 영상 신호를 캡처.</li>
	</ol>
</li>
</ol>

<ol>
	<li>Krishna, R. G., Wold, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Post-translational+modification+of+proteins.">Post-translational modification of proteins.</a> Adv Enzymol Relat Areas Mol Biol. 67, 265-298 (1993).</li><li>Lothrop, A. P., Torres, M. P., Fuchs, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deciphering+post-translational+modification+codes.">Deciphering post-translational modification codes.</a> FEBS Lett. 587 (8), 1247-1257 (2013).</li><li>Walsh, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Posttranslational modification of proteins : expanding nature's inventory. , (2006).</li><li>Khoury, G. A., Baliban, R. C., Floudas, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteome-wide+post-translational+modification+statistics:+frequency+analysis+and+curation+of+the+swiss-prot+database.">Proteome-wide post-translational modification statistics: frequency analysis and curation of the swiss-prot database.</a> Sci Rep. 1, (2011).</li><li>Grotenbreg, G., Ploegh, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+biology:+dressed-up+proteins.">Chemical biology: dressed-up proteins.</a> Nature. 446 (7139), 993-995 (2007).</li><li>Arif, M., Selvi, B. R., Kundu, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+acetylation:+the+tale+of+a+modification+from+transcription+regulation+to+metabolism.">Lysine acetylation: the tale of a modification from transcription regulation to metabolism.</a> Chembiochem. 11 (11), 1501-1504 (2010).</li><li>Cohen, T., Yao, T. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=AcK-knowledge+reversible+acetylation.">AcK-knowledge reversible acetylation.</a> Science's STKE : signal transduction knowledge environment. (245), pe42 (2004).</li><li>Drazic, A., Myklebust, L. M., Ree, R., Arnesen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+world+of+protein+acetylation.">The world of protein acetylation.</a> Biochim Biophys Acta. 1864 (10), 1372-1401 (2016).</li><li>Escalante-Semerena, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N&#949;-acetylation+control+conserved+in+all+three+life+domains.">N&#949;-acetylation control conserved in all three life domains.</a> Microbe. 5, 340-344 (2010).</li><li>Kouzarides, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation:+a+regulatory+modification+to+rival+phosphorylation?.">Acetylation: a regulatory modification to rival phosphorylation?.</a> The EMBO journal. 19 (6), 1176-1179 (2000).</li><li>Soppa, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+acetylation+in+archaea,+bacteria,+and+eukaryotes.">Protein acetylation in archaea, bacteria, and eukaryotes.</a> Archaea. , (2010).</li><li>Verdin, E., Ott, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=50+years+of+protein+acetylation:+from+gene+regulation+to+epigenetics,+metabolism+and+beyond.">50 years of protein acetylation: from gene regulation to epigenetics, metabolism and beyond.</a> Nat Rev Mol Cell Biol. 16 (4), 258-264 (2015).</li><li>Allfrey, V. G., Faulkner, R., Mirsky, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+and+Methylation+of+Histones+and+Their+Possible+Role+in+the+Regulation+of+Rna+Synthesis.">Acetylation and Methylation of Histones and Their Possible Role in the Regulation of Rna Synthesis.</a> P Natl Acad Sci USA. 51, 786-794 (1964).</li><li>Phillips, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+presence+of+acetyl+groups+of+histones.">The presence of acetyl groups of histones.</a> Biochem j. 87, 258-263 (1963).</li><li>Sterner, D. E., Berger, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+of+histones+and+transcription-related+factors.">Acetylation of histones and transcription-related factors.</a> Microbiology and molecular biology reviews: MMBR. 64 (2), 435-459 (2000).</li><li>Glozak, M. A., Sengupta, N., Zhang, X., Seto, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+and+deacetylation+of+non-histone+proteins.">Acetylation and deacetylation of non-histone proteins.</a> Gene. 363, 15-23 (2005).</li><li>Close, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+emerging+role+of+lysine+acetylation+of+non-nuclear+proteins.">The emerging role of lysine acetylation of non-nuclear proteins.</a> Cell Mol Life Sci. 67 (8), 1255-1264 (2010).</li><li>Iyer, A., Fairlie, D. P., Brown, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+acetylation+in+obesity,+diabetes+and+metabolic+disease.">Lysine acetylation in obesity, diabetes and metabolic disease.</a> Immunol Cell Biol. 90 (1), 39-46 (2012).</li><li>You, L., Nie, J., Sun, W. J., Zheng, Z. Q., Yang, X. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+acetylation:+enzymes,+bromodomains+and+links+to+different+diseases.">Lysine acetylation: enzymes, bromodomains and links to different diseases.</a> Essays Biochem. 52, 1-12 (2012).</li><li>Bonnaud, E. M., Suberbielle, E., Malnou, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+acetylation+in+neuronal+(dys)function.">Histone acetylation in neuronal (dys)function.</a> Biomol Concepts. 7 (2), 103-116 (2016).</li><li>Fukushima, A., Lopaschuk, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+control+of+cardiac+fatty+acid+beta-oxidation+and+energy+metabolism+in+obesity,+diabetes,+and+heart+failure.">Acetylation control of cardiac fatty acid beta-oxidation and energy metabolism in obesity, diabetes, and heart failure.</a> Biochim Biophys Acta. 1862 (12), 2211-2220 (2016).</li><li>Kaypee, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aberrant+lysine+acetylation+in+tumorigenesis:+Implications+in+the+development+of+therapeutics.">Aberrant lysine acetylation in tumorigenesis: Implications in the development of therapeutics.</a> Pharmacol Ther. 162, 98-119 (2016).</li><li>Tapias, A., Wang, Z. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+Acetylation+and+Deacetylation+in+Brain+Development+and+Neuropathies.">Lysine Acetylation and Deacetylation in Brain Development and Neuropathies.</a> Genomics Proteomics Bioinformatics. 15 (1), 19-36 (2017).</li><li>Hu, L. I., Lima, B. P., Wolfe, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+protein+acetylation:+the+dawning+of+a+new+age.">Bacterial protein acetylation: the dawning of a new age.</a> Molecular microbiology. 77 (1), 15-21 (2010).