This work was supported by the National Science Foundation through a CAREER Award (grant number DBI-1253293); the National Institutes of Health (NIH) (grant numbers HG007233-01, R01-EB019453-01, 1R21HG007233, DP2-AR068129-01, R01-HG008978); and the Defense Advanced Research Projects Agency Living Foundries Program (contract numbers HR0011-12-C-0065, N66001-12-C-4211, HR0011-12-C-0066).

<ol>
	<li>Navin, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumour+evolution+inferred+by+single-cell+sequencing.">Tumour evolution inferred by single-cell sequencing.</a> Nature. 472 (7341), 90-94 (2011).</li><li>Ni, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reproducible+copy+number+variation+patterns+among+single+circulating+tumor+cells+of+lung+cancer+patients.">Reproducible copy number variation patterns among single circulating tumor cells of lung cancer patients.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (52), 21083-21088 (2013).</li><li>Schmidt, H., Hensel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogenicity+islands+in+bacterial+pathogenesis.">Pathogenicity islands in bacterial pathogenesis.</a> Clinical Microbiology Reviews. 17, 14-56 (2004).</li><li>Mart&#237;nez, J. L., Baquero, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+among+strategies+associated+with+bacterial+infection:+pathogenicity+epidemicity,+and+antibiotic+resistance.">Interactions among strategies associated with bacterial infection: pathogenicity epidemicity, and antibiotic resistance.</a> Clinical Microbiology Reviews. 15 (4), 647-679 (2002).</li><li>Rinke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Obtaining+genomes+from+uncultivated+environmental+microorganisms+using+FACS-based+single-cell+genomics.">Obtaining genomes from uncultivated environmental microorganisms using FACS-based single-cell genomics.</a> Nature Protocols. 9 (5), 1038-1048 (2014).</li><li>Rinke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+the+phylogeny+and+coding+potential+of+microbial+dark+matter.">Insights into the phylogeny and coding potential of microbial dark matter.</a> Nature. 499 (7459), 431-437 (2013).</li><li>Zhang, H., Liu, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+tweezers+for+single+cells.">Optical tweezers for single cells.</a> Journal of the Royal Society Interface. 5 (24), 671-690 (2008).</li><li>Xu, L., Brito, I. L., Alm, E. J., Blainey, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virtual+microfluidics+for+digital+quantification+and+single-cell+sequencing.">Virtual microfluidics for digital quantification and single-cell sequencing.</a> Nature Methods. 13 (9), 759-762 (2016).</li><li>Gawad, C., Koh, W., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+the+clonal+origins+of+childhood+acute+lymphoblastic+leukemia+by+single-cell+genomics.">Dissecting the clonal origins of childhood acute lymphoblastic leukemia by single-cell genomics.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (50), 17947-17952 (2014).</li><li>Macosko, E. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+parallel+genome-wide+expression+profiling+of+individual+cells+using+nanoliter+droplets.">Highly parallel genome-wide expression profiling of individual cells using nanoliter droplets.</a> Cell. 161 (5), 1202-1214 (2015).</li><li>Klein, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+barcoding+for+single-cell+transcriptomics+applied+to+embryonic+stem+cells.">Droplet barcoding for single-cell transcriptomics applied to embryonic stem cells.</a> Cell. 161 (5), 1187-1201 (2015).</li><li>Rotem, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+single-cell+labeling+(Hi-SCL)+for+RNA-Seq+using+drop-based+microfluidics.">High-throughput single-cell labeling (Hi-SCL) for RNA-Seq using drop-based microfluidics.</a> PLoS One. 10 (5), 1-14 (2015).</li><li>Amini, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Haplotype-resolved+whole-genome+sequencing+by+contiguity-preserving+transposition+and+combinatorial+indexing.">Haplotype-resolved whole-genome sequencing by contiguity-preserving transposition and combinatorial indexing.</a> Nature Reviews Genetics. 46 (12), 1343-1349 (2014).</li><li>Zheng, G. X. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Haplotyping+germline+and+cancer+genomes+with+high-throughput+linked-read+sequencing.">Haplotyping germline and cancer genomes with high-throughput linked-read sequencing.</a> Nature Biotechnology. 34 (3), 303-311 (2016).</li><li>Lan, F., Haliburton, J. R., Yuan, A., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+barcoding+for+massively+parallel+single-molecule+deep+sequencing.">Droplet barcoding for massively parallel single-molecule deep sequencing.</a> Nature Communications. 7, 11784 (2016).</li><li>Rotem, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+ChIP-seq+reveals+cell+subpopulations+defined+by+chromatin+state.">Single-cell ChIP-seq reveals cell subpopulations defined by chromatin state.</a> Nature Biotechnology. 33 (11), 1165-1172 (2015).</li><li>Lan, F., Demaree, B., Ahmed, N., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+genome+sequencing+at+ultra-high-throughput+with+microfluidic+droplet+barcoding.">Single-cell genome sequencing at ultra-high-throughput with microfluidic droplet barcoding.</a> Nature Biotechnology. 35 (7), 640-646 (2017).</li><li>Novak, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+multiplex+gene+detection+and+sequencing+with+microfluidically+generated+agarose+emulsions.">Single-cell multiplex gene detection and sequencing with microfluidically generated agarose emulsions.</a> Angewandte Chemie Internation Edition. 50 (2), 390-395 (2011).</li><li>Gill, C., Van De Wijgert, J. H. H. M., Blow, F., Darby, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+lysis+methods+for+the+extraction+of+bacterial+DNA+for+analysis+of+the+vaginal+microbiota.">Evaluation of lysis methods for the extraction of bacterial DNA for analysis of the vaginal microbiota.</a> PLoS One. 11 (9), 1-16 (2016).</li><li>Picelli, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tn5+transposase+and+tagmentation+procedures+for+massively+scaled+sequencing+projects.">Tn5 transposase and tagmentation procedures for massively scaled sequencing projects.</a> Genome Research. 24 (12), 2033-2040 (2014).</li><li>Abate, A. R., Chen, C. H., Agresti, J. J., Weitz, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beating+Poisson+encapsulation+statistics+using+close-packed+ordering.">Beating Poisson encapsulation statistics using close-packed ordering.</a> Lab on a Chip. 9 (18), 2628 (2009).</li><li>Jain, A., Yang, A. H. J., Erickson, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gel-based+optical+waveguides+with+live+cell+encapsulation+and+integrated+microfluidics.">Gel-based optical waveguides with live cell encapsulation and integrated microfluidics.</a> Optic Letters. 37 (9), 1472 (2012).</li><li>Karbaschi, M., Shahi, P., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+chemical-free+breaking+of+microfluidic+emulsions+with+a+hand-held+antistatic+gun.">Rapid chemical-free breaking of microfluidic emulsions with a hand-held antistatic gun.</a> Biomicrofluidics. 11 (4), 1-6 (2017).</li><li>Gole, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+polymerase+cloning+and+genome+sequencing+of+single+cells+using+nanoliter+microwells.">Massively parallel polymerase cloning and genome sequencing of single cells using nanoliter microwells.</a> Nature Biotechnology. 31 (12), 1126-1132 (2013).</li><li>Chao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metagenomic+analysis+reveals+significant+changes+of+microbial+compositions+and+protective+functions+during+drinking+water+treatment.">Metagenomic analysis reveals significant changes of microbial compositions and protective functions during drinking water treatment.</a> Scientific Reports. 3 (1), 3550 (2013).</li><li>Fierer, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-biome+metagenomic+analyses+of+soil+microbial+communities+and+their+functional+attributes.">Cross-biome metagenomic analyses of soil microbial communities and their functional attributes.</a> Proceedings of the National Academy of Sciences of the United States of America. 109 (52), 21390-21395 (2012).</li><li>Mande, S. S., Mohammed, M. H., Ghosh, T. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Classification+of+metagenomic+sequences:+methods+and+challenges.">Classification of metagenomic sequences: methods and challenges.</a> Briefings in Bioinformatics. 13 (6), 669-681 (2012).</li><li>Eastburn, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+droplet+enrichment+for+targeted+sequencing.">Microfluidic droplet enrichment for targeted sequencing.</a> Nucleic Acids Research. 43 (13), e86 (2015).</li><li>Clark, I. C., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Finding+a+helix+in+a+haystack:+nucleic+acid+cytometry+with+droplet+microfluidics.">Finding a helix in a haystack: nucleic acid cytometry with droplet microfluidics.</a> Lab on a Chip. 17 (12), 2032-2045 (2017).</li></ol>

