This work was supported by the NIH (AI119813), the start-up from the University of Arkansas, and the award from Arkansas Biosciences Institute.

1. Site-Directed Mutagenesis of the Target Gene
Note: MDH is expressed under T7 promoter in the pCDF-1 vector with the CloDF13 origin and a copy number of 20 to 4034.
<ol>
	<li>Introduce the amber stop codon at the position 140 in the gene by primers (forward primer: GGTGTTTATGACTAGAACAAACTGTTCGGCG and reverse primer: GGCTTTTTTCAGCACTTCAGCAGCAATTGC), following the instruction of the site-directed mutagenesis kit.</li>
	<li>Amplify the template plasmid containing the gene of wild-type malate dehydratase, and insert the stop codon mutation by the polymerase chain reaction (PCR) reaction. In the reaction mixture, include 12.5 &#181;L of 2X DNA polymerase enzyme mix, 1.25 &#181;L of 10 &#181;M Forward primer, 1.25 &#181;L of 10 &#181;M Reverse primer, 1 &#181;L of template DNA (20 ng/&#181;L) (pCDF-1 plasmid containing the gene of wild-type MDH), and 9 &#181;L of nuclease-free water.
	<ol>
		<li>Use PCR reaction parameters as follows: Initial denaturation at 98 &#176;C for 30 s; 25 cycles of 10 s at 98 &#176;C, 30 s at 55 &#176;C, and 3 min at 72 &#176;C; final extension at 72 &#176;C for 3 min. After PCR, add the amplified material directly to the Kinase-Ligase-DpnI enzyme mix from the kit for 1 h at room temperature for circularization and template removal. 
		Note: The reaction mixture contains 1 &#181;L of PCR product, 5 &#181;L of 2X Reaction Buffer, 1 &#181;L of 10X Kinase-Ligase-DpnI enzyme mix, and 3 &#181;L of nuclease-free water.</li>
	</ol>
	</li>
	<li>Add 5 &#181;L of the reaction mix to the tube of 25 &#181;L thawed competent E. coli DH5&#945; cells from the kit. Carefully flick the tube to mix, and place the mixture on ice for 30 min. Heat shock the mixture at 42 &#176;C for 30 s, and place on ice for additional 5 min.
	<ol>
		<li>Pipette 600 &#181;L of room temperature Super Optimal broth with Catabolite repression (SOC) media from the kit into the mixture, incubate at 37 &#176;C for 60 min with shaking at 250 rpm, spread 100 &#181;L onto a lysogeny broth (LB) agar plate with the corresponding antibiotic, and incubate overnight at 37 &#176;C with shaking at 250 rpm.</li>
	</ol>
	</li>
	<li>Pick 4-6 single colonies into 6 mL fresh LB media with the corresponding antibiotic, and incubate at 37 &#176;C overnight with shaking at 250 rpm. Extract plasmids from each overnight culture by the plasmid purification kit, following the manufacturer&#39;s manual, then send plasmids for DNA sequencing according to the protocol of the service provider to confirm the stop codon mutation at correct positions.</li>
	<li>Store the strain with the correct sequence at -80 &#176;C by mixing 1 mL overnight culture and 300 &#181;L 100% DMSO.</li>
</ol>
2. Expression of the Acetylated Protein
<ol>
	<li>Insert the genes of optimized acetyllysyl-tRNA synthetase33 and optimized tRNAPyl 32 into the pTech plasmid. Place the tRNA synthetase gene under the constitutive lpp promoter. Place the tRNA gene under the constitutive proK promoter34.
	<ol>
		<li>Co-transform the expression vector34 containing the mutated TAG-containing gene of malate dehydrogenase, and the plasmid harboring the optimized acetyllysine incorporation system, into 25 &#181;L thawed competent E. coli BL21(DE3) cells by heat shock at 42 &#176;C for 10 s, and place on ice for additional 5 min.</li>
		<li>Pipette 600 &#181;L of room temperature SOC media into the mixture, incubate at 37 &#176;C for 60 min with shaking at 275 rpm, spread 100 &#181;L onto a plate with 100 &#181;g/mL streptomycin and 50 &#181;g/mL chloramphenicol, and incubate overnight at 37 &#176;C with shaking at 275 rpm.</li>
	</ol>
	</li>
	<li>Pick up a single colony from the plate, and inoculate into 15 mL fresh LB media with 100 &#181;g/mL streptomycin and 50 &#181;g/mL chloramphenicol in a 50 mL tube overnight at 37 &#176;C with shaking at the speed of 250 rpm. Transfer the 15 mL overnight culture to 300 mL fresh LB media with antibiotics in a 1 L flask, and incubate at 37 &#176;C with shaking at 250 rpm.</li>
	<li>Dissolve acetyllysine with water to make 100 mM stock solution, store at 4 &#176;C. Add 5 mM acetyllysine and 20 mM nicotinamide (inhibitor of deacetylases) to the growth media when absorbance reaches 0.5 at 600 nm.
	<ol>
		<li>Grow cells for an additional 1 h at 37 &#176;C, shaking at 250 rpm, then add 0.5 mM IPTG for protein expression, and grow cells at 25 &#176;C overnight, with shaking at 180 rpm. 
		NOTE: The expression conditions may need optimization for different proteins.</li>
	</ol>
	</li>
	<li>Collect cells by centrifuging at 3,000 x g at 4 &#176;C for 15 min, discard the supernatant, and wash cell pellets with the Phosphate-buffered saline (PBS) buffer (10 mM Na2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl). Collect washed cells at 10,000 x g at 4 &#176;C for 5 min, discard the supernatant, and store cell pellets at -80 &#176;C.</li>
</ol>
3. Purification of the Acetylated Protein
<ol>
	<li>Thaw the frozen cell pellets on ice, and re-suspend with 15 mL of lysis buffer (50 mM tris(hydroxymethyl)aminomethane (Tris) pH 7.8, 300 mM NaCl, 20 mM imidazole, and 20 mM nicotinamide), 5 &#181;L of &#946;-mercaptoethanol and 1 &#181;L Benzonase nuclease (250 units).</li>