</li><li>Jones, J. D., O'Connor, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+acetylation+in+prokaryotes.">Protein acetylation in prokaryotes.</a> Proteomics. 11 (15), 3012-3022 (2011).</li><li>Bernal, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+bacterial+physiology+by+lysine+acetylation+of+proteins.">Regulation of bacterial physiology by lysine acetylation of proteins.</a> New biotechnol. 31 (6), 586-595 (2014).</li><li>Hentchel, K. L., Escalante-Semerena, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acylation+of+Biomolecules+in+Prokaryotes:+a+Widespread+Strategy+for+the+Control+of+Biological+Function+and+Metabolic+Stress.">Acylation of Biomolecules in Prokaryotes: a Widespread Strategy for the Control of Biological Function and Metabolic Stress.</a> Microbiology and molecular biology reviews : MMBR. 79 (3), 321-346 (2015).</li><li>Ouidir, T., Kentache, T., Hardouin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+lysine+acetylation+in+bacteria:+Current+state+of+the+art.">Protein lysine acetylation in bacteria: Current state of the art.</a> Proteomics. 16 (2), 301-309 (2016).</li><li>Wolfe, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+protein+acetylation:+new+discoveries+unanswered+questions.">Bacterial protein acetylation: new discoveries unanswered questions.</a> Curr Genet. 62 (2), 335-341 (2016).</li><li>Albaugh, B. N., Arnold, K. M., Lee, S., Denu, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autoacetylation+of+the+histone+acetyltransferase+Rtt109.">Autoacetylation of the histone acetyltransferase Rtt109.</a> J Biol Chem. 286 (28), 24694-24701 (2011).</li><li>Neumann, H., Peak-Chew, S. Y., Chin, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+encoding+N&#949;-acetyllysine+in+recombinant+proteins.">Genetically encoding N&#949;-acetyllysine in recombinant proteins.</a> Nat chem biol. 4 (4), 232-234 (2008).</li><li>Fan, C., Xiong, H., Reynolds, N. M., Soll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rationally+evolving+tRNAPyl+for+efficient+incorporation+of+noncanonical+amino+acids.">Rationally evolving tRNAPyl for efficient incorporation of noncanonical amino acids.</a> Nucleic Acids Res. 43 (22), e156 (2015).</li><li>Bryson, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Continuous+directed+evolution+of+aminoacyl-tRNA+synthetases+to+alter+amino+acid+specificity+and+enhance+activity.">Continuous directed evolution of aminoacyl-tRNA synthetases to alter amino acid specificity and enhance activity.</a> Nat Chem Biol. , (2017).</li><li>Venkat, S., Gregory, C., Sturges, J., Gan, Q., Fan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studying+the+Lysine+Acetylation+of+Malate+Dehydrogenase.">Studying the Lysine Acetylation of Malate Dehydrogenase.</a> J Mol Biol. 429 (9), 1396-1405 (2017).</li><li>Venkat, S., Gregory, C., Gan, Q., Fan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+characterization+of+the+lysine+acetylation+of+tyrosyl-tRNA+synthetase+in+Escherichia+coli.">Biochemical characterization of the lysine acetylation of tyrosyl-tRNA synthetase in Escherichia coli.</a> Chembiochem. 18 (19), 1928-1934 (2017).</li><li>Liu, C. C., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adding+new+chemistries+to+the+genetic+code.">Adding new chemistries to the genetic code.</a> Annu Rev Biochem. 79, 413-444 (2010).</li><li>Mukai, T., Lajoie, M. J., Englert, M., Soll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rewriting+the+Genetic+Code.">Rewriting the Genetic Code.</a> Annu Rev Microbiol. , (2017).</li><li>O'Donoghue, P., Ling, J., Wang, Y. S., Soll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Upgrading+protein+synthesis+for+synthetic+biology.">Upgrading protein synthesis for synthetic biology.</a> Nat Chem Biol. 9 (10), 594-598 (2013).</li><li>Chin, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expanding+and+reprogramming+the+genetic+code+of+cells+and+animals.">Expanding and reprogramming the genetic code of cells and animals.</a> Annu Rev Biochem. 83, 379-408 (2014).</li><li>O'Donoghue, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Near-cognate+suppression+of+amber,+opal+and+quadruplet+codons+competes+with+aminoacyl-tRNAPyl+for+genetic+code+expansion.">Near-cognate suppression of amber, opal and quadruplet codons competes with aminoacyl-tRNAPyl for genetic code expansion.</a> FEBS Lett. 586 (21), 3931-3937 (2012).</li><li>Aerni, H. R., Shifman, M. A., Rogulina, S., O'Donoghue, P., Rinehart, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Revealing+the+amino+acid+composition+of+proteins+within+an+expanded+genetic+code.">Revealing the amino acid composition of proteins within an expanded genetic code.</a> Nucleic Acids Res. 43 (2), e8 (2015).</li><li>Huang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+convenient+method+for+genetic+incorporation+of+multiple+noncanonical+amino+acids+into+one+protein+in+Escherichia+coli.">A convenient method for genetic incorporation of multiple noncanonical amino acids into one protein in Escherichia coli.</a> Mol Biosyst. 6 (4), 683-686 (2010).</li><li>Venkat, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+encoding+thioacetyl-lysine+as+a+nondeacetylatable+analog+of+lysine+acetylation+in+Escherichia+coli.">Genetically encoding thioacetyl-lysine as a nondeacetylatable analog of lysine acetylation in Escherichia coli.</a> FEBS Open. , (2017).</li><li>Wan, W., Tharp, J. M., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysyl-tRNA+synthetase:+an+ordinary+enzyme+but+an+outstanding+genetic+code+expansion+tool.">Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool.</a> Biochim Biophys Acta. 1844 (6), 1059-1070 (2014).</li><li>Gregoretti, I. V., Lee, Y. M., Goodson, H. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+evolution+of+the+histone+deacetylase+family:+functional+implications+of+phylogenetic+analysis.">Molecular evolution of the histone deacetylase family: functional implications of phylogenetic analysis.</a> J Mol Biol. 338 (1), 17-31 (2004).</li><li>Weinert, B. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetyl-phosphate+is+a+critical+determinant+of+lysine+acetylation+in+E.+coli.">Acetyl-phosphate is a critical determinant of lysine acetylation in E. coli.</a> Mol cell. 51 (2), 265-272 (2013).</li></ol>