Patents pertaining to this workflow may be licensed to Mission Bio, of which Adam R. Abate is a shareholder.

The SiC-seq microfluidic workflow produces single-cell genome sequencing data from thousands of bacterial cells. Digital barcodes spliced onto the genomes of microgel-encapsulated cells allow for the in silico deconvolution of NGS data into groups of barcoded reads originating from the same cell. A control experiment with a microbial community of known composition is necessary for evaluating the purity of the barcode groups. A large fraction of low-purity groups indicates that the cell encapsulation rate is too high or that there is significant droplet cross-contamination occurring during the microfluidic processing steps. According to Poisson statistics, the barcodes and cells should be encapsulated at a target ratio of 1 particle for every 10 drops to limit the rate of multiple encapsulation events to less than 5% of all non-empty droplets. An encapsulation rate higher than this increases the rates of doublets exponentially, so the verification of the encapsulation ratio during the dropmaking process is of critical importance. Users should be particularly cautious of the encapsulation of multiple cells in a single microgel because reads from different cells sharing the same barcode sequence cannot be bioinformatically separated. In the case that 1 cell receives 2 different barcodes, the barcode group purity is unaffected although the abundance metrics are skewed when counting by barcode sequence.
Droplet cross-contamination may also arise due to suboptimal merger conditions. During a successful operation, the microfluidic merger device (Figure 5) can controllably pair 1 barcode droplet with 1 microgel and a volume of PCR reagent. Non-ideal flow rates will result in a droplet pairing at incorrect ratios: 1 barcode could be paired with 2 microgels, for example. All flow rates listed in the protocol are intended to be estimates and may need to be adjusted depending on slight variations in the device geometry and droplet sizes. Users with access to cameras with high-speed recording capabilities (&#62;10,000 frames/s) should verify the correct droplet merger at the beginning and over the course of the microfluidic operation. Users without access to a high-speed camera can collect a small volume of the merged output and manually measure the droplet sizes under a microscope. The droplet size should be uniform: an excess of unmerged barcodes or microgel drops indicates that the reinjection rates should be reduced accordingly.
Several general precautions should be taken when handling microgels and microdroplets to preserve their integrity. Microgels, though mechanically robust, must be sufficiently cooled prior to the breaking and washing steps to ensure complete gelation. Non-spherical microgels are an indication that the agarose was not given adequate time to solidify. When washing microgels, spin the suspensions down at the required speeds to avoid a loss of product. Agarose hydrogel has a refractive index closely matching that of water and may be difficult to see in a tube22, so users should carefully identify the gel-liquid boundary prior to aspiration. Water-in-oil droplets are susceptible to coalescence by the build-up of static forces23 on laboratory gloves and tubing. For this reason, we recommend loading the droplet reinjection syringes with bare hands and treating all the reinjection lines with an anti-static gun prior to the pump priming. Large coalesced droplets can be removed by slowly rotating the emulsions in a syringe and manually aspirating the larger drops, which accumulate near the top due to their larger buoyant force.
SiC-seq is the first technology to demonstrate single-cell genome sequencing of &#62;50,000 bacterial cells. This platform offers significant advantages in throughput over existing approaches and enables a deeper sampling of heterogeneous microbial communities. To date, microfluidic technologies for single-cell genome sequencing have employed microchambers9 and microwells24 for cell isolation and amplification, but with throughputs in the range of only tens to hundreds of cells. The flow sorting of single cells into wellplates5,6 requires no specialized microfluidic instrumentation but possesses a similarly low throughput. Given that soil and water samples from the environment commonly have alpha diversities of &#62;1,000 at the species level25,26, SiC-seq is highly advantageous by virtue of its ability to sample a far greater number of organisms. The SiC-seq workflow is adaptable to cell inputs from laboratory culture, the natural environment, or a living host. A cell sample need only be in an aqueous suspension and free of large particles (&#62;10 &#181;m) to be suitable for microfluidic encapsulation. For example, the method has been previously applied to a sample of seawater using a series of wash and filtering steps to pre-process the cells prior to encapsulation17.
The SiC-seq protocol generates a relatively sparse amount of sequencing data from each single cell and may not be suitable for all applications. Some bioinformatics algorithms such as de novo genome assembly or single nucleotide variant (SNV) calling require higher coverage depths to work effectively. Instead, barcode groups can be clustered in silico by taxonomic binning methods27 so that algorithms can be applied on larger sets of reads. The relatively low overall barcoding efficiency of the SiC-seq workflow may also present challenges in cases where the availability of the input sample is low. SiC-seq relies on a Poisson-distributed barcode encapsulation step, therefore approximately 10% of the cells receive a molecular barcode and are amplified during the final library preparation step. While this is comparable to other microdroplet-based barcoding schemes10, users working with precious cell samples may have difficulty achieving the adequate library yield for sequencing and may need to increase the number of PCR cycles in the final amplification step. Another potential solution for users with microfluidic expertise is to sort positive barcode droplets after the digital PCR step, thus bringing the overall barcoding efficiency to &#62;85%28.
A potential future direction for SiC-seq technology is adapting the workflow for use with mammalian cells, paving the way for new clinical single-cell studies. As an example, an analysis of the copy number variation among single cancer cells may further our understanding of the role of heterogeneity in cancer pathology2. Alternatively, integrating SiC-seq with existing methods to probe and enrich DNA sequences of interest29 would enable the targeted single-cell sequencing of subpopulations or rare strains of cells. With environmental samples, genes from within a known metabolic pathway could be targeted and analyzed contextually alongside neighboring genes to identify novel genomic islands. From within a human host environment, low-titer pathogenic bacteria samples could be isolated and sequenced at the single-cell level to examine more closely their genotypic origins of virulence.