	<li>Break cells by 40 kHz sonication at 70% power output with 10 cycles of 10 s short bursts, followed by intervals of 30 s for cooling to form crude extract. Centrifuge crude extract at 20,000 x g for 25 min at 4 &#176;C. Filter the supernatant with the 0.45 &#181;m membrane filter, and load into a column containing 1 mL of nickel-nitrilotriacetic acid (Ni-NTA) resin equilibrated with 20 mL of water and 20 mL of lysis buffer. 
	NOTE: Cells could also be broken by mild detergents, if sonication is not available.</li>
	<li>Wash the column with 20 mL of wash buffer (50 mM Tris pH 7.8, 300 mM NaCl, 50 mM imidazole, and 20 mM nicotinamide), and then elute with 2 mL of elution buffer (50 mM Tris pH 7.8, 300 mM NaCl, 150 mM imidazole, and 20 mM nicotinamide).</li>
	<li>Desalt the elution fraction with desalting buffer (25 mM Tris pH 7.8 and 10 mM NaCl) by the PD-10 column, following the manufacturer&#39;s manual. Measure the concentration of the eluted protein by following the instruction of the Bradford protein assay reagent. The desalted protein is ready for further experiments. 
	NOTE: Make 50% glycerol stock of the protein, and keep in -80 &#176;C for storage.</li>
</ol>
4. Biochemical Characterization of the Acetylated Protein
<ol>
	<li>SDS-PAGE and mass spectrometry analyses.
	<ol>
		<li>Denature proteins with the sodium dodecyl sulfate (SDS) sample buffer (5 &#181;L protein sample with 2 &#181;L 4X SDS sample buffer) in a 2 mL tube at 105 &#176;C for 5 min, centrifuge the mixture at 2000 x g for 10 s, load onto the 4-20% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gel, and run at 200 V for 30 min.</li>
		<li>Wash the gel with distilled water and shake gently for 5 min, repeating the process 3 times. Discard the water, and stain the gel with Coomassie blue stain for 1 h with gentle shaking. De-stain the gel with distilled water, shake gently for 30 min, and repeat this de-stain 3 times.</li>
		<li>Cut the band at 33 kDa on the Coomassie blue-stained SDS-PAGE gel, and send it to mass spectrometry facilities or companies to confirm the acetyllysine was incorporated at the designed position. 
		NOTE: The protocol of mass spectrometry analysis followed the previous experiment34.</li>
	</ol>
	</li>
	<li>Western Blotting
	<ol>
		<li>Run the SDS-PAGE gel with the same protocol in step 4.1. After the gel run, soak the gel with the transfer buffer (25 mM Tris, 192 mM glycine, pH 8.3, and 20% methanol) for 15 min.</li>
		<li>Activate a 0.2 &#181;m, 7 cm x 8.5 cm polyvinylidene difluoride (PVDF) membrane with methanol for 1 min, and rinse with transfer buffer before preparing the transfer sandwich. 
		NOTE: Methanol is hazardous in case of skin contact, eye contact, ingestion, or inhalation. Severe over-exposure can result in death.</li>
		<li>Make the transfer sandwich from cathode to anode (sponge, filter paper, SDS-PAGE gel, PVDF membrane, filter paper, and sponge). Put the stack in the transfer tank, run at constant current of 350 mA for 45 min. 
		NOTE: Transfer time may need optimization.</li>
		<li>Wash the PVDF membrane with 25 mL Tris-buffered saline, 0.1% Tween 20 (TBST) (137 mM NaCl, 20 mM Tris, 0.1% Tween-20, pH 7.6) buffer for 5 min with gentle shaking. Block the membrane with 5% Bovine serum albumin (BSA) in the TBST buffer for 1 h at room temperature.</li>
		<li>Incubate the membrane with HRP-conjugated acetyllysine-antibody with a final concentration of 1 &#181;g/mL diluted with 5% BSA in TBST at 4 &#176;C overnight with gentle shaking. 
		NOTE: For faster results, this step could be performed in room temperature for 1 h. The dilution of antibody may need optimization.</li>
		<li>Wash the membrane with 20 mL TBST buffer for 5 min with gentle shaking, repeating the step 4 times. Apply the chemiluminescence substrate to the membrane by following the manufacturer&#39;s instructions. Capture the signal with a charge-coupled device (CCD) camera-based imager.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Krishna, R. G., Wold, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Post-translational+modification+of+proteins.">Post-translational modification of proteins.</a> Adv Enzymol Relat Areas Mol Biol. 67, 265-298 (1993).</li><li>Lothrop, A. P., Torres, M. P., Fuchs, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deciphering+post-translational+modification+codes.">Deciphering post-translational modification codes.</a> FEBS Lett. 587 (8), 1247-1257 (2013).</li><li>Walsh, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Posttranslational modification of proteins : expanding nature's inventory. , (2006).</li><li>Khoury, G. A., Baliban, R. C., Floudas, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteome-wide+post-translational+modification+statistics:+frequency+analysis+and+curation+of+the+swiss-prot+database.">Proteome-wide post-translational modification statistics: frequency analysis and curation of the swiss-prot database.</a> Sci Rep. 1, (2011).</li><li>Grotenbreg, G., Ploegh, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+biology:+dressed-up+proteins.">Chemical biology: dressed-up proteins.</a> Nature. 446 (7139), 993-995 (2007).</li><li>Arif, M., Selvi, B. R., Kundu, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+acetylation:+the+tale+of+a+modification+from+transcription+regulation+to+metabolism.">Lysine acetylation: the tale of a modification from transcription regulation to metabolism.</a> Chembiochem. 11 (11), 1501-1504 (2010).</li><li>Cohen, T., Yao, T. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=AcK-knowledge+reversible+acetylation.">AcK-knowledge reversible acetylation.