저자는 공개 없다.

비정규 아미노산 (ncAAs)의 유전 결합 ncAA 청구 tRNA에 의해 할당 된 codon, 주로는 황색 정지 codon UAG36,37,38,39의 억제에 기반 해당 anticodon 포함 하. UAG codon 릴리스 요소-1 (RF1) 박테리아에 의해 인식 된다로 알려져 있다 그리고 그것은 또한 억제할 수 있습니다 의해 정식 아미노산 (cAAs)로 청구 하는 호스트에?...

포스트 번역 상 수정 (PTMs) 단백질의 번역 과정 후 발생 하 고 공유 추가 기능 그룹에서 발생 하는 아미노산 잔류물, 유전자를 포함 하 여 거의 모든 생물 학적 과정에 중요 한 역할을 재생을 전사, 스트레스 반응, 세포 분화, 및 물질 대사1,2,3 날짜 하려면, 약 400 독특한 PTMs 확인된4되었습니다. 게놈과는 프로테옴의 intricacy는 단백질 PTMs로 대부분 증폭 단백질 활동 및 지역화, 고 단백질, 핵 산, 지질, 및 공동 인자5등 다른 분자와 상호 작용에 영향을 미칠.
단백질 acetylation 지난 2 년간6,7,,89,10,11,12PTMs 연구의 최전선에 왔다. Lysine acetylation 처음 발견 되었다 히스톤에 이상의 50 년 전13,14은 잘 조사 되어, 80 개 이상의 녹음 방송 요인, 레 귤 레이 터, 및 다양 한 단백질15에 알려져 있다 16,17. 단백질 acetylation에 대 한 연구 뿐만 아니라, 규제 메커니즘의 깊은 이해를 제공 하지만 다양 한 역 기능 acetylation18,19, 로 인 한 질병에 대 한 치료 가이드 20 , 21 , 22 , 23. lysine acetylation 진핵생물에서 발생 하지만 최근 연구는 단백질 acetylation 또한 세균 생리학, chemotaxis, 내 산 성, 활성화 및 안정화를 포함 하 여 주요 역할 재생 믿어 pathogenicity 섬과 다른 독성 단백질24,25,26,27,,2829관련.
Lysine acetylation 화학적 특성을 일반적으로 사용 되는 방법은 사이트 지시 된 mutagenesis 사용 하는. 글루타민은 비슷한 크기와 극성 때문에 acetyllysine의 모방으로 사용 됩니다. 아르기닌은 생리 적인 조건 하에서 그것의 긍정적인 요금을 유지 하지만 acetylated 수 없습니다 비 acetylated lysine 모방으로 활용 됩니다. 그러나, 두 모방 하지 진짜 isosteres 이며 항상 예상된 결과30를 생성 하지 않습니다. 가장 엄격한 접근은 어렵거나 lysine acetylation 자연7,11의 낮은 산출할 인해 가장 고전적인 방법에 대 한 특정 리 진 잔류물에 균질 acetylated 단백질을 생성 하는 것입니다. 이 문제는 설계 pyrrolysyl-tRNA 합성을 사용 하 여 유전자 코드 확장 전략에 의해 unraveled 되었습니다 tRNA 충전 Methanosarcinaceae 종에서 벗어나 acetyllysine와Pyl 활용 호스트 변환 기계는 UAG를 억제 하는 mRNA에 codon를 중지 하 고 대상 단백질31의 설계 위치에 acetyllysine의 지휘. 최근에, 우리는 향상 된 EF-부 엉-바인딩 tRNA32 와 업그레이드 된 acetyllysyl-tRNA 합성33이 시스템을 최적화 했습니다. 또한, 우리는 malate 효소34 와 tyrosyl-tRNA 합성35의 acetylation 연구에서이 향상 된 통합 시스템을 적용 했습니다. 여기, 우리가 우리가 광범위 하 게 실증 사례로 공부 malate 효소 (MDH)를 사용 하 여 생화학 식별 분자 클로닝에서 순전히 acetylated 단백질을 생성 하기 위한 프로토콜을 보여 줍니다.

