Diese Arbeit wurde unterstützt von der National Science Foundation durch den CAREER Award (Grant-Nummer DBI-1253293); die National Institute of Health (NIH) (Zuschuss Zahlen HG007233-01, R01-EB019453-01, 1R21HG007233, DP2-AR068129-01, R01-HG008978); und das Defense Advanced Research Projekte Agentur Leben Gießereien Programm (Vertragsnummern HR0011-12-C-0065, N66001-12-C-4211, HR0011-12-C-0066).

<ol>
	<li>Navin, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumour+evolution+inferred+by+single-cell+sequencing.">Tumour evolution inferred by single-cell sequencing.</a> Nature. 472 (7341), 90-94 (2011).</li><li>Ni, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reproducible+copy+number+variation+patterns+among+single+circulating+tumor+cells+of+lung+cancer+patients.">Reproducible copy number variation patterns among single circulating tumor cells of lung cancer patients.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (52), 21083-21088 (2013).</li><li>Schmidt, H., Hensel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogenicity+islands+in+bacterial+pathogenesis.">Pathogenicity islands in bacterial pathogenesis.</a> Clinical Microbiology Reviews. 17, 14-56 (2004).</li><li>Mart&#237;nez, J. L., Baquero, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+among+strategies+associated+with+bacterial+infection:+pathogenicity+epidemicity,+and+antibiotic+resistance.">Interactions among strategies associated with bacterial infection: pathogenicity epidemicity, and antibiotic resistance.</a> Clinical Microbiology Reviews. 15 (4), 647-679 (2002).</li><li>Rinke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Obtaining+genomes+from+uncultivated+environmental+microorganisms+using+FACS-based+single-cell+genomics.">Obtaining genomes from uncultivated environmental microorganisms using FACS-based single-cell genomics.</a> Nature Protocols. 9 (5), 1038-1048 (2014).</li><li>Rinke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+the+phylogeny+and+coding+potential+of+microbial+dark+matter.">Insights into the phylogeny and coding potential of microbial dark matter.</a> Nature. 499 (7459), 431-437 (2013).</li><li>Zhang, H., Liu, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+tweezers+for+single+cells.">Optical tweezers for single cells.</a> Journal of the Royal Society Interface. 5 (24), 671-690 (2008).</li><li>Xu, L., Brito, I. L., Alm, E. J., Blainey, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virtual+microfluidics+for+digital+quantification+and+single-cell+sequencing.">Virtual microfluidics for digital quantification and single-cell sequencing.</a> Nature Methods. 13 (9), 759-762 (2016).</li><li>Gawad, C., Koh, W., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+the+clonal+origins+of+childhood+acute+lymphoblastic+leukemia+by+single-cell+genomics.">Dissecting the clonal origins of childhood acute lymphoblastic leukemia by single-cell genomics.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (50), 17947-17952 (2014).</li><li>Macosko, E. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+parallel+genome-wide+expression+profiling+of+individual+cells+using+nanoliter+droplets.">Highly parallel genome-wide expression profiling of individual cells using nanoliter droplets.</a> Cell. 161 (5), 1202-1214 (2015).</li><li>Klein, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+barcoding+for+single-cell+transcriptomics+applied+to+embryonic+stem+cells.">Droplet barcoding for single-cell transcriptomics applied to embryonic stem cells.</a> Cell. 161 (5), 1187-1201 (2015).</li><li>Rotem, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+single-cell+labeling+(Hi-SCL)+for+RNA-Seq+using+drop-based+microfluidics.">High-throughput single-cell labeling (Hi-SCL) for RNA-Seq using drop-based microfluidics.</a> PLoS One. 10 (5), 1-14 (2015).</li><li>Amini, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Haplotype-resolved+whole-genome+sequencing+by+contiguity-preserving+transposition+and+combinatorial+indexing.">Haplotype-resolved whole-genome sequencing by contiguity-preserving transposition and combinatorial indexing.</a> Nature Reviews Genetics. 46 (12), 1343-1349 (2014).</li><li>Zheng, G. X. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Haplotyping+germline+and+cancer+genomes+with+high-throughput+linked-read+sequencing.">Haplotyping germline and cancer genomes with high-throughput linked-read sequencing.</a> Nature Biotechnology. 34 (3), 303-311 (2016).</li><li>Lan, F., Haliburton, J. R., Yuan, A., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+barcoding+for+massively+parallel+single-molecule+deep+sequencing.">Droplet barcoding for massively parallel single-molecule deep sequencing.</a> Nature Communications. 7, 11784 (2016).</li><li>Rotem, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+ChIP-seq+reveals+cell+subpopulations+defined+by+chromatin+state.">Single-cell ChIP-seq reveals cell subpopulations defined by chromatin state.</a> Nature Biotechnology. 33 (11), 1165-1172 (2015).</li><li>Lan, F., Demaree, B., Ahmed, N., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+genome+sequencing+at+ultra-high-throughput+with+microfluidic+droplet+barcoding.">Single-cell genome sequencing at ultra-high-throughput with microfluidic droplet barcoding.</a> Nature Biotechnology. 35 (7), 640-646 (2017).