</a> Science's STKE : signal transduction knowledge environment. (245), pe42 (2004).</li><li>Drazic, A., Myklebust, L. M., Ree, R., Arnesen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+world+of+protein+acetylation.">The world of protein acetylation.</a> Biochim Biophys Acta. 1864 (10), 1372-1401 (2016).</li><li>Escalante-Semerena, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N&#949;-acetylation+control+conserved+in+all+three+life+domains.">N&#949;-acetylation control conserved in all three life domains.</a> Microbe. 5, 340-344 (2010).</li><li>Kouzarides, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation:+a+regulatory+modification+to+rival+phosphorylation?.">Acetylation: a regulatory modification to rival phosphorylation?.</a> The EMBO journal. 19 (6), 1176-1179 (2000).</li><li>Soppa, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+acetylation+in+archaea,+bacteria,+and+eukaryotes.">Protein acetylation in archaea, bacteria, and eukaryotes.</a> Archaea. , (2010).</li><li>Verdin, E., Ott, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=50+years+of+protein+acetylation:+from+gene+regulation+to+epigenetics,+metabolism+and+beyond.">50 years of protein acetylation: from gene regulation to epigenetics, metabolism and beyond.</a> Nat Rev Mol Cell Biol. 16 (4), 258-264 (2015).</li><li>Allfrey, V. G., Faulkner, R., Mirsky, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+and+Methylation+of+Histones+and+Their+Possible+Role+in+the+Regulation+of+Rna+Synthesis.">Acetylation and Methylation of Histones and Their Possible Role in the Regulation of Rna Synthesis.</a> P Natl Acad Sci USA. 51, 786-794 (1964).</li><li>Phillips, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+presence+of+acetyl+groups+of+histones.">The presence of acetyl groups of histones.</a> Biochem j. 87, 258-263 (1963).</li><li>Sterner, D. E., Berger, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+of+histones+and+transcription-related+factors.">Acetylation of histones and transcription-related factors.</a> Microbiology and molecular biology reviews: MMBR. 64 (2), 435-459 (2000).</li><li>Glozak, M. A., Sengupta, N., Zhang, X., Seto, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+and+deacetylation+of+non-histone+proteins.">Acetylation and deacetylation of non-histone proteins.</a> Gene. 363, 15-23 (2005).</li><li>Close, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+emerging+role+of+lysine+acetylation+of+non-nuclear+proteins.">The emerging role of lysine acetylation of non-nuclear proteins.</a> Cell Mol Life Sci. 67 (8), 1255-1264 (2010).</li><li>Iyer, A., Fairlie, D. P., Brown, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+acetylation+in+obesity,+diabetes+and+metabolic+disease.">Lysine acetylation in obesity, diabetes and metabolic disease.</a> Immunol Cell Biol. 90 (1), 39-46 (2012).</li><li>You, L., Nie, J., Sun, W. J., Zheng, Z. Q., Yang, X. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+acetylation:+enzymes,+bromodomains+and+links+to+different+diseases.">Lysine acetylation: enzymes, bromodomains and links to different diseases.</a> Essays Biochem. 52, 1-12 (2012).</li><li>Bonnaud, E. M., Suberbielle, E., Malnou, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+acetylation+in+neuronal+(dys)function.">Histone acetylation in neuronal (dys)function.</a> Biomol Concepts. 7 (2), 103-116 (2016).</li><li>Fukushima, A., Lopaschuk, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+control+of+cardiac+fatty+acid+beta-oxidation+and+energy+metabolism+in+obesity,+diabetes,+and+heart+failure.">Acetylation control of cardiac fatty acid beta-oxidation and energy metabolism in obesity, diabetes, and heart failure.</a> Biochim Biophys Acta. 1862 (12), 2211-2220 (2016).</li><li>Kaypee, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aberrant+lysine+acetylation+in+tumorigenesis:+Implications+in+the+development+of+therapeutics.">Aberrant lysine acetylation in tumorigenesis: Implications in the development of therapeutics.</a> Pharmacol Ther. 162, 98-119 (2016).</li><li>Tapias, A., Wang, Z. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+Acetylation+and+Deacetylation+in+Brain+Development+and+Neuropathies.">Lysine Acetylation and Deacetylation in Brain Development and Neuropathies.</a> Genomics Proteomics Bioinformatics. 15 (1), 19-36 (2017).</li><li>Hu, L. I., Lima, B. P., Wolfe, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+protein+acetylation:+the+dawning+of+a+new+age.">Bacterial protein acetylation: the dawning of a new age.</a> Molecular microbiology. 77 (1), 15-21 (2010).</li><li>Jones, J. D., O'Connor, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+acetylation+in+prokaryotes.">Protein acetylation in prokaryotes.</a> Proteomics. 11 (15), 3012-3022 (2011).</li><li>Bernal, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+bacterial+physiology+by+lysine+acetylation+of+proteins.">Regulation of bacterial physiology by lysine acetylation of proteins.</a> New biotechnol. 31 (6), 586-595 (2014).</li><li>Hentchel, K. L., Escalante-Semerena, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acylation+of+Biomolecules+in+Prokaryotes:+a+Widespread+Strategy+for+the+Control+of+Biological+Function+and+Metabolic+Stress.">Acylation of Biomolecules in Prokaryotes: a Widespread Strategy for the Control of Biological Function and Metabolic Stress.</a> Microbiology and molecular biology reviews : MMBR. 79 (3), 321-346 (2015).