<table><tbody><tr><td>Bradford protein assay</td><td>Bio-Rad</td><td>5000006</td><td>Protein concentration</td></tr><tr><td>4x Laemmli Sample Buffer</td><td>Bio-Rad</td><td>1610747</td><td>SDS sample buffer</td></tr><tr><td>Coomassie G-250 Stain</td><td>Bio-Rad</td><td>1610786</td><td>SDS-PAGE gel staining</td></tr><tr><td>4-20% SDS-PAGE ready gel</td><td>Bio-Rad</td><td>4561093</td><td>Protein determination</td></tr><tr><td>Ac-K-100 (HRP Conjugate)</td><td>Cell Signaling</td><td>6952</td><td>Antibody</td></tr><tr><td>IPTG</td><td>CHEM-IMPEX</td><td>194</td><td>Expression inducer</td></tr><tr><td>N&lt;sup&gt;&amp;epsilon;&lt;/sup&gt;-Acetyl-L-lysine</td><td>CHEM-IMPEX</td><td>5364</td><td>Noncanonical amino acid</td></tr><tr><td>PD-10 desalting column</td><td>GE Healthcare</td><td>17085101</td><td>Desalting</td></tr><tr><td>Q5 Site-Directed Mutagenesis Kit</td><td>NEB</td><td>E0554</td><td>Introducing the stop codon</td></tr><tr><td>BL21 (DE3) cells</td><td>NEB</td><td>C2527</td><td>Expressing strain</td></tr><tr><td>QIAprep Spin Miniprep Kit</td><td>QIAGEN</td><td>27106</td><td>Extracting plasmids</td></tr><tr><td>Ni-NTA resin</td><td>QIAGEN</td><td>30210</td><td>Affinity purification resin</td></tr><tr><td>nicotinamide</td><td>Sigma-Aldrich</td><td>N3376</td><td>Deacetylase inhibitor</td></tr><tr><td>&amp;beta;-Mercaptoethanol</td><td>Sigma-Aldrich</td><td>M6250</td><td>Reducing agent</td></tr><tr><td>BugBuster Protein Extraction Reagent</td><td>Sigma-Aldrich</td><td>70584</td><td>Breaking cells</td></tr><tr><td>Benzonase nuclease</td><td>Sigma-Aldrich</td><td>E1014</td><td>DNase</td></tr><tr><td>ECL Western Blotting Substrate</td><td>ThermoFisher</td><td>32106</td><td>Chemiluminescence</td></tr><tr><td>Premixed LB Broth</td><td>VWR</td><td>97064</td><td>Cell growth medium</td></tr><tr><td>Bovine serum albumin</td><td>VWR</td><td>97061-416</td><td>western blots blocking</td></tr></tbody></table>

a facile protocol to generate site-specifically acetylated proteins in escherichia coli

포스트 번역 상 수정 단백질의 특정 위치에서 발생 하는 다양 한 세포질 프로세스에서에서 중요 한 역할을 보여왔다. 그 중, 가역 lysine acetylation 생활의 모든 영역에서 가장 넓게 분배 된 중 하나입니다. 수많은 acetylome 질량 분석 기반 연구를 수행 하는 있지만 더이 상 상속 acetylation 대상의 제한 되었습니다. 가능한 이유 하나 대부분 클래식 생 화 확 적인 방법에 의해 원하는 위치에 순전히 acetylated 단백질을 생성 하기 어렵습니다. 이 문제를 해결 하려면 유전자 코드 확장 기술 cotranslational 설립을 직접 설계 pyrrolysyl-tRNA 합성 변종, Methanosarcinaceae 종에서 그것의 동족 tRNA의 쌍을 사용 하 여 적용 된 관심사의 단백질에 특정 사이트에 acetyllysine의. Histone acetylation의 연구에서 첫 번째 응용 프로그램, 후이 이렇게 다양 한 단백질에 acetylation 연구 촉진 했다. 이 작품에서는, 우리는 호스트 모델 박테리아 대장균 을 사용 하 여 site-specifically acetylated 단백질을 생산 하는 손쉬운 프로토콜을 증명 하고있다. Malate 효소는이 작품에서 데모 예제로 사용 되었습니다.