</li><li>Novak, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+multiplex+gene+detection+and+sequencing+with+microfluidically+generated+agarose+emulsions.">Single-cell multiplex gene detection and sequencing with microfluidically generated agarose emulsions.</a> Angewandte Chemie Internation Edition. 50 (2), 390-395 (2011).</li><li>Gill, C., Van De Wijgert, J. H. H. M., Blow, F., Darby, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+lysis+methods+for+the+extraction+of+bacterial+DNA+for+analysis+of+the+vaginal+microbiota.">Evaluation of lysis methods for the extraction of bacterial DNA for analysis of the vaginal microbiota.</a> PLoS One. 11 (9), 1-16 (2016).</li><li>Picelli, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tn5+transposase+and+tagmentation+procedures+for+massively+scaled+sequencing+projects.">Tn5 transposase and tagmentation procedures for massively scaled sequencing projects.</a> Genome Research. 24 (12), 2033-2040 (2014).</li><li>Abate, A. R., Chen, C. H., Agresti, J. J., Weitz, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beating+Poisson+encapsulation+statistics+using+close-packed+ordering.">Beating Poisson encapsulation statistics using close-packed ordering.</a> Lab on a Chip. 9 (18), 2628 (2009).</li><li>Jain, A., Yang, A. H. J., Erickson, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gel-based+optical+waveguides+with+live+cell+encapsulation+and+integrated+microfluidics.">Gel-based optical waveguides with live cell encapsulation and integrated microfluidics.</a> Optic Letters. 37 (9), 1472 (2012).</li><li>Karbaschi, M., Shahi, P., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+chemical-free+breaking+of+microfluidic+emulsions+with+a+hand-held+antistatic+gun.">Rapid chemical-free breaking of microfluidic emulsions with a hand-held antistatic gun.</a> Biomicrofluidics. 11 (4), 1-6 (2017).</li><li>Gole, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+polymerase+cloning+and+genome+sequencing+of+single+cells+using+nanoliter+microwells.">Massively parallel polymerase cloning and genome sequencing of single cells using nanoliter microwells.</a> Nature Biotechnology. 31 (12), 1126-1132 (2013).</li><li>Chao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metagenomic+analysis+reveals+significant+changes+of+microbial+compositions+and+protective+functions+during+drinking+water+treatment.">Metagenomic analysis reveals significant changes of microbial compositions and protective functions during drinking water treatment.</a> Scientific Reports. 3 (1), 3550 (2013).</li><li>Fierer, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-biome+metagenomic+analyses+of+soil+microbial+communities+and+their+functional+attributes.">Cross-biome metagenomic analyses of soil microbial communities and their functional attributes.</a> Proceedings of the National Academy of Sciences of the United States of America. 109 (52), 21390-21395 (2012).</li><li>Mande, S. S., Mohammed, M. H., Ghosh, T. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Classification+of+metagenomic+sequences:+methods+and+challenges.">Classification of metagenomic sequences: methods and challenges.</a> Briefings in Bioinformatics. 13 (6), 669-681 (2012).</li><li>Eastburn, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+droplet+enrichment+for+targeted+sequencing.">Microfluidic droplet enrichment for targeted sequencing.</a> Nucleic Acids Research. 43 (13), e86 (2015).</li><li>Clark, I. C., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Finding+a+helix+in+a+haystack:+nucleic+acid+cytometry+with+droplet+microfluidics.">Finding a helix in a haystack: nucleic acid cytometry with droplet microfluidics.</a> Lab on a Chip. 17 (12), 2032-2045 (2017).</li></ol>

Patente im Zusammenhang mit diesem Workflow wird vielleicht an Mission Bio, von welchen Adam R. Abate lizenziert ein Aktionär.

Die SiC-Seq mikrofluidischen Workflow produziert einzellige Genom-Sequenzierungsdaten von Tausenden von Bakterienzellen. Digitalen Barcodes gespleißt auf die Genome der Microgel-gekapselte Zellen ermöglichen die in Silico Dekonvolution NGS Daten in Gruppen von Barcodes liest aus derselben Zelle. Ein kontrollexperiment mit einer mikrobiellen Gemeinschaft von bekannter Zusammensetzung ist notwendig für die Beurteilung der Reinheit der Barcode-Gruppen. Ein großer Teil der Low-Reinheit Gruppen zeigt, dass die Zelle Kapselung Rate zu hoch ist oder gibt es erhebliche Tröpfchen Cross-Kontamination während der mikrofluidischen Verarbeitungsschritte auftreten. Poisson Statistiken zufolge sollte die Barcodes und Zellen in einem Ziel-Verhältnis von 1 Teilchen für jeden 10 Tropfen, die Rate der mehrere Kapselung Ereignisse auf weniger als 5 % von allen nicht-leere Tröpfchen zu begrenzen gekapselt werden. Eine Kapselung-Rate höher als dies steigt die Preise von Dubletten exponentiell, so ist die Überprüfung der Kapselung Verhältnis während des Dropmaking-Prozesses von entscheidender Bedeutung. Nutzer sollten die Kapselung von mehreren Zellen in eine einzelne Microgel besonders vorsichtig sein, da liest aus verschiedenen Zellen teilen die gleiche Barcode-Sequenz Bioinformatically getrennt werden können. Im Fall, dass 1 Zelle erhält 2 verschiedene Barcodes, die Barcode-Gruppe-Reinheit ist nicht betroffen, obwohl die Fülle Metriken verzerrt werden, wenn durch Barcode-Sequenz zählen.