</li><li>Ouidir, T., Kentache, T., Hardouin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+lysine+acetylation+in+bacteria:+Current+state+of+the+art.">Protein lysine acetylation in bacteria: Current state of the art.</a> Proteomics. 16 (2), 301-309 (2016).</li><li>Wolfe, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+protein+acetylation:+new+discoveries+unanswered+questions.">Bacterial protein acetylation: new discoveries unanswered questions.</a> Curr Genet. 62 (2), 335-341 (2016).</li><li>Albaugh, B. N., Arnold, K. M., Lee, S., Denu, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autoacetylation+of+the+histone+acetyltransferase+Rtt109.">Autoacetylation of the histone acetyltransferase Rtt109.</a> J Biol Chem. 286 (28), 24694-24701 (2011).</li><li>Neumann, H., Peak-Chew, S. Y., Chin, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+encoding+N&#949;-acetyllysine+in+recombinant+proteins.">Genetically encoding N&#949;-acetyllysine in recombinant proteins.</a> Nat chem biol. 4 (4), 232-234 (2008).</li><li>Fan, C., Xiong, H., Reynolds, N. M., Soll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rationally+evolving+tRNAPyl+for+efficient+incorporation+of+noncanonical+amino+acids.">Rationally evolving tRNAPyl for efficient incorporation of noncanonical amino acids.</a> Nucleic Acids Res. 43 (22), e156 (2015).</li><li>Bryson, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Continuous+directed+evolution+of+aminoacyl-tRNA+synthetases+to+alter+amino+acid+specificity+and+enhance+activity.">Continuous directed evolution of aminoacyl-tRNA synthetases to alter amino acid specificity and enhance activity.</a> Nat Chem Biol. , (2017).</li><li>Venkat, S., Gregory, C., Sturges, J., Gan, Q., Fan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studying+the+Lysine+Acetylation+of+Malate+Dehydrogenase.">Studying the Lysine Acetylation of Malate Dehydrogenase.</a> J Mol Biol. 429 (9), 1396-1405 (2017).</li><li>Venkat, S., Gregory, C., Gan, Q., Fan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+characterization+of+the+lysine+acetylation+of+tyrosyl-tRNA+synthetase+in+Escherichia+coli.">Biochemical characterization of the lysine acetylation of tyrosyl-tRNA synthetase in Escherichia coli.</a> Chembiochem. 18 (19), 1928-1934 (2017).</li><li>Liu, C. C., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adding+new+chemistries+to+the+genetic+code.">Adding new chemistries to the genetic code.</a> Annu Rev Biochem. 79, 413-444 (2010).</li><li>Mukai, T., Lajoie, M. J., Englert, M., Soll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rewriting+the+Genetic+Code.">Rewriting the Genetic Code.</a> Annu Rev Microbiol. , (2017).</li><li>O'Donoghue, P., Ling, J., Wang, Y. S., Soll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Upgrading+protein+synthesis+for+synthetic+biology.">Upgrading protein synthesis for synthetic biology.</a> Nat Chem Biol. 9 (10), 594-598 (2013).</li><li>Chin, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expanding+and+reprogramming+the+genetic+code+of+cells+and+animals.">Expanding and reprogramming the genetic code of cells and animals.</a> Annu Rev Biochem. 83, 379-408 (2014).</li><li>O'Donoghue, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Near-cognate+suppression+of+amber,+opal+and+quadruplet+codons+competes+with+aminoacyl-tRNAPyl+for+genetic+code+expansion.">Near-cognate suppression of amber, opal and quadruplet codons competes with aminoacyl-tRNAPyl for genetic code expansion.</a> FEBS Lett. 586 (21), 3931-3937 (2012).</li><li>Aerni, H. R., Shifman, M. A., Rogulina, S., O'Donoghue, P., Rinehart, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Revealing+the+amino+acid+composition+of+proteins+within+an+expanded+genetic+code.">Revealing the amino acid composition of proteins within an expanded genetic code.</a> Nucleic Acids Res. 43 (2), e8 (2015).</li><li>Huang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+convenient+method+for+genetic+incorporation+of+multiple+noncanonical+amino+acids+into+one+protein+in+Escherichia+coli.">A convenient method for genetic incorporation of multiple noncanonical amino acids into one protein in Escherichia coli.</a> Mol Biosyst. 6 (4), 683-686 (2010).</li><li>Venkat, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+encoding+thioacetyl-lysine+as+a+nondeacetylatable+analog+of+lysine+acetylation+in+Escherichia+coli.">Genetically encoding thioacetyl-lysine as a nondeacetylatable analog of lysine acetylation in Escherichia coli.</a> FEBS Open. , (2017).</li><li>Wan, W., Tharp, J. M., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysyl-tRNA+synthetase:+an+ordinary+enzyme+but+an+outstanding+genetic+code+expansion+tool.">Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool.</a> Biochim Biophys Acta. 1844 (6), 1059-1070 (2014).</li><li>Gregoretti, I. V., Lee, Y. M., Goodson, H. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+evolution+of+the+histone+deacetylase+family:+functional+implications+of+phylogenetic+analysis.">Molecular evolution of the histone deacetylase family: functional implications of phylogenetic analysis.</a> J Mol Biol. 338 (1), 17-31 (2004).</li><li>Weinert, B. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetyl-phosphate+is+a+critical+determinant+of+lysine+acetylation+in+E.+coli.">Acetyl-phosphate is a critical determinant of lysine acetylation in E. coli.</a> Mol cell. 51 (2), 265-272 (2013).</li></ol>