야생-타입 MDH 그건 1 L 문화 당 31 mg acetylated MDH 단백질의 수익률 1 L 문화, 당 15 밀리 그램 이었다. 그림 1에서 보듯이 순화 된 단백질 SDS-PAGE로 분석 되었다. 야생-타입 MDH 긍정적인 제어34로 사용 되었다. 성장 매체에서 acetyllysine (AcK) 설립 시스템 및 돌연변이 mdh 유전자를 은닉 하는 세포에서 하지만 AcK 없이 순화 하는 단백질은 ...

Watch this Scientific Journal Video about A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli at JoVE.com

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

유전자 코드 확장 acetylation 단백질을 포함 한 생물 학적 과정의 넓은 범위를 공부 하는 강력한 도구 역할을 합니다. 여기 균질 생성 하기 위한이 기술을 악용 하는 손쉬운 프로토콜 acetylated 단백질 대장균 세포에 특정 사이트에 설명 합니다.

Site-Specifically 생성 하는 손쉬운 프로토콜 Acetylated 대장균 에서 단백질

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. ...

a-facile-protocol-to-generate-site-specifically-acetylated-proteins

Research

JoVE Journal

Immunology and Infection

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

6.8K 조회수.  University of Arkansas. 유전자 코드 확장 acetylation 단백질을 포함 한 생물 학적 과정의 넓은 범위를 공부 하는 강력한 도구 역할을 합니다. 여기 균질 생성 하기 위한이 기술을 악용 하는 손쉬운 프로토콜 acetylated 단백질 대장균 세포에 특정 사이트에 설명 합니다.

비디오: A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Efficient and Site-specific Antibody Labeling by Strain-promoted Azide-alkyne Cycloaddition

There are currently many chemical tools available to introduce chemical probes into proteins to study their structure and function. A useful method is protein conjugation by genetically introducing an unnatural amino acid containing a bioorthogonal functional group. This report describes a detailed protocol for site-specific antibody conjugation. The protocol includes experimental details for the genetic incorporation of an azide-containing amino acid, and the conjugation reaction by strain-promoted azide-alkyne cycloaddition (SPAAC). This strain-promoted reaction proceeds by simple mixing of the reacting molecules at physiological pH and temperature, and does not require additional reagents such as copper(I) ions and copper-chelating ligands. Therefore, this method would be useful for general protein conjugation and development of antibody drug conjugates (ADCs).

Here, we present a protocol to site-specifically introduce chemical probes into an antibody fragment by genetically incorporating an azide-containing amino acid, and subsequently coupling the azide with a chemical probe by strain-promoted azide-alkyne cycloaddition (SPAAC).

효율적이고 사이트 별 스트레인 승진 아 지드 - 알킨 사이클로에 의해 항체 라벨링

There are currently many chemical tools available to introduce chemical probes into proteins to study their structure and function. A useful method is ...

연구

생화학

Deacetylation Assays to Unravel the Interplay between Sirtuins (SIRT2) and Specific Protein-substrates

Acetylation has emerged as an important post-translational modification (PTM) regulating a plethora of cellular processes and functions. This is further supported by recent findings in high-resolution mass spectrometry based proteomics showing that many new proteins and sites within these proteins can be acetylated. However the identity of the enzymes regulating these proteins and sites is often unknown. Among these enzymes, sirtuins, which belong to the class III histone lysine deacetylases, have attracted great interest as enzymes regulating the acetylome under different physiological or pathophysiological conditions. Here we describe methods to link SIRT2, the cytoplasmic sirtuin, with its substrates including both in vitro and in vivo deacetylation assays. These assays can be applied in studies focused on other members of the sirtuin family to unravel the specific role of sirtuins and are necessary in order to establish the regulatory interplay of specific deacetylases with their substrates as a first step to better understand the role of protein acetylation. Furthermore, such assays can be used to distinguish functional acetylation sites on a protein from what may be non-regulatory acetylated lysines, as well as to examine the interplay between a deacetylase and its substrate in a physiological context.

Deacetylation Assays to Unravel the Interplay between Sirtuins SIRT2 and Specific Protein-substrates

This protocol describes the required steps to execute in vitro and in vivo deacetylation assays in order to establish the role of proteins as specific deacetylation substrates for sirtuins and further study the role of reversible - lysine acetylation as a post-translational modification.

탈 아세틸 화 분석법은 시르 투 인 사이의 상호 작용 (SIRT2) 및 특정 단백질 기판을 해명

Acetylation has emerged as an important post-translational modification (PTM) regulating a plethora of cellular processes and functions. This is further ...