Droplet Cross-Kontamination auch durch suboptimale Fusion Bedingungen entstehen können. Bei einer erfolgreichen Operation kann mikrofluidischen Fusion Gerät (Abbildung 5) kontrollierbar 1 Barcode-Tropfen mit 1 Microgel und einem Volumen von PCR-Reagenz koppeln. Non-Ideal Flussraten führt ein Tröpfchen Paarung bei falschen Verhältnisse: 1 Barcode könnte zum Beispiel mit 2 mikrogele gekoppelt werden. Alle Durchflussmengen im Protokoll aufgeführten sollen Schätzungen und können je nach geringfügige Abweichungen in der Geometrie und Tröpfchen Gerätegrößen angepasst werden müssen. Benutzer mit Zugriff auf Kameras mit High-Speed-Aufnahme-Funktionen (> 10.000 Bilder/s) sollten die richtigen Tropfen Fusion zu Beginn und im Laufe der Operation mikrofluidischen überprüfen. Benutzer ohne Zugriff auf eine High-Speed-Kamera ein kleines Volumen der zusammengeführten Ausgabe sammeln und manuell messen die tröpfchengrößen unter dem Mikroskop. Die Tröpfchengröße sollte einheitlich sein: ein Übermaß an individuellen Barcodes oder Microgel Tropfen zeigt an, dass die Reinjektion entsprechend gesenkt werden sollte.
Mehrere werden allgemeine Vorkehrungen beim Umgang mit mikrogele und Microdroplets, ihre Integrität zu bewahren. Mikrogele, muss obwohl mechanisch robust, ausreichend vor den Bruch und Waschschritte dafür vollständig Gelierung gekühlt werden. Non-sphärische mikrogele sind ein Indiz, das die Agarose nicht ausreichend Zeit gegeben, zu festigen. Beim Waschen mikrogele spin-down die Suspensionen mit der erforderlichen Geschwindigkeit um ein Produkt zu vermeiden. Agarose Hydrogel hat einen Brechungsindex genau passend, das Wasser und kann schwierig sein, in ein Rohr22, zu sehen, so dass Benutzer die Gel-Liquid-Grenze vor Aspiration sorgfältig identifizieren sollte. Wasser-in-Öl-Tropfen sind anfällig für Koaleszenz durch den Aufbau von statischen Kräfte23 Labor Handschuhe und Schläuche. Aus diesem Grund empfehlen wir laden die Tröpfchen Reinjektion Spritzen mit bloßen Händen und behandeln die Reinjektion Linien mit einem Anti-Statik-Pistole vor die Pumpe ansaugen. Zusammengeführte große Tröpfchen können entfernt werden, durch langsam rotierende die Emulsionen in einer Spritze und manuell Absaugen von großen Tropfen, die in der Nähe der Spitze aufgrund ihrer größeren Auftrieb zu sammeln.
SiC-Seq ist die erste Technologie nachzuweisen einzellige Genomsequenzierung von > 50.000 Bakterienzellen. Diese Plattform bietet erhebliche Vorteile im Durchsatz über bestehende Ansätze und ermöglicht eine tiefere Probenahme von heterogenen mikrobieller Gemeinschaften. Bisher haben mikrofluidischen Technologien für einzellige Genom-Sequenzierung Microchambers9 und Mikrovertiefungen24 für Zelle Isolation und Verstärkung, aber mit Durchsätzen im Bereich von nur Dutzende bis Hunderte von Zellen eingesetzt. Der Fluss sortieren einzelner Zellen in Wellplates5,6 erfordert keine spezielle mikrofluidischen Instrumentation aber besitzt einen ähnlich geringen Durchsatz. Da die Boden- und Wasserproben aus der Umgebung häufig alpha Unterschiede haben > 1.000 auf die Spezies Stufe25,26, SiC-Seq ist ein großer Vorteil aufgrund seiner Fähigkeit, eine weit größere Anzahl von Organismen zu probieren. Die SiC-Seq-Workflow ist anpassungsfähig auf Zelle Eingaben von Laborkultur, die natürliche Umwelt oder eine lebende Host. Eine Zellprobe muss nur in einer wässrigen Suspension und frei von großen Partikeln (> 10 µm) für mikrofluidischen Kapselung geeignet. Beispielsweise wurde die Methode bereits zu einer Probe von Meerwasser mit Hilfe einer Reihe von Waschanlagen und Filterung Schritte aus, um die Zellen vor der Kapselung17Vorverarbeiten angewendet.