The authors have nothing to disclose.

The genetic incorporation of noncanonical amino acids (ncAAs) is based on the suppression of an assigned codon, mostly the amber stop codon UAG36,37,38,39, by the ncAA-charged tRNA containing the corresponding anticodon. As is known, the UAG codon is recognized by the release factor-1 (RF1) in bacteria, and it can also be suppressed by near cognate tRNAs from hosts charged by canonical amino ac...

Post-translational modifications (PTMs) of proteins occur after the translation process, and arise from covalent addition of functional groups to amino acid residues, playing important roles in almost all the biological processes, including gene transcription, stress response, cellular differentiation, and metabolism1,2,3. To date, about 400 distinctive PTMs have been identified4. The intricacy of the genome and the proteome is amplified to a great extent by protein PTMs, as they regulate protein activity and localization, and affect the interaction with other molecules such as proteins, nucleic acids, lipids, and cofactors5.
Protein acetylation has been at the forefront of PTMs studies in the last two decades6,7,8,9,10,11,12. Lysine acetylation was first discovered in histones more than 50 years ago13,14, has been well scrutinized, and is known to exist in more than 80 transcription factors, regulators, and various proteins15,16,17. Studies on protein acetylation have not only provided us with a deeper understanding of its regulatory mechanisms, but also guided treatments for a number of diseases caused by dysfunctional acetylation18,19,20,21,22,23. It was believed that lysine acetylation only happens in eukaryotes, but recent studies have shown that protein acetylation also plays key roles in bacterial physiology, including chemotaxis, acid resistance, activation, and stabilization of pathogenicity islands and other virulence related proteins24,25,26,27,28,29.
A commonly used method to biochemically characterize lysine acetylation is using site-directed mutagenesis. Glutamine is used as a mimic of acetyllysine because of its similar size and polarity. Arginine is utilized as a non-acetylated lysine mimic, since it preserves its positive charge under physiological conditions but cannot be acetylated. However, both mimics are not real isosteres and do not always yield the expected results30. The most rigorous approach is to generate homogeneously acetylated proteins at specific lysine residues, which is difficult or impossible for most classical methods due to the low stoichiometry of lysine acetylation in nature7,11. This challenge has been unraveled by the genetic code expansion strategy, which employs an engineered pyrrolysyl-tRNA synthetase variant from Methanosarcinaceae species to charge tRNAPyl with acetyllysine, utilizes the host translational machinery to suppress the UAG stop codon in the mRNA, and directs the incorporation of acetyllysine in the designed position of the target protein31. Recently, we have optimized this system with an improved EF-Tu-binding tRNA32 and an upgraded acetyllysyl-tRNA synthetase33. Furthermore, we have applied this enhanced incorporation system in acetylation studies of malate dehydrogenase34 and tyrosyl-tRNA synthetase35. Herein, we demonstrate the protocol for generating purely acetylated proteins from the molecular cloning to biochemical identification by using malate dehydrogenase (MDH), which we have extensively studied as a demonstrative example.

<table border="0" cellpadding="0" cellspacing="0" width="615">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Bradford protein assay</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">5000006</td>
			<td style="width:167px;">Protein concentration</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">4x Laemmli Sample Buffer</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">1610747</td>
			<td style="width:167px;">SDS sample buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Coomassie G-250 Stain</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">1610786</td>
			<td style="width:167px;">SDS-PAGE gel staining</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">4-20% SDS-PAGE ready gel</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">4561093</td>
			<td style="width:167px;">Protein determination</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Ac-K-100 (HRP Conjugate)</td>
			<td style="width:113px;">Cell Signaling</td>
			<td style="width:119px;">6952</td>
			<td style="width:167px;">Antibody</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">IPTG</td>
			<td style="width:113px;">CHEM-IMPEX</td>
			<td style="width:119px;">194</td>
			<td style="width:167px;">Expression inducer</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:216px;">N&#949;-Acetyl-L-lysine</td>
			<td style="width:113px;">CHEM-IMPEX</td>
			<td style="width:119px;">5364</td>
			<td style="width:167px;">Noncanonical amino acid</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">PD-10 desalting column</td>
			<td style="width:113px;">GE Healthcare</td>
			<td style="width:119px;">17085101</td>
			<td style="width:167px;">Desalting</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">Q5 Site-Directed Mutagenesis Kit</td>
			<td style="width:113px;">NEB</td>
			<td style="width:119px;">E0554</td>
			<td style="width:167px;">Introducing the stop codon</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">BL21 (DE3) cells</td>
			<td style="width:113px;">NEB</td>
			<td style="width:119px;">C2527</td>
			<td style="width:167px;">Expressing strain</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:113px;">QIAGEN</td>
			<td style="width:119px;">27106</td>
			<td style="width:167px;">Extracting plasmids</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Ni-NTA resin</td>
			<td style="width:113px;">QIAGEN</td>
			<td style="width:119px;">30210</td>
			<td style="width:167px;">Affinity purification resin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">nicotinamide</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">N3376</td>
			<td style="width:167px;">Deacetylase inhibitor</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">&#946;-Mercaptoethanol</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">M6250</td>
			<td style="width:167px;">Reducing agent</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">BugBuster Protein Extraction Reagent</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">70584</td>
			<td style="width:167px;">Breaking cells</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Benzonase nuclease</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">E1014</td>
			<td style="width:167px;">DNase</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">ECL Western Blotting Substrate</td>
			<td style="width:113px;">ThermoFisher</td>
			<td style="width:119px;">32106</td>
			<td style="width:167px;">Chemiluminescence</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Premixed LB Broth</td>
			<td style="width:113px;">VWR</td>
			<td style="width:119px;">97064</td>
			<td style="width:167px;">Cell growth medium</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Bovine serum albumin</td>
			<td style="width:113px;">VWR</td>
			<td style="width:119px;">97061-416</td>
			<td style="width:167px;">western blots blocking</td>
		</tr>
	</tbody>
</table>

a facile protocol to generate site-specifically acetylated proteins in escherichia coli

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. Among them, reversible lysine acetylation is one of the most widely distributed in all domains of life. Although numerous mass spectrometry-based acetylome studies have been performed, further characterization of these putative acetylation targets has been limited. One possible reason is that it is difficult to generate purely acetylated proteins at desired positions by most classic biochemical approaches. To overcome this challenge, the genetic code expansion technique has been applied to use the pair of an engineered pyrrolysyl-tRNA synthetase variant, and its cognate tRNA from Methanosarcinaceae species, to direct the cotranslational incorporation of acetyllysine at the specific site in the protein of interest. After first application in the study of histone acetylation, this approach has facilitated acetylation studies on a variety of proteins. In this work, we demonstrated a facile protocol to produce site-specifically acetylated proteins by using the model bacterium Escherichia coli as the host. Malate dehydrogenase was used as a demonstration example in this work.