The genome serves as a blueprint of cellular identity and function, containing the entirety of an organism&#39;s coding potential. An understanding of cellular biology at the genome level can explain the observed phenotypic diversity within heterogeneous cell populations. This heterogeneity is apparent in biological systems and has broad implications for human health and disease. For example, gene copy number variations among tumor cells are linked to the evolution and spread of cancer1,2. In bacterial infections, pathogenicity islands present in a small fraction of genomes can be horizontally transferred and lead to the proliferation of antibiotic-resistant bacteria3,4. A primary challenge in studying genomes at the single-cell level is the low quantities of DNA available, as well as the need to analyze thousands of cells to sample the full diversity of genotypes. For these reasons, limitations in experimental throughput have hindered the effectiveness of single-cell studies, biasing results towards the most abundant cells. Single-cell isolation techniques such as flow sorting5,6, optical tweezers7, embedment in bulk gels8, and microfluidics9 are capable of processing hundreds of cells for sequencing; however, this represents only a small fraction of most samples. A method for single-cell genome sequencing with substantially higher throughput would allow deeper and more complete profiling of cell populations, thereby elucidating the role of genotypic diversity within these communities.
Droplet microfluidics enables the high-throughput manipulation of cells and biological reagents within millions of picoliter-scale reactors. To date, microdroplet technologies have been used to study differential expression patterns among cells from heterogeneous tissues10,11,12, deeply sequence long molecules13,14,15, and conduct chromatin immunoprecipitation sequencing (ChiP-seq) analyses on single cells16. Indeed, microdroplets are capable of high-throughput, compartmentalized operations, making them amenable to applications in single-cell genomics. The development of this technology presents its own unique technological challenges, however. Cells must be lysed, purified, and amplified with minimal bias, to uniformly sample cell populations. Additionally, unlike polyadenylated mRNA transcripts in mammalian cells, there is no comparable molecular motif in the genome to facilitate the capture of the target nucleic acid. For these reasons, single-cell genome sequencing has been difficult to implement in microdroplet platforms.
In this work, we provide a detailed protocol of our previously reported single-cell microfluidic approach capable of sequencing the genomes of tens of thousands of cells in a single experiment17. With this technology, called SiC-seq, bacterial cells are encapsulated in micron-scale hydrogels and individually lysed, tagmented, and merged with a microdroplet containing a unique oligonucleotide barcode, which is spliced onto the cell&#39;s genomic DNA via a single overlap extension polymerase chain reaction (PCR). The hydrogels serve as isolated containers in which high-molecular-weight genomic DNA is sterically encased, allowing smaller molecules such as detergents and lytic enzymes to access and purify DNA prior to barcoding18. This protocol processes &#62;50,000 single cells in a matter of hours, resulting in a barcoded library ready for sequencing. Following the sequencing, the reads are demultiplexed according to their single-cell barcode sequence, resulting in a dataset comprised of millions of reads, each with a cellular index.

<table><tbody><tr><td>3&quot; silicon wafers, P type, virgin test grade</td><td>University Wafers</td><td>447</td><td></td></tr><tr><td>SU-8 3025 photoresist</td><td>Microchem</td><td>17030192</td><td></td></tr><tr><td>Spin coater</td><td>Specialty Coating Systems</td><td>G3P-8</td><td></td></tr><tr><td>Photomasks</td><td>CadArt Servcies</td><td>(custom)</td><td>See Supplemental Files for mask designs</td></tr><tr><td>PGMEA developer</td><td>Sigma-Aldrich</td><td>484431</td><td></td></tr><tr><td>Isopropanol</td><td>Sigma-Aldrich</td><td>109827</td><td></td></tr><tr><td>Sylgard 184 silicone elastomer kit</td><td>Krayden</td><td>4019862</td><td></td></tr><tr><td>Degassing chamber</td><td>Bel-Art</td><td>42025</td><td></td></tr><tr><td>0.75 mm biopsy punch</td><td>World Precision Instruments</td><td>504529</td><td></td></tr><tr><td>Glass microscope slides (75 mm x 50 mm)</td><td>Corning</td><td>294775X50</td><td></td></tr><tr><td>Aquapel (hydrophobic glass treatment)</td><td>Pittsburgh Glass Works</td><td>47100</td><td></td></tr><tr><td>PE-2 polyethylene tubing</td><td>Scientific Commodities</td><td>B31695-PE/2</td><td></td></tr><tr><td>1 mL syringes</td><td>BD</td><td>309628</td><td></td></tr><tr><td>27 gauge needles</td><td>BD</td><td>305109</td><td></td></tr><tr><td>Syringe pump</td><td>New Era Pump Systems</td><td>NE-501</td><td></td></tr><tr><td>Novec HFE-7500 fluorinated oil (HFE)</td><td>3M</td><td>98-0212-2928-5</td><td></td></tr><tr><td>FC-40 fluorinated oil</td><td>Sigma-Aldrich</td><td>F9755</td><td></td></tr><tr><td>PEG-PFPE surfactant</td><td>Ran Biotechnologies</td><td>008-FluoroSurfactant</td><td></td></tr><tr><td>Space heater</td><td>Lasko&amp;nbsp;</td><td>CD09250&amp;nbsp;</td><td></td></tr><tr><td>Agarose, low gelling temperature</td><td>Sigma-Aldrich</td><td>a9414</td><td></td></tr><tr><td>TE (10X)</td><td>Rockland</td><td>mb-007</td><td></td></tr><tr><td>PBS 1X, pH 7.4</td><td>E&amp;amp;K Scientific Products</td><td>EK-65083</td><td></td></tr><tr><td>OptiPrep (density gradient medium)</td><td>Sigma-Aldrich</td><td>d1556</td><td></td></tr><tr><td>1H,1H,2H-Perfluoro-1-Octanol (PFO)</td><td>Sigma-Aldrich</td><td>370533</td><td></td></tr><tr><td>Span 80 (sorbitane monooleate)</td><td>Sigma-Aldrich</td><td>s6760</td><td></td></tr><tr><td>Hexane</td><td>Sigma-Aldrich</td><td>139386</td><td></td></tr><tr><td>Tween 20 (polysorbate 20)</td><td>Sigma-Aldrich</td><td>p2287</td><td></td></tr><tr><td>Lysozyme Type IV</td><td>MP Biomedicals</td><td>195303</td><td></td></tr><tr><td>Mutanolysin</td><td>Sigma-Aldrich</td><td>M9901</td><td></td></tr><tr><td>Zymolyase (yeast lytic enzyme)</td><td>Zymo Research</td><td>e1004</td><td></td></tr><tr><td>Lysostaphin</td><td>Sigma-Aldrich</td><td>L7386</td><td></td></tr><tr><td>Sodium chloride</td><td>Sigma-Aldrich</td><td>S9888</td><td></td></tr><tr><td>EDTA</td><td>Sigma-Aldrich</td><td>E6758</td><td></td></tr><tr><td>Tris-HCl, pH 7.5, 1M</td><td>Invitrogen</td><td>15567-027</td><td></td></tr><tr><td>Dithiothreitol (DTT)</td><td>Teknova</td><td>d9750</td><td></td></tr><tr><td>Lithium dodecyl sulfate</td><td>Sigma-Aldrich</td><td>L9781</td><td></td></tr><tr><td>Proteinase K</td><td>New England Biosciences</td><td>P8107S</td><td></td></tr><tr><td>Ethanol, 200 Proof (100%)</td><td>Koptec</td><td>V1001</td><td></td></tr><tr><td>SYBR Green I (nucleic acid stain)</td><td>Invitrogen</td><td>S7563</td><td></td></tr><tr><td>PEG 6k</td><td>Sigma-Aldrich</td><td>81260</td><td></td></tr><tr><td>Triton X-100 (octylphenol ethoxylate)</td><td>Sigma-Aldrich</td><td>t8787</td><td></td></tr><tr><td>Nextera DNA Library Prep Kit</td><td>Illumina</td><td>FC-121-1030</td><td></td></tr><tr><td>Phusion Hot Start Flex Master Mix (High-Fidelity Hot Start Master Mix)</td><td>New England Biosciences</td><td>m05365</td><td></td></tr><tr><td>Platinum Multiplex PCR Master Mix (Taq Master Mix)</td><td>Applied Biosystems</td><td>4464263</td><td></td></tr><tr><td>Warmstart 2.0 Bst Polymerase (isothermal polymerase)</td><td>New England Biosciences</td><td>m0538m</td><td></td></tr><tr><td>NT buffer from Nextera XT kit (neutralization buffer)</td><td>Illumina</td><td>FC-131-1024</td><td></td></tr><tr><td>Cold cathode fluorescent inverter</td><td>(custom)</td><td>(custom)</td><td></td></tr><tr><td>DC power supply</td><td>Mastech</td><td>HY1503D</td><td></td></tr><tr><td>Zerostat 3 anti-static gun</td><td>Milty</td><td>5036694022153</td><td></td></tr><tr><td>3D-printed centrifuge syringe holder</td><td>(custom)</td><td>(custom)</td><td>See Supplemental Files for 3D print file</td></tr><tr><td>Zymo DNA Clean &amp;amp; Concentrator-5</td><td>Zymo Research</td><td>D4003</td><td></td></tr></tbody></table>