화학

Expression, Isolation, and Purification of Soluble and Insoluble Biotinylated Proteins for Nerve Tissue Regeneration

Recombinant protein engineering has utilized Escherichia coli (E. coli) expression systems for nearly 4 decades, and today E. coli is still the most widely used host organism. The flexibility of the system allows for the addition of moieties such as a biotin tag (for streptavidin interactions) and larger functional proteins like green fluorescent protein or cherry red protein. Also, the integration of unnatural amino acids like metal ion chelators, uniquely reactive functional groups, spectroscopic probes, and molecules imparting post-translational modifications has enabled better manipulation of protein properties and functionalities. As a result this technique creates customizable fusion proteins that offer significant utility for various fields of research. More specifically, the biotinylatable protein sequence has been incorporated into many target proteins because of the high affinity interaction between biotin with avidin and streptavidin. This addition has aided in enhancing detection and purification of tagged proteins as well as opening the way for secondary applications such as cell sorting. Thus, biotin-labeled molecules show an increasing and widespread influence in bioindustrial and biomedical fields. For the purpose of our research we have engineered recombinant biotinylated fusion proteins containing nerve growth factor (NGF) and semaphorin3A (Sema3A) functional regions. We have reported previously how these biotinylated fusion proteins, along with other active protein sequences, can be tethered to biomaterials for tissue engineering and regenerative purposes. This protocol outlines the basics of engineering biotinylatable proteins at the milligram scale, utilizing&#160; a T7 lac inducible vector and E. coli expression hosts, starting from transformation to scale-up and purification.

Developing biotinylatable fusion proteins has many potential applications in various fields of research. Recombinant protein engineering is a straight forward procedure that is cost-effective, providing high yields of custom-designed proteins.

신경 조직의 재생을위한 가용성 및 불용성 바이오틴 단백질의 발현, 분리 및 정제

Recombinant protein engineering has utilized Escherichia coli (E. coli) expression systems for nearly 4 decades, and today E. coli is still the most ...

생체공학

Monitoring the Assembly of a Secreted Bacterial Virulence Factor Using Site-specific Crosslinking

This article describes a method to detect and analyze dynamic interactions between a protein of interest and other factors in vivo. Our method is based on the amber suppression technology that was originally developed by Peter Schultz and colleagues1. An amber mutation is first introduced at a specific codon of the gene encoding the protein of interest. The amber mutant is then expressed in E. coli together with genes encoding an amber suppressor tRNA and an amino acyl-tRNA synthetase derived from Methanococcus jannaschii. Using this system, the photo activatable amino acid analog p-benzoylphenylalanine (Bpa) is incorporated at the amber codon. Cells are then irradiated with ultraviolet light to covalently link the Bpa residue to proteins that are located within 3-8 &#197;. Photocrosslinking is performed in combination with pulse-chase labeling and immunoprecipitation of the protein of interest in order to monitor changes in protein-protein interactions that occur over a time scale of seconds to minutes. We optimized the procedure to study the assembly of a bacterial virulence factor that consists of two independent domains, a domain that is integrated into the outer membrane and a domain that is translocated into the extracellular space, but the method can be used to study many different assembly processes and biological pathways in both prokaryotic and eukaryotic cells. In principle interacting factors and even specific residues of interacting factors that bind to a protein of interest can be identified by mass spectrometry.

This article illustrates the use of pulse-chase radio labeling in combination with site-specific photocrosslinking to monitor interactions between a protein of interest and other factors in E. coli. Unlike traditional chemical cross-linking methods, this approach generates high resolution &#8220;snapshots&#8221; of an ordered assembly pathway in a living cell.

This article describes a method to detect and analyze dynamic interactions between a protein of interest and other factors in vivo. Our method is based on ...

면역학 및 감염병학

Escherichia coli-Based Cell-Free Protein Synthesis: Protocols for a robust, flexible, and accessible platform technology

Over the last 50 years, Cell-Free Protein Synthesis (CFPS) has emerged as a powerful technology to harness the transcriptional and translational capacity of cells within a test tube. By obviating the need to maintain the viability of the cell, and by eliminating the cellular barrier, CFPS has been foundational to emerging applications in biomanufacturing of traditionally challenging proteins, as well as applications in rapid prototyping for metabolic engineering, and functional genomics. Our methods for implementing an E. coli-based CFPS platform allow new users to access many of these applications. Here, we describe methods to prepare extract through the use of enriched media, baffled flasks, and a reproducible method of tunable sonication-based cell lysis. This extract can then be used for protein expression capable of producing 900 &#181;g/mL or more of super folder green fluorescent protein (sfGFP) in just 5 h from experimental setup to data analysis, given that appropriate reagent stocks have been prepared beforehand. The estimated startup cost of obtaining reagents is $4,500 which will sustain thousands of reactions at an estimated cost of $0.021 per &#181;g of protein produced or $0.019 per &#181;L of reaction. Additionally, the protein expression methods mirror the ease of the reaction setup seen in commercially available systems due to optimization of reagent pre-mixes, at a fraction of the cost. In order to enable the user to leverage the flexible nature of the CFPS platform for broad applications, we have identified a variety of aspects of the platform that can be tuned and optimized depending on the resources available and the protein expression outcomes desired.