Die SiC-Seq-Protokoll generiert eine relativ spärliche Sequenzierung Datenmenge aus jeder einzelnen Zelle und möglicherweise nicht für alle Anwendungen geeignet. Einige Bioinformatik-Algorithmen wie de Novo Genom Montage oder Einzel-Nukleotid-Variante (SNV) aufrufen erfordern höhere Abdeckung tiefen, effektiv zu arbeiten. Stattdessen können Barcode Gruppen gruppierten in Silico taxonomische binning Methoden27 sein, so dass Algorithmen auf größere Sätze liest angewendet werden können. Die relativ niedrige Barcoding Gesamteffizienz der SiC-Seq-Workflow kann auch in Fällen Herausforderungen denen die Verfügbarkeit der eingabesample niedrig ist. SiC-Seq basiert auf einer Poisson-verteilten Barcode Kapselung Schritt, daher etwa 10 % der Zellen erhalten einen molekularen Barcode und werden während der abschließenden Bibliothek Vorbereitungsschritt verstärkt. Zwar ist dies vergleichbar mit anderen Microdroplet-basierte Barcode Systeme10, Benutzer arbeiten mit kostbaren Zellproben haben Schwierigkeiten, die die entsprechende Bibliothek Ausbeute für die Sequenzierung zu erreichen und möglicherweise müssen Sie die Anzahl der PCR-Zyklen im Finale zu erhöhen Verstärkung Schritt. Eine andere mögliche Lösung für Benutzer mit mikrofluidischen Expertise ist es, positive Barcode Tröpfchen Sortieren nach dem digitalen PCR Schritt, womit sich den Gesamtwirkungsgrad Barcoding auf > 85 %28.
Eine mögliche zukünftige Richtung für SiC-Seq-Technologie wird den Workflow für die Verwendung mit Säugerzellen, ebnet den Weg für neue klinische Studien der einzelligen angepasst. Als Beispiel, eine Analyse der die Kopie Nummer Unterschiede zwischen den einzelnen Krebs Zellen Mai unser Verständnis der Rolle der Heterogenität in Krebs Pathologie2weiter. Alternativ würde die Integration von SiC-Seq mit vorhandenen Methoden zur Sonde und DNA-Sequenzen von Interesse29 bereichern die gezielte einzellige Sequenzierung von Subpopulationen oder seltene Sorten von Zellen ermöglichen. Mit Umweltproben könnten Gene innerhalb einer bekannten Stoffwechselweg gezielt und Kontextuell neben benachbarte Gene zur Identifizierung neuartiger genomischer Inseln analysiert werden. Von innerhalb einer menschlichen Host-Umgebung, niedrige Titer Pathogene Bakterien Proben isoliert werden konnte und sequenziert einzellige Ebene mehr untersuchen eng ihre genotypischen Ursprünge der Virulenz.

Das Genom dient als eine Blaupause der zelluläre Identität und Funktion, mit der Gesamtheit des Organismus Potenzial Codierung ist. Ein Verständnis der zellulären Biologie an der Genom-Ebene kann die beobachteten phänotypische Vielfalt innerhalb heterogener Zell-Populationen erklären. Diese Heterogenität ist offensichtlich in biologischen Systemen und hat breite Auswirkungen auf die menschliche Gesundheit und Krankheit. Zum Beispiel sind Genvarianten Kopie Zahl unter den Tumorzellen, die Entwicklung und Ausbreitung von Krebs1,2verbunden. Bei bakteriellen Infektionen Pathogenitätsinseln vorhanden in einem kleinen Bruchteil der Genome horizontal übertragen werden können und führen zu der Verbreitung von Antibiotika-resistente Bakterien3,4. Eine primäre Herausforderung bei der Untersuchung der Genome der Ebene der einzelligen ist die geringe Mengen an DNA zur Verfügung sowie die Notwendigkeit, Tausende von Zellen zu analysieren, die ganze Vielfalt der Genotypen zu probieren. Aus diesen Gründen haben Einschränkungen in experimentelle Durchsatz die Wirksamkeit der einzelligen Studien, Vorspannen Ergebnisse in Richtung der am häufigsten vorkommenden Zellen verhindert. Einzellige ISOLIERUNGSTECHNIKEN wie Flow sortieren,5,6, optische Pinzette7, Einbettung in loser Schüttung Gele8und Mikrofluidik9 sind in der Lage hunderte von Zellen für die Sequenzierung; Dies ist jedoch nur einen kleinen Bruchteil von den meisten Proben. Eine Methode für einzellige Genom-Sequenzierung mit wesentlich höheren Durchsatz würde erlauben, tiefer und umfassender Profilierung der Zell-Populationen, damit Aufklärung die Rolle der genotypischen Vielfalt innerhalb dieser Gemeinschaften.
Droplet Mikrofluidik ermöglicht die Hochdurchsatz-Manipulation von Zellen und biologische Reagenzien innerhalb von Millionen von Picoliter-Skala Reaktoren. Heute, Microdroplet, die Technologien verwendet wurden, um differentielle Expression-Muster zwischen den Zellen von heterogenen Gewebe10,11,12, studieren tief Sequenz lange Moleküle13,14 ,15und Verhalten Chromatin Immunopräzipitation Sequenzierung (ChiP-Seq) Analysen auf Einzelzellen16. In der Tat sind Microdroplets hohem Durchsatz, unterteilte Operationen, so dass sie offen für Anwendungen in einzellige Genomics. Die Entwicklung dieser Technologie stellt jedoch seinen eigenen einzigartigen technologischen Herausforderungen. Zellen müssen lysiert, gereinigt und mit minimalen Bias, um einheitlich Probe Zellpopulationen verstärkt werden. Außerdem, im Gegensatz zu Polyadenylated mRNA Transkripte in Säugerzellen gibt es keine vergleichbare Molekulare Motiv im Genom, die Erfassung von der Ziel-Nukleinsäure zu erleichtern. Aus diesen Gründen wurde die Sequenzierung des Genoms einzellige in Microdroplet Plattformen schwer umzusetzen.