an ultrahigh-throughput microfluidic platform for single-cell genome sequencing

Sequencing technologies have undergone a paradigm shift from bulk to single-cell resolution in response to an evolving understanding of the role of cellular heterogeneity in biological systems. However, single-cell sequencing of large populations has been hampered by limitations in processing genomes for sequencing. In this paper, we describe a method for single-cell genome sequencing (SiC-seq) which uses droplet microfluidics to isolate, amplify, and barcode the genomes of single cells. Cell encapsulation in microgels allows the compartmentalized purification and tagmentation of DNA, while a microfluidic merger efficiently pairs each genome with a unique single-cell oligonucleotide barcode, allowing &gt;50,000 single cells to be sequenced per run. The sequencing data is demultiplexed by barcode, generating groups of reads originating from single cells. As a high-throughput and low-bias method of single-cell sequencing, SiC-seq will enable a broader range of genomic studies targeted at diverse cell populations.

The SiC-seq experimental workflow contains 3 PDMS microfluidic devices fabricated using a soft lithography procedure (Figure 1). A co-flow dropmaker (Figure 3A) generates 25 &#181;m of digital barcode droplets for labeling genomic DNA with a unique single-cell identifier. The barcode oligonucleotides consist of a 15 bp degenerate sequence flanked by PCR handles for amplification (Table 2, BAR primer). The barcodes are diluted to a femtomolar concentration to achieve the single-molecule encapsulation, and all droplets receive either 0 or 1 barcode fragment(s). The droplets containing a barcode are amplified, yielding many copies of double-stranded barcode amplicons. A nucleic acid stain is used to verify the successful amplification and quantify the encapsulation rate of the barcode fragments (Figure 4B). The microgels are generated by co-flowing a bacterial cell suspension and a molten agarose gel at equal flow rates (Figure 2A). The agarose is prepared at twice the desired final concentration, as the co-flow dropmaking process effectively dilutes the aqueous solutions by a factor of 2. As the agarose cools, it solidifies into a 25 &#181;m diameter microgel occupying the spherical volume of the droplet.
A series of wash and lysis steps purifies the high-molecular-weight genomic DNA in the microgels (Figure 2B). After breaking the emulsions, aqueous washes are carried out in large volumes to dilute out trace organic solvents which can inhibit the downstream enzymatic treatments. The washed microgels are observed under a microscope to verify the cell encapsulation rate (Figure 4A). A cocktail of enzymes with broad lytic activity is added to the microgel suspension to digest the cell walls of the bacteria and eukaryotic microbes19. A second treatment with Proteinase K and detergent degrades the proteins and solubilizes cell debris.
Tagmentation of the purified DNA is carried out in droplets to avoid potential cross-contamination resulting from the diffusion of small tagmented DNA fragments between the microgels18. A droplet encapsulation device (Figure 3B) compartmentalizes each microgel with a buffer and tagmentation enzyme, which simultaneously fragments double-stranded DNA while also &#34;tagging&#34; it with a preloaded oligonucleotide20. The microgels are loaded into the droplets as close-packed particles, achieving encapsulation rates approaching 1 microgel for every drop with few doublets21 (Figure 4C).
In the final step of the microfluidic workflow (Figure 2C), a device performs a double merger operation combining 1 barcode drop, 1 microgel-containing drop, and the amplification mix in a controlled two-step process. First, a droplet containing PCR reagent is paired and merged with a barcode drop in the region shown in yellow (Figure 5). Saltwater electrodes in the microfluidic channel produce a high electric field gradient which triggers the droplet merger. In a similar manner, the first merged droplet is paired with a microgel droplet and merged a second time in the region shown in red. The droplets are collected and thermal cycled off-chip in a single-overlap extension (SOE) PCR. The overlapping complementary ends of the barcode and the tagmented genomic DNA allow fusion and exponential amplification of only properly barcoded constructs.
The sequencing data is first filtered by a read quality and then parsed by grouping the reads according to their 15-bp single-cell barcode sequence. For a barcode group to be considered valid, it should contain a minimum number of reads; this thresholding limits the analysis to cells with a useful amount of sequencing data and removes the PCR-mutated barcode &#34;orphans&#34; from the dataset. In this sample run, the minimum is set to 7.5 kbps per group (50 reads of 150 bp each). A histogram of the barcode counts versus the group size shows that a significant portion of the valid barcode groups is just above the threshold size (Figure 6A).
In a control experiment where the microbial community composition is known, the purity and relative abundance metrics are used to evaluate the quality of a SiC-seq run. Here, a synthetic 10-cell community consisting of 3 gram-negative bacteria, 5 gram-positive bacteria, and 2 yeasts is analyzed. The purity of a given barcode group is defined as the number of reads mapping to the most common genome in the group divided by the total number of reads in the group. The vast majority of the barcode groups have purities greater than 0.95 (Figure 6B). Relative abundance of the cell types is calculated by counting the raw reads and by counting the barcode groups, where the groups are assigned a cell type corresponding to the consensus of its member reads (Figure 6C). The abundance of reads and barcode groups track in roughly equal proportions, indicating that the cell populations are being sampled such that certain species are not contained in disproportionately small or large barcode groups. Plotting the aggregate coverage of all barcode groups from a single species indicates a high coverage across the entire genome, with few or no dropout regions (Figure 7). The uniformity of coverage can be verified with a frequency distribution of normalized coverage values, with most values centered around the average (Figure 7, inset).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57598/57598fig1.jpg" /> 
Figure 1: Fabrication of microfluidic devices by photolithography. (A) Master molds with a single feature height are fabricated by spin coating a layer of SU-8 photoresist onto a silicon wafer. The photoresist is then patterned with a photolithographic mask and UV light, crosslinking the exposed SU-8. Finally, uncrosslinked SU-8 is dissolved in a developer bath. The resulting mold is used to cast PDMS which is bonded to a glass slide to produce the complete microfluidic device. (B) For a double-layer device, the fabrication similarly begins with spin coating and exposure steps. These steps are then repeated to create a two-layer device. <a href="/files/ftp_upload/57598/57598fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57598/57598fig2.jpg" /> 