Escherichia coli-Based Cell-Free Protein Synthesis: Protocols for a robust, flexible, and accessible platform technology

This protocol details the steps, costs, and equipment necessary to generate E. coli-based cell extracts and implement in vitro protein synthesis reactions within 4 days or less. To leverage the flexible nature of this platform for broad applications, we discuss reaction conditions that can be adapted and optimized.

대장균-셀 무료 단백질 합성 기반: 강력 하 고 유연 하며 액세스할 수 있는 플랫폼 기술에 대 한 프로토콜

Over the last 50 years, Cell-Free Protein Synthesis (CFPS) has emerged as a powerful technology to harness the transcriptional and translational capacity ...

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Acetylated histone proteins can be easily expressed in Escherichia coli encoding a mutant, N&#949;-acetyl-lysine (AcK)-specific Methanosarcina mazi pyrrolysine tRNA-synthetase (MmAcKRS1) and its cognate tRNA (tRNAPyl) to assemble reconstituted mononucleosomes with site specific acetylated histones. MmAcKRS1 and tRNAPyl deliver AcK at an amber mutation site in the mRNA of choice during translation in Escherichia coli. This technique has been used extensively to incorporate AcK at H3 lysine sites. Pyrrolysyl-tRNA synthetase (PylRS) can also be easily evolved to incorporate other noncanonical amino acids (ncAAs) for site specific protein modification or functionalization. Here we detail a method to incorporate AcK using the MmAcKRS1 system into histone H3 and integrate acetylated H3 proteins into reconstituted mononucleosomes. Acetylated reconstituted mononucleosomes can be used in biochemical and binding assays, structure determination, and more. Obtaining modified mononucleosomes is crucial for designing experiments related to discovering new interactions and understanding epigenetics.

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Here we present a method to express acetylated histone proteins using genetic code expansion and assemble reconstituted nucleosomes in vitro.

에체리치아 대장균의 유전코드 확장을 이용한 뉴클레오소성 재구성을 위한 히스톤의 특정 리신 아세틸화

Acetylated histone proteins can be easily expressed in Escherichia coli encoding a mutant, N&#949;-acetyl-lysine (AcK)-specific Methanosarcina mazi ...

Engineering 'Golden' Fluorescence by Selective Pressure Incorporation of Non-canonical Amino Acids and Protein Analysis by Mass Spectrometry and Fluorescence

Fluorescent proteins are fundamental tools for the life sciences, in particular for fluorescence microscopy of living cells. While wild-type and engineered variants of the green fluorescent protein from Aequorea victoria (avGFP) as well as homologs from other species already cover large parts of the optical spectrum, a spectral gap remains in the near-infrared region, for which avGFP-based fluorophores are not available. Red-shifted fluorescent protein (FP) variants would substantially expand the toolkit for spectral unmixing of multiple molecular species, but the naturally occurring red-shifted FPs derived from corals or sea anemones have lower fluorescence quantum yield and inferior photo-stability compared to the avGFP variants. Further manipulation and possible expansion of the chromophore&#39;s conjugated system towards the far-red spectral region is also limited by the repertoire of 20 canonical amino acids prescribed by the genetic code. To overcome these limitations, synthetic biology can achieve further spectral red-shifting via insertion of non-canonical amino acids into the chromophore triad. We describe the application of SPI to engineer avGFP variants with novel spectral properties. Protein expression is performed in a tryptophan-auxotrophic E. coli strain and by supplementing growth media with suitable indole precursors. Inside the cells, these precursors are converted to the corresponding tryptophan analogs and incorporated into proteins by the ribosomal machinery in response to UGG codons. The replacement of Trp-66 in the enhanced &#34;cyan&#34; variant of avGFP (ECFP) by an electron-donating 4-aminotryptophan results in GdFP featuring a 108 nm Stokes shift and a strongly red-shifted emission maximum (574 nm), while being thermodynamically more stable than its predecessor ECFP. Residue-specific incorporation of the non-canonical amino acid is analyzed by mass spectrometry. The spectroscopic properties of GdFP are characterized by time-resolved fluorescence spectroscopy as one of the valuable applications of genetically encoded FPs in life sciences.

Synthetic biology enables the engineering of proteins with unprecedented properties using the co-translational insertion of non-canonical amino acids. Here, we presented how a spectrally red-shifted variant of a GFP-type fluorophore with novel fluorescence spectroscopic properties, termed &#34;gold&#34; fluorescent protein (GdFP), is produced in E. coli via selective pressure incorporation (SPI).

정식이 아닌 아미노산의 선택적 압력 관에 의해 '황금' 형광 및 질량 분석 및 형광 단백질 분석 엔지니어링

Fluorescent proteins are fundamental tools for the life sciences, in particular for fluorescence microscopy of living cells. While wild-type and ...