The yield of acetylated MDH protein was 15 mg per 1 L culture, while that of wild-type MDH was 31 mg per 1 L culture. Purified proteins were analyzed by SDS-PAGE as shown in Figure 1. The wild-type MDH was used as a positive control34. The protein purified from cells harboring the acetyllysine (AcK) incorporation system and the mutant mdh gene, but without AcK in growth media, was used as a negative control. Lysine acetylation...

Watch this Scientific Journal Video about A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli at JoVE.com

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Genetic code expansion serves as a powerful tool to study a wide range of biological processes, including protein acetylation. Here we demonstrate a facile protocol to exploit this technique for generating homogeneously acetylated proteins at specific sites in Escherichia coli cells.

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. ...

a-facile-protocol-to-generate-site-specifically-acetylated-proteins

Research

JoVE Journal

Immunology and Infection

6.8K Views.  University of Arkansas. Genetic code expansion serves as a powerful tool to study a wide range of biological processes, including protein acetylation. Here we demonstrate a facile protocol to exploit this technique for generating homogeneously acetylated proteins at specific sites in Escherichia coli cells.

Video: A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Using Fluorescent Proteins to Visualize and Quantitate Chlamydia Vacuole Growth Dynamics in Living Cells

The obligate intracellular bacterium Chlamydia elicits a great burden on global public health. C.&#160;trachomatis is the leading bacterial cause of sexually transmitted infection and also the primary cause of preventable blindness in the world. An essential determinant for successful infection of host cells by Chlamydia is the bacterium's ability to manipulate host cell signaling from within a novel, vacuolar compartment called the inclusion. From within the inclusion, Chlamydia acquire nutrients required for their 2-3 day developmental growth, and they additionally secrete a panel of effector proteins onto the cytosolic face of the vacuole membrane and into the host cytosol. Gaps in our understanding of Chlamydia biology, however, present significant challenges for visualizing and analyzing this intracellular compartment. Recently, a reverse-imaging strategy for visualizing the inclusion using GFP expressing host cells was described. This approach rationally exploits the intrinsic impermeability of the inclusion membrane to large molecules such as GFP. In this work, we describe how GFP- or mCherry-expressing host cells are generated for subsequent visualization of chlamydial inclusions. Furthermore, this method is shown to effectively substitute for costly antibody-based enumeration methods, can be used in tandem with other fluorescent labels, such as GFP-expressing Chlamydia, and can be exploited to derive key quantitative data about inclusion membrane growth from a range of Chlamydia species and strains.

Using Fluorescent Proteins to Visualize and Quantitate Chlamydia Vacuole Growth Dynamics in Living Cells

A live cell fluorescent protein based method for illuminating cellular vacuoles (inclusions) containing Chlamydia is described. This strategy enables rapid, automated determination of Chlamydia infectivity in samples and can be used to quantitatively investigate inclusion growth dynamics.

The obligate intracellular bacterium Chlamydia elicits a great burden on global public health. C.&#160;trachomatis is the leading bacterial cause of ...

A Protocol to Infect Caenorhabditis elegans with Salmonella typhimurium

In the last decade, C. elegans has emerged as an invertebrate organism to study interactions between hosts and pathogens, including the host defense against gram-negative bacterium Salmonella typhimurium. Salmonella establishes persistent infection in the intestine of C. elegans and results in early death of infected animals. A number of immunity mechanisms have been identified in C. elegans to defend against Salmonella infections. Autophagy, an evolutionarily conserved lysosomal degradation pathway, has been shown to limit the Salmonella replication in C. elegans and in mammals. Here, a protocol is described to infect C. elegans with Salmonella typhimurium, in which the worms are exposed to Salmonella for a limited time, similar to Salmonella infection in humans. Salmonella infection significantly shortens the lifespan of C. elegans. Using the essential autophagy gene bec-1 as an example, we combined this infection method with C. elegans RNAi feeding approach and showed this protocol can be used to examine the function of C. elegans host genes in defense against Salmonella infection. Since C. elegans whole genome RNAi libraries are available, this protocol makes it possible to comprehensively screen for C. elegans genes that protect against Salmonella and other intestinal pathogens using genome-wide RNAi libraries.

A Protocol to Infect Caenorhabditis elegans with Salmonella typhimurium

C. elegans has emerged as a new genetic model to study host-pathogen interactions. Here we describe a protocol to infect C. elegans with Salmonella typhimurium coupled with the double-strand RNAi interference technique to examine the role of host genes in defense against Salmonella infection.

In the last decade, C. elegans has emerged as an invertebrate organism to study interactions between hosts and pathogens, including the host defense ...

Non-Invasive Model of Neuropathogenic Escherichia coli Infection in the Neonatal Rat

Investigation of the interactions between animal host and bacterial pathogen is only meaningful if the infection model employed replicates the principal features of the natural infection. This protocol describes procedures for the establishment and evaluation of systemic infection due to neuropathogenic Escherichia coli K1 in the neonatal rat. Colonization of the gastrointestinal tract leads to dissemination of the pathogen along the gut-lymph-blood-brain course of infection and the model displays strong age dependency. A strain of E. coli O18:K1 with enhanced virulence for the neonatal rat produces exceptionally high rates of colonization, translocation to the blood compartment and invasion of the meninges following transit through the choroid plexus. As in the human host, penetration of the central nervous system is accompanied by local inflammation and an invariably lethal outcome. The model is of proven utility for studies of the mechanism of pathogenesis, for evaluation of therapeutic interventions and for assessment of bacterial virulence.

Non-Invasive Model of Neuropathogenic Escherichia coli Infection in the Neonatal Rat

Here, a procedure is described for the establishment of systemic infection in the neonatal rat with cultures of Escherichia coli K1. This non-invasive procedure permits colonization of the gastrointestinal tract, translocation of the pathogen to the systemic circulation, and invasion of the central nervous system at the choroid plexus.