Figure 2: Overview of the SiC-seq workflow. (A) A microbial suspension is co-flowed with molten agarose in a dropmaker device to encapsulate single cells in microgels. (B) The microgels are subjected to a series of washes to purify the bacterial genomic DNA. Lytic enzymes digest the cell walls of gram-positive bacteria and yeasts, and detergent solubilizes the cellular debris. The microgels are re-encapsulated into droplets for the tagmentation to reduce cross-contamination. (C) The microfluidic merger combines a digital PCR barcode, a tagmented microgel genome, and an amplification mix at a rate &#62;1 kHz. Off-chip SOE-PCR splices a unique single-cell barcode onto the tagmented genome and selectively amplifies fully barcoded constructs. <a href="/files/ftp_upload/57598/57598fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57598/57598fig3.jpg" /> 
Figure 3: Microfluidic devices for dropmaking and microgel re-encapsulation. (A) This panel shows a co-flow dropmaker (25 &#181;m of feature height). Cells and molten agarose are introduced into the device at equal flow rates to produce 25 &#181;m droplets at a 25 &#181;m x 25 &#181;m junction. For the digital barcode dropmaking, the cell inlet is plugged, and a PCR mix is introduced into the agarose inlet. (B) This panel shows a microgel re-encapsulation device (25 &#181;m of feature height). The microgels flow into a funnel-shaped inlet to maintain their close-packed ordering and receive a volume of tagmentation mix prior to the re-encapsulation at a 25 &#181;m x 30 &#181;m junction. <a href="/files/ftp_upload/57598/57598fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57598/57598fig4.jpg" /> 
Figure 4: Micrographs of droplets and microgels. (A) This panel shows washed 25 &#181;m microgels prior to enzymatic lysis. The bacteria are fluorescently stained for the quantification of the encapsulation rate. Poisson loading statistics dictate that the cells should be encapsulated at a rate of 1 in 10 drops or less to minimize the frequency of multiple-encapsulation events. (B) This panel shows a fluorescence microscopy image of 25 &#181;m digital barcode droplets treated with a nucleic acid stain. The droplets containing amplified barcode fragments produce a strong fluorescence signal. (C) This panel shows microgels re-encapsulated in 50 &#181;m drops. The close-packing of the microgels allows for encapsulation rates approaching 1 gel per drop with few doublets. <a href="/files/ftp_upload/57598/57598fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57598/57598fig5.jpg" /> 
Figure 5: Microfluidic double merger device for single-cell genome barcoding. A two-step merger operation pairs barcode droplets with tagmented genomes at a high-throughput. A droplet of PCR mix is first generated and merged with a barcode droplet in the region shown in yellow using saltwater electrodes. Next, a droplet containing a microgel is introduced and merged a second time in the region shown in red. Oil inlets allow for precise control of the spacing between the reinjected droplets. The barcode reinjection chamber and its spacer oil are placed on the shorter 25 &#181;m layer, shaded in blue. All other device features belong to the thicker layer with 45 &#181;m of total height. <a href="/files/ftp_upload/57598/57598fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/57598/57598fig6.jpg" /> 
Figure 6: Barcode group metrics for a 10-cell synthetic microbial community. (A) This panel shows the distribution of the barcode group sizes. The number of groups of a given size decreases exponentially as the group size increases. A minimum threshold of 7.5 kbps per group limits the analysis to groups with a sufficient amount of information and removes the PCR-mutated sequence &#34;orphans.&#34; (B) This panel shows the distribution of barcode group purities. The vast majority (&#62;90%) of groups are of very high purity (&#62;95%). (C) This panel shows the relative abundance of 10 species calculated at the read and barcode group level. The 2 counting methods produce similar results, indicating that the barcode group sizes are consistent across species. <a href="/files/ftp_upload/57598/57598fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/57598/57598fig7.jpg" /> 
Figure 7: Aggregate genomic coverage of Bacillus subtilis barcode groups. The reads from all the barcode groups mapping to the bacterium B. subtilis (N = 9,398) are pooled and analyzed in aggregate. A circular coverage map illustrates the coverage uniformity of the SiC-seq reads, with no observable dropout regions. A dashed line around the circumference indicates the average coverage (5.55x). The inset histogram of the relative coverage frequencies shows that a bulk of the bases are covered at a depth near the genome-wide average, represented by the dashed line. <a href="/files/ftp_upload/57598/57598fig7large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Device</td>
			<td>1st Layer Height (&#181;m)</td>
			<td>1st Layer Spin Speed (rpm)</td>
			<td>2nd Layer Height (&#181;m)</td>
			<td>2nd Layer Spin Speed (rpm)</td>
		</tr>
		<tr>
			<td>Co-flow dropmaker</td>
			<td>25</td>
			<td>4000</td>
			<td>N/A</td>
			<td>N/A</td>
		</tr>
		<tr>
			<td>Gel re-encapsulator</td>
			<td>25</td>
			<td>4000</td>
			<td>N/A</td>
			<td>N/A</td>
		</tr>
		<tr>
			<td>Double merger</td>
			<td>25</td>
			<td>4000</td>
			<td>20</td>
			<td>5000</td>
		</tr>
	</tbody>
</table>
Table 1: Microfluidic device fabrication parameters. This table shows a listing of the microfluidic devices used in the SiC-seq workflow with their required speeds for photoresist spin coating (based on the manufacturer&#39;s specifications for SU-8 3025).
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Label</td>
			<td colspan="5">Sequence (5&#39; &#62; 3&#39;)</td>
		</tr>
		<tr>
			<td>BAR</td>
			<td colspan="5">GCAGCTGGCGTAATAGCGAGTACAATCTGCTCTGATGCCGCATAGNNNNNNNNNNNNNNNTAAGCCAGCCCCGACACT</td>
		</tr>
		<tr>
			<td>DNA_BAR</td>
			<td colspan="5">CTGTCTCTTATACACATCTCCGAGCCCACGAGACGTGTCGGGGCTGGCTTA</td>
		</tr>
		<tr>
			<td>P7_BAR</td>
			<td colspan="5">CAAGCAGAAGACGGCATACGAGATCAGCTGGCGTAATAGCG</td>
		</tr>
		<tr>
			<td>P5_DNA</td>
			<td colspan="5">AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC</td>
		</tr>
		<tr>
			<td>I7_READ</td>
			<td colspan="5">GCCCACGAGACGTGTCGGGGCTGGCTTA</td>
		</tr>
	</tbody>
</table>
Table 2: Primer sequences.
Supplemental File 1: <a href="/files/ftp_upload/57598/Suppl_File_1-SiC-seq_device_masks.dwg" target="_blank">Please click here to download this file.</a>
Supplemental File 2: <a href="/files/ftp_upload/57598/Suppl_File_2-centrifuge_syringe_holder_1mL.dwg" target="_blank">Please click here to download this file.</a>

Watch this Scientific Journal Video about An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing at JoVE.com

An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing

Single-cell sequencing reveals genotypic heterogeneity in biological systems, but current technologies lack the throughput necessary for the deep profiling of community composition and function. Here, we describe a microfluidic workflow for sequencing &gt;50,000 single-cell genomes from diverse cell populations.

Sequencing technologies have undergone a paradigm shift from bulk to single-cell resolution in response to an evolving understanding of the role of ...

an-ultrahigh-throughput-microfluidic-platform-for-single-cell-genome

Research

JoVE Journal

Bioengineering

17.5K Views.  University of California, San Francisco. Single-cell sequencing reveals genotypic heterogeneity in biological systems, but current technologies lack the throughput necessary for the deep profiling of community composition and function. Here, we describe a microfluidic workflow for sequencing >50,000 single-cell genomes from diverse cell populations.