Dabei bieten wir ein detailliertes Protokoll unseres bereits berichtet einzellige mikrofluidischen Ansatzes in der Lage, der Sequenzierung der Genome von Zehntausenden von Zellen in einem einzigen Experiment17. Mit dieser Technologie, genannt SiC-Seq Bakterienzellen in Mikron-Skala Hydrogele gekapselt und individuell lysiert, Tagmented, und fusionierte mit einer Microdroplet, enthält einen einzigartige Oligonukleotid-Barcode, der auf die Zelle genomischer DNA über gespleißt wird eine einzigen Überschneidungen Erweiterung Polymerase-Kettenreaktion (PCR). Die Hydrogele dienen als isolierte Container in denen hohen Molekulargewicht genomischer DNA sterisch ummantelt ist, ermöglicht kleinere Moleküle wie Wasch- und lytischen Enzymen Zugang zu reinigen DNA vor Barcoding18. Dieses Protokoll verarbeitet > 50.000 Einzelzellen in einer Angelegenheit von Stunden, wodurch eine Barcode-Bibliothek für die Sequenzierung bereit. Nach der Sequenzierung sind die liest demultiplexed entsprechend ihrer einzellige Barcode Reihenfolge, was in einem Dataset besteht aus Millionen von liest, jeder mit einem zellulären Index.

<table><tbody><tr><td>3&quot; silicon wafers, P type, virgin test grade</td><td>University Wafers</td><td>447</td><td></td></tr><tr><td>SU-8 3025 photoresist</td><td>Microchem</td><td>17030192</td><td></td></tr><tr><td>Spin coater</td><td>Specialty Coating Systems</td><td>G3P-8</td><td></td></tr><tr><td>Photomasks</td><td>CadArt Servcies</td><td>(custom)</td><td>See Supplemental Files for mask designs</td></tr><tr><td>PGMEA developer</td><td>Sigma-Aldrich</td><td>484431</td><td></td></tr><tr><td>Isopropanol</td><td>Sigma-Aldrich</td><td>109827</td><td></td></tr><tr><td>Sylgard 184 silicone elastomer kit</td><td>Krayden</td><td>4019862</td><td></td></tr><tr><td>Degassing chamber</td><td>Bel-Art</td><td>42025</td><td></td></tr><tr><td>0.75 mm biopsy punch</td><td>World Precision Instruments</td><td>504529</td><td></td></tr><tr><td>Glass microscope slides (75 mm x 50 mm)</td><td>Corning</td><td>294775X50</td><td></td></tr><tr><td>Aquapel (hydrophobic glass treatment)</td><td>Pittsburgh Glass Works</td><td>47100</td><td></td></tr><tr><td>PE-2 polyethylene tubing</td><td>Scientific Commodities</td><td>B31695-PE/2</td><td></td></tr><tr><td>1 mL syringes</td><td>BD</td><td>309628</td><td></td></tr><tr><td>27 gauge needles</td><td>BD</td><td>305109</td><td></td></tr><tr><td>Syringe pump</td><td>New Era Pump Systems</td><td>NE-501</td><td></td></tr><tr><td>Novec HFE-7500 fluorinated oil (HFE)</td><td>3M</td><td>98-0212-2928-5</td><td></td></tr><tr><td>FC-40 fluorinated oil</td><td>Sigma-Aldrich</td><td>F9755</td><td></td></tr><tr><td>PEG-PFPE surfactant</td><td>Ran Biotechnologies</td><td>008-FluoroSurfactant</td><td></td></tr><tr><td>Space heater</td><td>Lasko&amp;nbsp;</td><td>CD09250&amp;nbsp;</td><td></td></tr><tr><td>Agarose, low gelling temperature</td><td>Sigma-Aldrich</td><td>a9414</td><td></td></tr><tr><td>TE (10X)</td><td>Rockland</td><td>mb-007</td><td></td></tr><tr><td>PBS 1X, pH 7.4</td><td>E&amp;amp;K Scientific Products</td><td>EK-65083</td><td></td></tr><tr><td>OptiPrep (density gradient medium)</td><td>Sigma-Aldrich</td><td>d1556</td><td></td></tr><tr><td>1H,1H,2H-Perfluoro-1-Octanol (PFO)</td><td>Sigma-Aldrich</td><td>370533</td><td></td></tr><tr><td>Span 80 (sorbitane monooleate)</td><td>Sigma-Aldrich</td><td>s6760</td><td></td></tr><tr><td>Hexane</td><td>Sigma-Aldrich</td><td>139386</td><td></td></tr><tr><td>Tween 20 (polysorbate 20)</td><td>Sigma-Aldrich</td><td>p2287</td><td></td></tr><tr><td>Lysozyme Type IV</td><td>MP Biomedicals</td><td>195303</td><td></td></tr><tr><td>Mutanolysin</td><td>Sigma-Aldrich</td><td>M9901</td><td></td></tr><tr><td>Zymolyase (yeast lytic enzyme)</td><td>Zymo Research</td><td>e1004</td><td></td></tr><tr><td>Lysostaphin</td><td>Sigma-Aldrich</td><td>L7386</td><td></td></tr><tr><td>Sodium chloride</td><td>Sigma-Aldrich</td><td>S9888</td><td></td></tr><tr><td>EDTA</td><td>Sigma-Aldrich</td><td>E6758</td><td></td></tr><tr><td>Tris-HCl, pH 7.5, 1M</td><td>Invitrogen</td><td>15567-027</td><td></td></tr><tr><td>Dithiothreitol (DTT)</td><td>Teknova</td><td>d9750</td><td></td></tr><tr><td>Lithium