Investigation of the interactions between animal host and bacterial pathogen is only meaningful if the infection model employed replicates the principal ...

Phage Phenomics: Physiological Approaches to Characterize Novel Viral Proteins

Current investigations into phage-host interactions are dependent on extrapolating knowledge from (meta)genomes. Interestingly, 60 - 95% of all phage sequences share no homology to current annotated proteins. As a result, a large proportion of phage genes are annotated as hypothetical. This reality heavily affects the annotation of both structural and auxiliary metabolic genes. Here we present phenomic methods designed to capture the physiological response(s) of a selected host during expression of one of these unknown phage genes. Multi-phenotype Assay Plates (MAPs) are used to monitor the diversity of host substrate utilization and subsequent biomass formation, while metabolomics provides bi-product analysis by monitoring metabolite abundance and diversity. Both tools are used simultaneously to provide a phenotypic profile associated with expression of a single putative phage open reading frame (ORF). Representative results for both methods are compared, highlighting the phenotypic profile differences of a host carrying either putative structural or metabolic phage genes. In addition, the visualization techniques and high throughput computational pipelines that facilitated experimental analysis are presented.

Here, we present phenomic approaches for the functional characterization of putative phage genes. Techniques include a developed assay capable of monitoring host anabolic metabolism, the Multi-phenotype Assay Plates (MAPs), in addition to the established method of metabolomics, capable of measuring effects to catabolic metabolism.

Current investigations into phage-host interactions are dependent on extrapolating knowledge from (meta)genomes. Interestingly, 60 - 95% of all phage ...

One-step Negative Chromatographic Purification of Helicobacter pylori Neutrophil-activating Protein Overexpressed in Escherichia coli in Batch Mode

Helicobacter pylori neutrophil-activating protein (HP-NAP) is a major virulence factor of Helicobacter pylori (H. pylori). It plays a critical role in H. pylori-induced gastric inflammation by activating several innate leukocytes including neutrophils, monocytes, and mast cells. The immunogenic and immunomodulatory properties of HP-NAP make it a potential diagnostic and vaccine candidate for H. pylori and a new drug candidate for cancer therapy. In order to obtain substantial quantities of purified HP-NAP used for its clinical applications, an efficient method to purify this protein with high yield and purity needs to be established.
In this protocol, we have described a method for one-step negative chromatographic purification of recombinant HP-NAP overexpressed in Escherichia coli (E. coli) by using diethylaminoethyl (DEAE) ion-exchange resins (e.g., Sephadex) in batch mode. Recombinant HP-NAP constitutes nearly 70% of the total protein in E. coli and is almost fully recovered in the soluble fraction upon cell lysis at pH 9.0. Under the optimal condition at pH 8.0, the majority of HP-NAP is recovered in the unbound fraction while the endogenous proteins from E. coli are efficiently removed by the resin.
This purification method using negative mode batch chromatography with DEAE ion-exchange resins yields functional HP-NAP from E. coli in its native form with high yield and purity. The purified HP-NAP could be further utilized for the prevention, treatment, and prognosis of H. pylori-associated diseases as well as cancer therapy.

One-step Negative Chromatographic Purification of Helicobacter pylori Neutrophil-activating Protein Overexpressed in Escherichia coli in Batch Mode

A high yield method for one-step negative purification of recombinant Helicobacter pylori neutrophil-activating protein (HP-NAP) overexpressed in Escherichia coli by using diethylaminoethyl resins in batch mode is described. HP-NAP purified by this method is beneficial for the development of vaccines, drugs, or diagnostics for H. pylori-associated diseases.

Helicobacter pylori neutrophil-activating protein (HP-NAP) is a major virulence factor of Helicobacter pylori (H. pylori). It plays a critical role in H. ...

A Protocol to Characterize the Morphological Changes of Clostridium difficile in Response to Antibiotic Treatment

Assessment of antibiotic action with new drug development directed towards anaerobic bacteria is difficult and technically demanding. To gain insight into possible MOA, morphologic changes associated with antibiotic exposure can be visualized using scanning electron microscopy (SEM). Integrating SEM imaging with traditional kill curves may improve our insight into drug action and advance the drug development process. To test this premise, kill curves and SEM studies were conducted using drugs with known but different MOA (vancomycin and metronidazole). C. difficile cells (R20291) were grown with or without the presence of antibiotic for up to 48 h. Throughout the 48 h interval, cells were collected at multiple time points to determine antibiotic efficacy and for imaging on the SEM. Consistent with previous reports, vancomycin and metronidazole had significant bactericidal activity following 24 h of treatment as measured by colony-forming unit (CFU) counting. Using SEM imaging we determined that metronidazole had significant effects on cell length (&#62; 50% reduction in cell length for each antibiotic; P&#60; 0.05) compared to controls and vancomycin. While the phenotypic response to drug treatment has not been documented previously in this manner, they are consistent with the drug&#39;s MOA demonstrating the versatility and reliability of the imaging and measurements and the application of this technique for other experimental compounds.

A Protocol to Characterize the Morphological Changes of Clostridium difficile in Response to Antibiotic Treatment

Antibiotic efficacy is most commonly determined by conducting killing kinetic studies and measuring colony forming units (CFUs). By integrating scanning electron microscopy (SEM) with these standard methods, we can distinguish the pharmacological effects of treatment between different antibiotics.

Assessment of antibiotic action with new drug development directed towards anaerobic bacteria is difficult and technically demanding. To gain insight into ...

Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

Enterohemorrhagic E. coli (EHEC) O157:H7, which is a foodborne pathogen that causesdiarrhea, hemorrhagic colitis (HS), and hemolytic uremic syndrome (HUS), colonize to the intestinal tract of humans. To study the detailed mechanism of EHEC colonization in vivo, it is essential to have animal models to monitor and quantify EHEC colonization. We demonstrate here a mouse-EHEC colonization model by transforming the bioluminescent expressing plasmid to EHEC to monitor and quantify EHEC colonization in living hosts. Animals inoculated with bioluminescence-labeled EHEC show intense bioluminescent signals in mice by detection with a non-invasive in vivo imaging system. After 1 and 2 days post infection, bioluminescent signals could still be detected in infected animals, which suggests that EHEC colonize in hosts for at least 2 days. We also demonstrate that these bioluminescent EHEC locate to mouse intestine, specifically in the cecum and colon, from ex vivo images. This mouse-EHEC colonization model may serve as a tool to advance the current knowledge of the EHEC colonization mechanism.

Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

A detailed protocol of a mouse model for enterohemorrhagic E. coli (EHEC) colonization by using bioluminescence-labeled bacteria is presented. The detection of these bioluminescent bacteria by a non-invasive in vivo imaging system in live animals can advance our current understanding of EHEC colonization.

Enterohemorrhagic E. coli (EHEC) O157:H7, which is a foodborne pathogen that causesdiarrhea, hemorrhagic colitis (HS), and hemolytic uremic syndrome ...

Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri

Transposon mutagenesis is a method that allows gene disruption via the random genomic insertion of a piece of DNA called a transposon. The protocol below outlines a method for high efficiency transfer between bacterial strains of a plasmid harboring a transposon containing a kanamycin resistance marker. The plasmid-borne transposase is encoded by a variant tnp gene that inserts the transposon into the genome of the recipient strain with very low insertional bias. This method thus allows the creation of large mutant libraries in which transposons have been inserted into unique genomic positions in a recipient strain of either Escherichia coli or Shigella flexneri bacteria. By using bacterial conjugation, as opposed to other methods such as electroporation or chemical transformation, large libraries with hundreds of thousands of unique clones can be created. This yields high-density insertion libraries, with insertions occurring as frequently as every 4-6 base pairs in non-essential genes. This method is superior to other methods as it allows for an inexpensive, easy to use, and high efficiency method for the creation of a dense transposon insertion library. The transposon library can be used in downstream applications such as transposon sequencing (Tn-Seq), to infer genetic interaction networks, or more simply, in mutational (forward genetic) screens.

Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri

Presented here is a simple method for creating a high-density transposon insertion library in Escherichia coli or Shigella flexneri using bacterial conjugation. This protocol allows the creation of a collection of hundreds of thousands of unique mutants in bacteria by the random genomic insertion of a transposon.

Transposon mutagenesis is a method that allows gene disruption via the random genomic insertion of a piece of DNA called a transposon. The protocol below ...

Overexpression and Purification of Human Cis-prenyltransferase in Escherichia coli

Prenyltransferases (PT) are a group of enzymes that catalyze chain elongation of allylic diphosphate using isopentenyl diphosphate (IPP) via multiple condensation reactions. DHDDS (dehydrodolichyl diphosphate synthase) is a eukaryotic long-chain cis-PT (forming cis double bonds from the condensation reaction) that catalyzes chain elongation of farnesyl diphosphate (FPP, an allylic diphosphate) via multiple condensations with isopentenyl diphosphate (IPP). DHDDS is of biomedical importance, as a non-conservative mutation (K42E) in the enzyme results in retinitis pigmentosa, ultimately leading to blindness. Therefore, the present protocol was developed in order to acquire large quantities of purified DHDDS, suitable for mechanistic studies. Here, the usage of protein fusion, optimized culture conditions and codon-optimization were used to allow the overexpression and purification of functionally active human DHDDS in E. coli. The described protocol is simple, cost-effective and time sparing. The homology of cis-PT among different species suggests that this protocol may be applied for other eukaryotic cis-PT as well, such as those involved in natural rubber synthesis.

Overexpression and Purification of Human Cis-prenyltransferase in Escherichia coli

A simple protocol for overexpression and purification of codon-optimized, human cis-prenyltransferase, under non-denaturing conditions, from Escherichia coli, is described, along with an enzymatic activity assay. This protocol can be generalized for production of other cis- prenyltransferase proteins in quantity and quality suitable for mechanistic studies.

Prenyltransferases (PT) are a group of enzymes that catalyze chain elongation of allylic diphosphate using isopentenyl diphosphate (IPP) via multiple ...

Using Enhanced Green Fluorescence Protein-expressing Escherichia Coli to Assess Mouse Peritoneal Macrophage Phagocytosis

This manuscript describes a simple and reproducible method to perform a phagocytosis assay. The first part of this method involves building a pET-SUMO-EGFP vector (SUMO = small ubiquitin-like modifier) and expressing enhanced green fluorescence protein (EGFP) in Escherichia coli (BL21DE). EGFP-expressing E. coli is coincubated with macrophages for 1 h at 37 &#176;C; the negative control group is incubated on ice for the same amount of time. Then, the macrophages are ready for assessment. The advantages of this technique include its simple and straightforward steps, and phagocytosis can be measured by both flow cytometer and fluorescence microscope. The EGFP-expressing E. coli are stable and display a strong fluorescence signal even after the macrophages are fixed with paraformaldehyde. This method is not only suitable for the assessment of macrophage cell lines or primary macrophages in vitro but also suitable for the evaluation of granulocyte and monocyte phagocytosis in peripheral blood mononuclear cells. The results show that the phagocytic capability of peritoneal macrophages from young (eight-week-old) mice is higher than that of macrophages from aged (16-month-old) mice. In summary, this method measures macrophage phagocytosis and is suitable for studying the innate immune system function.

Using Enhanced Green Fluorescence Protein-expressing Escherichia Coli to Assess Mouse Peritoneal Macrophage Phagocytosis

Here, we present a protocol to assess mouse peritoneal macrophage phagocytosis using enhanced green fluorescence protein-expressing Escherichia coli.