Video: An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing

High Throughput MicroRNA Profiling: Optimized Multiplex qRT-PCR at Nanoliter Scale on the Fluidigm Dynamic ArrayTM IFCs

The broad involvement of miRNAs in critical processes underlying development, tissue homoeostasis and disease has led to a surging interest among the research and pharmaceutical communities. To study miRNAs, it is essential that the quantification of microRNA levels is accurate and robust. By comparing wild-type to small RNA deficient mouse embryonic stem cells (mESC), we revealed a lack of accuracy and robustness in previous published multiplex qRT-PCR techniques. Here, we describe an optimized method, including purifying away excessive primers from previous multiplex steps before singleplex real time detection, which dramatically increases the accuracy and robustness of the technique. Furthermore, we explain how performing the technique on a microfluidic chip at nanoliter volumes significantly reduces reagent costs and permits time effective high throughput miRNA expression profiling.

Here we describe an optimized multiplex reverse transcriptase quantitative PCR (qRT-PCR) protocol in combination with a microfluidic platform as a cost and time effective high-throughput screening tool for microRNA (miRNA) expression levels, especially when working with limited amounts of sample.

The broad involvement of miRNAs in critical processes underlying development, tissue homoeostasis and disease has led to a surging interest among the ...

High-throughput Protein Expression Generator Using a Microfluidic Platform

Rapidly increasing fields, such as systems biology, require the development and implementation of new technologies, enabling high-throughput and high-fidelity measurements of large systems. Microfluidics promises to fulfill many of these requirements, such as performing high-throughput screening experiments on-chip, encompassing biochemical, biophysical, and cell-based assays1. Since the early days of microfluidics devices, this field has drastically evolved, leading to the development of microfluidic large-scale integration2,3. This technology allows for the integration of thousands of micromechanical valves on a single device with a postage-sized footprint (Figure 1). We have developed a high-throughput microfluidic platform for generating in vitro expression of protein arrays (Figure 2) named PING (Protein Interaction Network Generator). These arrays can serve as a template for many experiments such as protein-protein 4, protein-RNA5 or protein-DNA6 interactions.
The device consist of thousands of reaction chambers, which are individually programmed using a microarrayer. Aligning of these printed microarrays to microfluidics devices programs each chamber with a single spot eliminating potential contamination or cross-reactivity Moreover, generating microarrays using standard microarray spotting techniques is also very modular, allowing for the arraying of proteins7, DNA8, small molecules, and even colloidal suspensions. The potential impact of microfluidics on biological sciences is significant. A number of microfluidics based assays have already provided novel insights into the structure and function of biological systems, and the field of microfluidics will continue to impact biology.

We present a microfluidic approach for the expression of protein arrays. The device consists of thousands of reaction chambers controlled by micro-mechanical valves. The microfluidic device is mated to a microarray-printed gene library. These genes are then transcribed and translated on-chip, resulting in a protein array ready for experimental use.

Rapidly increasing fields, such as systems biology, require the development and implementation of new technologies, enabling high-throughput and ...

High Throughput Single-cell and Multiple-cell Micro-encapsulation

Microfluidic encapsulation methods have been previously utilized to capture cells in picoliter-scale aqueous, monodisperse drops, providing confinement from a bulk fluid environment with applications in high throughput screening, cytometry, and mass spectrometry. We describe a method to not only encapsulate single cells, but to repeatedly capture a set number of cells (here we demonstrate one- and two-cell encapsulation) to study both isolation and the interactions between cells in groups of controlled sizes. By combining drop generation techniques with cell and particle ordering, we demonstrate controlled encapsulation of cell-sized particles for efficient, continuous encapsulation. Using an aqueous particle suspension and immiscible fluorocarbon oil, we generate aqueous drops in oil with a flow focusing nozzle. The aqueous flow rate is sufficiently high to create ordering of particles which reach the nozzle at integer multiple frequencies of the drop generation frequency, encapsulating a controlled number of cells in each drop. For representative results, 9.9 &mu;m polystyrene particles are used as cell surrogates. This study shows a single-particle encapsulation efficiency Pk=1 of 83.7% and a double-particle encapsulation efficiency Pk=2 of 79.5% as compared to their respective Poisson efficiencies of 39.3% and 33.3%, respectively. The effect of consistent cell and particle concentration is demonstrated to be of major importance for efficient encapsulation, and dripping to jetting transitions are also addressed. 
Introduction 
Continuous media aqueous cell suspensions share a common fluid environment which allows cells to interact in parallel and also homogenizes the effects of specific cells in measurements from the media. High-throughput encapsulation of cells into picoliter-scale drops confines the samples to protect drops from cross-contamination, enable a measure of cellular diversity within samples, prevent dilution of reagents and expressed biomarkers, and amplify signals from bioreactor products. Drops also provide the ability to re-merge drops into larger aqueous samples or with other drops for intercellular signaling studies.1,2 The reduction in dilution implies stronger detection signals for higher accuracy measurements as well as the ability to reduce potentially costly sample and reagent volumes.3 Encapsulation of cells in drops has been utilized to improve detection of protein expression,4 antibodies,5,6 enzymes,7 and metabolic activity8 for high throughput screening, and could be used to improve high throughput cytometry.9 Additional studies present applications in bio-electrospraying of cell containing drops for mass spectrometry10 and targeted surface cell coatings.11 Some applications, however, have been limited by the lack of ability to control the number of cells encapsulated in drops. Here we present a method of ordered encapsulation12 which increases the demonstrated encapsulation efficiencies for one and two cells and may be extrapolated for encapsulation of a larger number of cells.
To achieve monodisperse drop generation, microfluidic "flow focusing" enables the creation of controllable-size drops of one fluid (an aqueous cell mixture) within another (a continuous oil phase) by using a nozzle at which the streams converge.13 For a given nozzle geometry, the drop generation frequency f and drop size can be altered by adjusting oil and aqueous flow rates Qoil and Qaq. As the flow rates increase, the flows may transition from drop generation to unstable jetting of aqueous fluid from the nozzle.14 
When the aqueous solution contains suspended particles, particles become encapsulated and isolated from one another at the nozzle. For drop generation using a randomly distributed aqueous cell suspension, the average fraction of drops Dk containing k cells is dictated by Poisson statistics, where Dk = &lambda;k exp(-&lambda;)/(k!) and &lambda; is the average number of cells per drop. The fraction of cells which end up in the "correctly" encapsulated drops is calculated using Pk = (k x Dk)/&Sigma;(k' x Dk'). The subtle difference between the two metrics is that Dk relates to the utilization of aqueous fluid and the amount of drop sorting that must be completed following encapsulation, and Pk relates to the utilization of the cell sample. As an example, one could use a dilute cell suspension (low &lambda;) to encapsulate drops where most drops containing cells would contain just one cell. While the efficiency metric Pk would be high, the majority of drops would be empty (low Dk), thus requiring a sorting mechanism to remove empty drops, also reducing throughput.15
Combining drop generation with inertial ordering provides the ability to encapsulate drops with more predictable numbers of cells per drop and higher throughputs than random encapsulation. Inertial focusing was first discovered by Segre and Silberberg16 and refers to the tendency of finite-sized particles to migrate to lateral equilibrium positions in channel flow. Inertial ordering refers to the tendency of the particles and cells to passively organize into equally spaced, staggered, constant velocity trains. Both focusing and ordering require sufficiently high flow rates (high Reynolds number) and particle sizes (high Particle Reynolds number).17,18 Here, the Reynolds number Re =uDh/&nu; and particle Reynolds number Rep =Re(a/Dh)2, where u is a characteristic flow velocity, Dh [=2wh/(w+h)] is the hydraulic diameter, &nu; is the kinematic viscosity, a is the particle diameter, w is the channel width, and h is the channel height. Empirically, the length required to achieve fully ordered trains decreases as Re and Rep increase. Note that the high Re and Rep requirements (for this study on the order of 5 and 0.5, respectively) may conflict with the need to keep aqueous flow rates low to avoid jetting at the drop generation nozzle. Additionally, high flow rates lead to higher shear stresses on cells, which are not addressed in this protocol. The previous ordered encapsulation study demonstrated that over 90% of singly encapsulated HL60 cells under similar flow conditions to those in this study maintained cell membrane integrity.12 However, the effect of the magnitude and time scales of shear stresses will need to be carefully considered when extrapolating to different cell types and flow parameters. The overlapping of the cell ordering, drop generation, and cell viability aqueous flow rate constraints provides an ideal operational regime for controlled encapsulation of single and multiple cells.
Because very few studies address inter-particle train spacing,19,20 determining the spacing is most easily done empirically and will depend on channel geometry, flow rate, particle size, and particle concentration. Nonetheless, the equal lateral spacing between trains implies that cells arrive at predictable, consistent time intervals. When drop generation occurs at the same rate at which ordered cells arrive at the nozzle, the cells become encapsulated within the drop in a controlled manner. This technique has been utilized to encapsulate single cells with throughputs on the order of 15 kHz,12 a significant improvement over previous studies reporting encapsulation rates on the order of 60-160 Hz.4,15 In the controlled encapsulation work, over 80% of drops contained one and only one cell, a significant efficiency improvement over Poisson (random) statistics, which predicts less than 40% efficiency on average.12
In previous controlled encapsulation work,12 the average number of particles per drop &lambda; was tuned to provide single-cell encapsulation. We hypothesize that through tuning of flow rates, we can efficiently encapsulate any number of cells per drop when &lambda; is equal or close to the number of desired cells per drop. While single-cell encapsulation is valuable in determining individual cell responses from stimuli, multiple-cell encapsulation provides information relating to the interaction of controlled numbers and types of cells. Here we present a protocol, representative results using polystyrene microspheres, and discussion for controlled encapsulation of multiple cells using a passive inertial ordering channel and drop generation nozzle.