dodecyl sulfate</td><td>Sigma-Aldrich</td><td>L9781</td><td></td></tr><tr><td>Proteinase K</td><td>New England Biosciences</td><td>P8107S</td><td></td></tr><tr><td>Ethanol, 200 Proof (100%)</td><td>Koptec</td><td>V1001</td><td></td></tr><tr><td>SYBR Green I (nucleic acid stain)</td><td>Invitrogen</td><td>S7563</td><td></td></tr><tr><td>PEG 6k</td><td>Sigma-Aldrich</td><td>81260</td><td></td></tr><tr><td>Triton X-100 (octylphenol ethoxylate)</td><td>Sigma-Aldrich</td><td>t8787</td><td></td></tr><tr><td>Nextera DNA Library Prep Kit</td><td>Illumina</td><td>FC-121-1030</td><td></td></tr><tr><td>Phusion Hot Start Flex Master Mix (High-Fidelity Hot Start Master Mix)</td><td>New England Biosciences</td><td>m05365</td><td></td></tr><tr><td>Platinum Multiplex PCR Master Mix (Taq Master Mix)</td><td>Applied Biosystems</td><td>4464263</td><td></td></tr><tr><td>Warmstart 2.0 Bst Polymerase (isothermal polymerase)</td><td>New England Biosciences</td><td>m0538m</td><td></td></tr><tr><td>NT buffer from Nextera XT kit (neutralization buffer)</td><td>Illumina</td><td>FC-131-1024</td><td></td></tr><tr><td>Cold cathode fluorescent inverter</td><td>(custom)</td><td>(custom)</td><td></td></tr><tr><td>DC power supply</td><td>Mastech</td><td>HY1503D</td><td></td></tr><tr><td>Zerostat 3 anti-static gun</td><td>Milty</td><td>5036694022153</td><td></td></tr><tr><td>3D-printed centrifuge syringe holder</td><td>(custom)</td><td>(custom)</td><td>See Supplemental Files for 3D print file</td></tr><tr><td>Zymo DNA Clean &amp;amp; Concentrator-5</td><td>Zymo Research</td><td>D4003</td><td></td></tr></tbody></table>

an ultrahigh-throughput microfluidic platform for single-cell genome sequencing

Sequenziertechnologien haben einen Paradigmenwechsel von Masse, einzellige Auflösung als Reaktion auf eine sich entwickelnde Verständnis der Rolle der zellulären Heterogenität in biologischen Systemen unterzogen. Jedoch wurde einzellige Sequenzierung von großen Populationen durch Einschränkungen bei der Verarbeitung von Genome für die Sequenzierung behindert. In diesem Beitrag beschreiben wir einer Methode für einzellige Genom-Sequenzierung (SiC-Seq) die Tröpfchen Mikrofluidik verwendet, um zu isolieren, zu verstärken und Barcode der Genome einzelner Zellen. Zelle die Kapselung in mikrogele ermöglicht es, die unterteilte Reinigung und Tagmentation der DNA, während eine mikrofluidischen Fusion effizient jedes Genom mit einem einzigartigen einzellige Oligonukleotid-Barcode Paare erlaubt > 50.000 Einzelzellen sequenziert werden pro Durchlauf. Die Sequenzierungsdaten ist per Barcode Generieren von Gruppen von liest aus Einzelzellen demultiplexed. Als eine Hochdurchsatz- und Low-Bias Methode der einzelligen Sequenzierung wird SiC-Seq ein breiteres Spektrum von genomischen Studium richtet sich an unterschiedliche Zellpopulationen ermöglichen.

Die SiC-Seq experimentelle Workflow enthält 3 PDMS mikrofluidischen Geräten hergestellt, mit einem weichen Lithographie-Verfahren (Abbildung 1). Eine Co-Flow-Dropmaker (Abbildung 3A) erzeugt 25 µm von digitalen Barcode Tröpfchen für die Kennzeichnung von genomischen DNS mit einer eindeutigen Kennung der einzelligen. Die Barcode-Oligonukleotide bestehen aus einer 15 bp Entartete Abfolge flankiert von PCR-Griffe für Verstärkung (Tabelle 2, BAR-Primer). Die Barcodes werden verdünnt, um eine femtomolare Konzentration der Einzelmolekül-Kapselung zu erreichen und alle Tröpfchen erhalten entweder 0 oder 1 Barcode FCP. Die Tröpfchen mit einem Barcode werden verstärkt, viele Kopien der Doppelstrang-Barcode Amplifikate nachgeben. Ein Nukleinsäure-Fleck wird verwendet, um die erfolgreiche Verstärkung zu überprüfen und zu quantifizieren die Kapselung Rate der Barcode-Fragmente (Abbildung 4 b). Die mikrogele entstehen durch Co fließt eine Bakterienzelle Federung und einem geschmolzenen Agarosegel bei gleicher Flussraten (Abbildung 2A). Die Agarose wird in zweimal die gewünschte Endkonzentration, vorbereitet, wie die Co-Flow Dropmaking Prozess effektiv die wässrigen Lösungen um den Faktor 2 verdünnt. Da die Agarose abkühlt, erstarrt es in eine 25 µm Durchmesser Microgel besetzen die kugelförmigen Volumen des tropfenabscheiders.