Peptide Scanning-assisted Identification of a Monoclonal Antibody-recognized Linear B-cell Epitope

The identification of an antigenic epitope by the immune system allows for the understanding of the protective mechanism of neutralizing antibodies that may facilitate the development of vaccines and peptide drugs. Peptide scanning is a simple and efficient method that straightforwardly maps the linear epitope recognized by a monoclonal antibody (mAb). Here, the authors present an epitope determination methodology involving serially truncated recombinant proteins, synthetic peptide design, and dot-blot hybridization for the antigenic recognition of nervous necrosis virus coat protein using a neutralizing mAb. This technique relies on the dot-blot hybridization of synthetic peptides and mAbs on a polyvinylidene fluoride (PVDF) membrane. The minimum antigenic region of a viral coat protein recognized by the RG-M56 mAb can be narrowed down by step-by-step trimmed peptide mapping onto a 6-mer peptide epitope. In addition, alanine scanning mutagenesis and residue substitution can be performed to characterize the binding significance of each amino acid residue making up the epitope. The residues flanking the epitope site were found to play critical roles in peptide conformation regulation. The identified epitope peptide may be used to form crystals of epitope peptide-antibody complexes for an x-ray diffraction study and functional competition, or for therapeutics.

Here, the authors present a simple and efficient protocol to define a linear antigenic epitope using a purified monoclonal antibody and peptide scanning through dot-blot hybridization. The identified epitope can then be used in therapeutic and diagnostic applications.

펩타이드 모노클로 날 항체 인식 선형 B 세포 에피토프의 확인을 스캔 보조

The identification of an antigenic epitope by the immune system allows for the understanding of the protective mechanism of neutralizing antibodies that ...

Targeting Cysteine Thiols for in Vitro Site-specific Glycosylation of Recombinant Proteins

Stromal interaction molecule-1 (STIM1) is a type-I transmembrane protein located on the endoplasmic reticulum (ER) and plasma membranes (PM). ER-resident STIM1 regulates the activity of PM Orai1 channels in a process known as store operated calcium (Ca2+) entry which is the principal Ca2+ signaling process that drives the immune response. STIM1 undergoes post-translational N-glycosylation at two luminal Asn sites within the Ca2+ sensing domain of the molecule. However, the biochemical, biophysical, and structure biological effects of N-glycosylated STIM1 were poorly understood until recently due to an inability to readily obtain high levels of homogeneous N-glycosylated protein. Here, we describe the implementation of an in vitro chemical approach which attaches glucose moieties to specific protein sites applicable to understanding the underlying effects of N-glycosylation on protein structure and mechanism. Using solution nuclear magnetic resonance spectroscopy we assess both efficiency of the modification as well as the structural consequences of the glucose attachment with a single sample. This approach can readily be adapted to study the myriad glycosylated proteins found in nature.

Targeting Cysteine Thiols for in Vitro Site-specific Glycosylation of Recombinant Proteins

Biochemical and structural analyses of glycosylated proteins require relatively large amounts of homogeneous samples. Here, we present an efficient chemical method for site-specific glycosylation of recombinant proteins purified from bacteria by targeting reactive Cys thiols.

재조합 형 단백질의 생체 외에서 사이트별 Glycosylation에 대 한 대상 시스테인 Thiols

Stromal interaction molecule-1 (STIM1) is a type-I transmembrane protein located on the endoplasmic reticulum (ER) and plasma membranes (PM). ER-resident ...

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for expressing proteins and genetic circuits in a controlled manner as well as for providing a prototyping environment for synthetic biology.2,3 To achieve the latter goal, cell-free expression systems that preserve endogenous Escherichia coli transcription-translation mechanisms are able to more accurately reflect in vivo cellular dynamics than those based on T7 RNA polymerase transcription. We describe the preparation and execution of an efficient endogenous E. coli based transcription-translation (TX-TL) cell-free expression system that can produce equivalent amounts of protein as T7-based systems at a 98% cost reduction to similar commercial systems.4,5 The preparation of buffers and crude cell extract are described, as well as the execution of a three tube TX-TL reaction. The entire protocol takes five days to prepare and yields enough material for up to 3000 single reactions in one preparation. Once prepared, each reaction takes under 8 hr from setup to data collection and analysis. Mechanisms of regulation and transcription exogenous to E. coli, such as lac/tet repressors and T7 RNA polymerase, can be supplemented.6 Endogenous properties, such as mRNA and DNA degradation rates, can also be adjusted.7 The TX-TL cell-free expression system has been demonstrated for large-scale circuit assembly, exploring biological phenomena, and expression of proteins under both T7- and endogenous promoters.6,8 Accompanying mathematical models are available.9,10 The resulting system has unique applications in synthetic biology as a prototyping environment, or "TX-TL biomolecular breadboard."

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

This five-day protocol outlines all steps, equipment, and supplemental software necessary for creating and running an efficient endogenous Escherichia coli based TX-TL cell-free expression system from scratch. With reagents, the protocol takes 8 hours or less to setup a reaction, collect, and process data.

구현을위한 프로토콜<em&gt; 대장균</em합성 생물학&gt;을 바탕으로 TX-TL의 무 세포 발현 시스템

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for ...