Combining monodisperse drop generation with inertial ordering of cells and particles, we describe a method to encapsulate a desired number of cells or particles in a single drop at kHz rates. We demonstrate efficiencies twice exceeding those of unordered encapsulation for single- and double-particle drops.

Microfluidic encapsulation methods have been previously utilized to capture cells in picoliter-scale aqueous, monodisperse drops, providing confinement ...

A Versatile Automated Platform for Micro-scale Cell Stimulation Experiments

Study of cells in culture (in vitro analysis) has provided important insight into complex biological systems. Conventional methods and equipment for in vitro analysis are well suited to study of large numbers of cells (&ge;105) in milliliter-scale volumes (&ge;0.1 ml). However, there are many instances in which it is necessary or desirable to scale down culture size to reduce consumption of the cells of interest and/or reagents required for their culture, stimulation, or processing. Unfortunately, conventional approaches do not support precise and reproducible manipulation of micro-scale cultures, and the microfluidics-based automated systems currently available are too complex and specialized for routine use by most laboratories. To address this problem, we have developed a simple and versatile technology platform for automated culture, stimulation, and recovery of small populations of cells (100 - 2,000 cells) in micro-scale volumes (1 - 20 &mu;l). The platform consists of a set of fibronectin-coated microcapillaries ("cell perfusion chambers"), within which micro-scale cultures are established, maintained, and stimulated; a digital microfluidics (DMF) device outfitted with "transfer" microcapillaries ("central hub"), which routes cells and reagents to and from the perfusion chambers; a high-precision syringe pump, which powers transport of materials between the perfusion chambers and the central hub; and an electronic interface that provides control over transport of materials, which is coordinated and automated via pre-determined scripts. As an example, we used the platform to facilitate study of transcriptional responses elicited in immune cells upon challenge with bacteria. Use of the platform enabled us to reduce consumption of cells and reagents, minimize experiment-to-experiment variability, and re-direct hands-on labor. Given the advantages that it confers, as well as its accessibility and versatility, our platform should find use in a wide variety of laboratories and applications, and prove especially useful in facilitating analysis of cells and stimuli that are available in only limited quantities.

We have developed an automated cell culture and interrogation platform for micro-scale cell stimulation experiments. The platform offers simple, versatile, and precise control in cultivating and stimulating small populations of cells, and recovering lysates for molecular analyses. The platform is well suited to studies that use precious cells and/or reagents.

Study of cells in culture (in vitro analysis) has provided important insight into complex biological systems. Conventional methods and equipment for in ...

A Microfluidic Chip for the Versatile Chemical Analysis of Single Cells

We present a microfluidic device that enables the quantitative determination of intracellular biomolecules in multiple single cells in parallel. For this purpose, the cells are passively trapped in the middle of a microchamber. Upon activation of the control layer, the cell is isolated from the surrounding volume in a small chamber. The surrounding volume can then be exchanged without affecting the isolated cell. However, upon short opening and closing of the chamber, the solution in the chamber can be replaced within a few hundred milliseconds. Due to the reversibility of the chambers, the cells can be exposed to different solutions sequentially in a highly controllable fashion, e.g. for incubation, washing, and finally, cell lysis. The tightly sealed microchambers enable the retention of the lysate, minimize and control the dilution after cell lysis. Since lysis and analysis occur at the same location, high sensitivity is retained because no further dilution or loss of the analytes occurs during transport. The microchamber design therefore enables the reliable and reproducible analysis of very small copy numbers of intracellular molecules (attomoles, zeptomoles) released from individual cells. Furthermore, many microchambers can be arranged in an array format, allowing the analysis of many cells at once, given that suitable optical instruments are used for monitoring. We have already used the platform for proof-of-concept studies to analyze intracellular proteins, enzymes, cofactors and second messengers in either relative or absolute quantifiable manner.

In this article we present a microfluidic chip for single cell analysis. It allows the quantification of intracellular proteins, enzymes, cofactors, and second messengers by means of fluorescent assays or immunoassays.&#160;

We present a microfluidic device that enables the quantitative determination of intracellular biomolecules in multiple single cells in parallel. For this ...

Sequencing of mRNA from Whole Blood using Nanopore Sequencing

Sequencing in remote locations and resource-poor settings presents unique challenges. Nanopore sequencing can be successfully used under such conditions, and was deployed to West Africa during the recent Ebola virus epidemic, highlighting this possibility. In addition to its practical advantages (low cost, ease of equipment transport and use), this technology also provides fundamental advantages over second-generation sequencing approaches, particularly the very long read length, ability to directly sequence RNA, and real-time availability of data. Raw read accuracy is lower than with other sequencing platforms, which represents the main limitation of this technology; however, this can be partially mitigated by the high read depth generated. Here, we present a field-compatible protocol for sequencing of the mRNAs encoding for Niemann-Pick C1, which is the cellular receptor for ebolaviruses. This protocol encompasses extraction of RNA from animal blood samples, followed by RT-PCR for target enrichment, barcoding, library preparation, and the sequencing run itself, and can be easily adapted for use with other DNA or RNA targets.

Nanopore sequencing is a novel technology that allows cost-effective sequencing in remote locations and resource-poor settings. Here, we present a protocol for sequencing of mRNAs from whole blood that is compatible with such conditions.

Sequencing in remote locations and resource-poor settings presents unique challenges. Nanopore sequencing can be successfully used under such conditions, ...