Eine Reihe von Wasch- und Lyse Schritten reinigt den hohe Molekulargewicht genomischen DNA in mikrogele (Abb. 2 b). Nach dem Bruch der Emulsionen, wässrige Waschungen erfolgt in großen Mengen, Spur organische Lösungsmittel verdünnen die nachgelagerten enzymatischen Behandlungen hemmen können. Die gewaschenen mikrogele werden unter dem Mikroskop zu überprüfen, die Zelle Kapselung Rate (Abb. 4A) beobachtet. Ein Cocktail von Enzymen mit breiten lytische Aktivität ergänzt die Microgel Aussetzung, die Zellwände der Bakterien und Eukaryoten Mikroben19zu verdauen. Eine zweite Behandlung mit Proteinase K und Reinigungsmittel die Proteine abbaut und zellenrückstand solubilisiert.
Tagmentation der gereinigte DNA erfolgt in Tropfen, um potenzielle infolge der Diffusion von kleinen Tagmented DNA-Fragmente zwischen mikrogele18Kreuzkontamination zu vermeiden. Ein Tröpfchen Kapselung Gerät (Abb. 3 b) teilt jedem mikrogel mit einem Puffer und Tagmentation Enzym, welches gleichzeitig doppelsträngige DNA Fragmente während auch "tagging" es mit einer vorinstallierten Oligonukleotid-20. Die mikrogele werden in die Tröpfchen als dicht an dicht Partikel erreichen Kapselung Preise nähert sich 1 Microgel für jeden Tropfen mit einigen Dubletten21 (Abbildung 4) geladen.
Im letzten Schritt des mikrofluidischen Workflows (Abbildung 2) führt ein Gerät einen doppelten Fusion Vorgang 1 Barcode-Tropfen, 1 Microgel-haltigen Tropfen und die Verstärkung Mischung in zwei kontrollierten Schritten kombinieren. Erstens ist ein Tröpfchen mit PCR Reagenz gepaart und mit einem Barcode-Tropfen in der Region erscheinen in gelb (Abbildung 5) zusammengeführt. Salzwassersee Elektroden in der Mikrofluidik-Kanal erzeugen einen hohen elektrischen Feld Farbverlauf, der Tröpfchen Fusion auslöst. In ähnlicher Weise ist das erste zusammengeführte Tröpfchen gepaart mit einem Microgel Tröpfchen und ein zweites Mal in der Region erscheinen in rot zusammengeführt. Die Tröpfchen werden gesammelt und thermischen Gefahren-Chip in einer Single-Überlappung Verlängerung (SOE) PCR. Die überlappenden komplementäre Enden des Barcodes und die Tagmented genomischer DNA ermöglichen Fusion und exponentielle Amplifikation nur richtig Barcode Konstrukte.
Die Sequenzierungsdaten zuerst gefiltert durch eine Lesen Sie Qualität und dann durch die Gruppierung der liest laut ihrer 15-bp einzellige Barcode-Sequenz analysiert. Für eine Barcode-Gruppe als gültig betrachtet werden sollte es eine Mindestanzahl von liest enthalten; Diese Schwellwerte schränkt die Analyse auf Zellen mit eine sinnvolle Menge an Sequenzierungsdaten und den PCR mutiert Barcode "Waisen" aus dem Dataset entfernt. In diesem Beispiel ausführen, befindet sich das Minimum auf 7,5 kbit/s pro Gruppe (50 mal gelesen von 150 bp jedes). Ein Histogramm der Barcode Grafen gegen die Größe der Gruppe zeigt, dass ein erheblicher Teil der gültigen Barcode Gruppen oberhalb der Schwellengröße (Abbildung 6A).