Genetics

High-Throughput Quantitative RT-PCR in Single and Bulk C. elegans Samples Using Nanofluidic Technology

This paper presents a high-throughput reverse transcription quantitative PCR (RT-qPCR) assay for Caenorhabditis elegans that is fast, robust, and highly sensitive. This protocol obtains precise measurements of gene expression from single worms or from bulk samples. The protocol presented here provides a novel adaptation of existing methods for complementary DNA (cDNA) preparation coupled to a nanofluidic RT-qPCR platform. The first part of this protocol, named &#8216;Worm-to-CT&#8217;, allows cDNA production directly from nematodes without the need for prior mRNA isolation. It increases experimental throughput by allowing the preparation of cDNA from 96 worms in 3.5 h. The second part of the protocol uses existing nanofluidic technology to run high-throughput RT-qPCR on the cDNA. This paper evaluates two different nanofluidic chips: the first runs 96 samples and 96 targets, resulting in 9,216 reactions in approximately 1.5 days of benchwork. The second chip type consists of six 12 x 12 arrays, resulting in 864 reactions. Here, the Worm-to-CT method is demonstrated by quantifying mRNA levels of genes encoding heat shock proteins from single worms and from bulk samples. Provided is an extensive list of primers designed to amplify processed RNA for the majority of coding genes within the C. elegans genome.

High-Throughput Quantitative RT-PCR in Single and Bulk C. elegans Samples Using Nanofluidic Technology

In this article a high-throughput protocol for fast and reliable determination of gene expression levels in single or bulk C. elegans samples is described. This protocol does not require RNA isolation and produces cDNA directly from samples. It can be used together with high-throughput multiplexed nanofluidic real-time qPCR platforms.

This paper presents a high-throughput reverse transcription quantitative PCR (RT-qPCR) assay for Caenorhabditis elegans that is fast, robust, and highly ...

A Microfluidic Platform for High-throughput Single-cell Isolation and Culture

Studying the heterogeneity of single cells is crucial for many biological questions, but is technically difficult. Thus, there is a need for a simple, yet high-throughput, method to perform single-cell culture experiments. Here, we report a microfluidic chip-based strategy for high-efficiency single-cell isolation (~77%) and demonstrate its capability of performing long-term single-cell culture (up to 7 d) and cellular heterogeneity analysis using clonogenic assay. These applications were demonstrated with KT98 mouse neural stem cells, and A549 and MDA-MB-435 human cancer cells. High single-cell isolation efficiency and long-term culture capability are achieved by using different sizes of microwells on the top and bottom of the microfluidic channel. The small microwell array is designed for precisely isolating single-cells, and the large microwell array is used for single-cell clonal culture in the microfluidic chip. This microfluidic platform constitutes an attractive approach for single-cell culture applications, due to its flexibility of adjustable cell culture spaces for different culture strategies, without decreasing isolation efficiency.

Here, we present a protocol for isolating and culturing single cells with a microfluidic platform, which utilizes a new microwell design concept to allow for high-efficiency single cell isolation and long-term clonal culture.

Studying the heterogeneity of single cells is crucial for many biological questions, but is technically difficult. Thus, there is a need for a simple, yet ...

Ultra-long Read Sequencing for Whole Genomic DNA Analysis

Third generation single-molecule DNA sequencing technologies offer significantly longer read length that can facilitate the assembly of complex genomes and analysis of complex structural variants. Nanopore platforms perform single-molecule sequencing by directly measuring the current changes mediated by DNA passage through the pores and can generate hundreds of kilobase (kb) reads with minimal capital cost. This platform has been adopted by many researchers for a variety of applications. Achieving longer sequencing read lengths is the most critical factor to leverage the value of nanopore sequencing platforms. To generate ultra-long reads, special consideration is required to avoid DNA breakages and gain efficiency to generate productive sequencing templates. Here, we provide the detailed protocol of ultra-long DNA sequencing including high molecular weight (HMW) DNA extraction from fresh or frozen cells, library construction by mechanical shearing or transposase fragmentation, and sequencing on a nanopore device. From 20-25 &#181;g of HMW DNA, the method can achieve N50 read length of 50-70 kb with mechanical shearing and N50 of 90-100 kb read length with transposase mediated fragmentation. The protocol can be applied to DNA extracted from mammalian cells to perform whole genome sequencing for the detection of structural variants and genome assembly. Additional improvements on the DNA extraction and enzymatic reactions will further increase the read length and expand its utility.

Long-read sequences greatly facilitate the assembly of complex genomes and characterization of structural variation. We describe a method to generate ultra-long sequences by nanopore-based sequencing platforms. The approach adopts an optimized DNA extraction followed by modified library preparations to generate hundreds of kilobase reads with moderate coverage from human cells.

Third generation single-molecule DNA sequencing technologies offer significantly longer read length that can facilitate the assembly of complex genomes ...

A Multilayer Microfluidic Platform for the Conduction of Prolonged Cell-Free Gene Expression

The limitations of cell-based synthetic biology are becoming increasingly apparent as researchers aim to develop larger and more complex synthetic genetic regulatory circuits. The analysis of synthetic genetic regulatory networks in vivo is time consuming and suffers from a lack of environmental control, with exogenous synthetic components interacting with host processes resulting in undesired behavior. To overcome these issues, cell-free characterization of novel circuitry is becoming more prevalent. In vitro transcription and translation (IVTT) mixtures allow the regulation of the experimental environment and can be optimized for each unique system. The protocols presented here detail the fabrication of a multilayer microfluidic device that can be utilized to sustain IVTT reactions for prolonged durations. In contrast to batch reactions, where resources are depleted over time and (by-) products accumulate, the use of microfluidic devices allows the replenishment of resources as well as the removal of reaction products. In this manner, the cellular environment is emulated by maintaining an out-of-equilibrium environment in which the dynamic behavior of gene circuits can be investigated over extended periods of time. To fully exploit the multilayer microfluidic device, hardware and software have been integrated to automate the IVTT reactions. By combining IVTT reactions with the microfluidic platform presented here, it becomes possible to comprehensively analyze complex network behaviors, furthering our understanding of the mechanisms that regulate cellular processes.

The fabrication process of a PDMS-based, multilayer, microfluidic device that allows in vitro transcription and translation (IVTT) reactions to be performed over prolonged periods is described. Furthermore, a comprehensive overview of the hardware and software required to automate and maintain these reactions for prolonged durations is provided.

The limitations of cell-based synthetic biology are becoming increasingly apparent as researchers aim to develop larger and more complex synthetic genetic ...

An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing

Summary

Explore More Videos

Chapters in this video

High Throughput MicroRNA Profiling: Optimized Multiplex qRT-PCR at Nanoliter Scale on the Fluidigm Dynamic ArrayTM IFCs

High-throughput Protein Expression Generator Using a Microfluidic Platform

High Throughput Single-cell and Multiple-cell Micro-encapsulation

A Versatile Automated Platform for Micro-scale Cell Stimulation Experiments

A Microfluidic Chip for the Versatile Chemical Analysis of Single Cells

Sequencing of mRNA from Whole Blood using Nanopore Sequencing

High-Throughput Quantitative RT-PCR in Single and Bulk C. elegans Samples Using Nanofluidic Technology

A Microfluidic Platform for High-throughput Single-cell Isolation and Culture

Ultra-long Read Sequencing for Whole Genomic DNA Analysis

A Multilayer Microfluidic Platform for the Conduction of Prolonged Cell-Free Gene Expression