In einem kontrollexperiment, wo die mikrobiellen Gemeinschaft Zusammensetzung bekannt ist, werden die Reinheit und die relative Häufigkeit Metriken zur Bewertung der Qualität einer SiC-Seq laufen. Hier ist eine synthetische 10-Zelle-Gemeinschaft bestehend aus 3 gram-negativen Bakterien, 5 gram-positiven Bakterien und Hefen 2 analysiert. Die Reinheit einer bestimmten Barcode-Gruppe ist definiert als die Anzahl der Lesevorgänge, die Zuordnung zu den häufigsten Genom in der Gruppe geteilt durch die Gesamtzahl der Lesevorgänge in der Gruppe. Die überwiegende Mehrheit der Barcode-Gruppen haben Reinheiten größer 0,95 (Abb. 6 b). Relative Häufigkeit der Zelltypen wird berechnet durch zählen der rohen liest und zählen die Barcode-Gruppen, wo die Gruppen einen Zellentyp entspricht dem Konsens von seiner Mitglied liest (Abbildung 6) zugeordnet sind. Die Fülle der Lese- und Barcode-Gruppen verfolgen in etwa zu gleichen Teilen, darauf hinweist, dass die Zell-Populationen abgetastet wird werden, so dass bestimmte Arten nicht in Gruppen unverhältnismäßig klein oder groß Barcode enthalten sind. Plotten der aggregierten Abdeckung aller Barcode-Gruppen aus einer einzigen Spezies zeigt eine hohe Abdeckung über das gesamte Genom, mit wenigen oder keinen ausfallende Regionen (Abbildung 7). Die Einheitlichkeit der Abdeckung mit einer Häufigkeitsverteilung der normalisierten Flächendeckungswerte, mit die meisten Werte um den Mittelwert zentriert überprüft werden kann (Abbildung 7, inset).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57598/57598fig1.jpg"> Abbildung 1 : Herstellung von mikrofluidischen Geräten durch Photolithographie. (A) Master Formen mit einer einzigen Funktion Höhe werden von Spin coating eine Schicht von SU-8 Photoresist auf einem Silizium-Wafer hergestellt. Der Fotolack ist dann eine Photolithographische Maske mit UV-Licht, Vernetzung der exponierten SU-8 gemustert. Schließlich ist in einem Entwickler-Bad Uncrosslinked SU-8 aufgelöst. Die resultierende Form wird verwendet, um PDMS zu werfen, das auf einen Objektträger zu produzieren das komplette mikrofluidischen Gerät verbunden ist. (B) für eine Doppelschicht-Gerät beginnt die Herstellung ähnlich mit Spin Coating und Belichtung Schritte. Diese Schritte werden dann wiederholt, ein zwei-Schicht-Gerät erstellen. <a href="/files/ftp_upload/57598/57598fig1large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57598/57598fig2.jpg"> Abbildung 2: Überblick über die SiC-Seq-Workflow. (A) A mikrobielle Federung ist Co floss mit geschmolzenen Agarose in einem Dropmaker Gerät Einzelzellen in mikrogele zu kapseln. (B) die mikrogele unterliegen einer Reihe von Waschungen, die bakterielle genomische DNA zu reinigen. Lytischen Enzyme verdauen die Zellwände von gram-positiven Bakterien und Hefen und Waschmittel solubilisiert der zelltrümmer. Die mikrogele sind neu gekapselt in Tröpfchen für die Tagmentation, Cross-Kontamination zu reduzieren. (C) der mikrofluidischen Fusion vereint digitale PCR Barcode, ein Tagmented Microgel Genom und eine Verstärkung-Mischung mit einer Rate > 1 kHz. Off-Chip SOE-PCR Spleiße einen einzigartigen einzellige Barcode auf das Tagmented Genom und selektiv verstärkt voll Barcode Konstrukte. <a href="/files/ftp_upload/57598/57598fig2large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57598/57598fig3.jpg"> Abbildung 3: Mikrofluidische Geräte für Dropmaking und Microgel Re Kapselung. (A) dieses Panel zeigt eine Co-Flow-Dropmaker (25 µm Funktion Höhe). Zellen und flüssige Agarose werden in das Gerät bei gleicher Flussraten bis 25 µm Tröpfchen an einer 25 µm X 25 µm Kreuzung produzieren vorgestellt. Für die digitalen Barcode-Dropmaking der zelleneinströmungsöffnung angeschlossen ist, und eine PCR-Mischung wird in der Agarose-Einlass eingeführt. (B) dieses Panel zeigt ein Microgel Re Kapselung Gerät (25 µm Funktion Höhe). Die mikrogele fließen in einen trichterförmigen Einlass zu erhalten, ihre dicht an dicht bestellen und erhalten ein Volumen von Tagmentation Mischung vor die erneute Einkapselung an einer 25 µm X 30-µm-Kreuzung. <a href="/files/ftp_upload/57598/57598fig3large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57598/57598fig4.jpg"> Abbildung 4 : Mikrographen Tröpfchen und mikrogele. (A) dieses Panel zeigt 25 µm mikrogele vor enzymatische Lyse gewaschen. Die Bakterien sind für die Quantifizierung der Kapselung Rate fluoreszent gefärbt. Poisson laden Statistiken zu diktieren, dass die Zellen gekapselte mit einer Rate von 1 in 10 Tropfen oder weniger um die Häufigkeit der Multiple-Kapselung Ereignisse zu minimieren. (B) zeigt dieses Panel eine Fluoreszenz Mikroskopie 25 µm digitalen Barcode Tröpfchen mit einer Nukleinsäure-beize behandelt. Die Tröpfchen mit verstärkten Barcode Fragmente erzeugen eine starke Fluoreszenz-Signal. (C) zeigt dieses Panel mikrogele wieder in 50 µm Tropfen gekapselt. Die schließen-Verpackung von der mikrogele ermöglicht eine Kapselung Preise nähert sich 1 Gel pro Tropfen mit einigen Dubletten. <a href="/files/ftp_upload/57598/57598fig4large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57598/57598fig5.jpg"> Abbildung 5 : Mikrofluidischen double Fusion Gerät für einzellige Genom Barcoding. Eine zweistufige Fusion Operation Paare Barcode Tröpfchen mit Tagmented Genome bei hohem Durchsatz. Ein Tropfen des PCR-Mixes zuerst erzeugt und mit einem Barcode-Tröpfchen in der Region erscheinen in gelb mit Salzwasser Elektroden zusammengeführt. Als nächstes ist ein Tröpfchen mit einem Microgel eingeführt und ein zweites Mal in der Region erscheinen in rot zusammengeführt. Öleinführungen ermöglichen präzise Kontrolle über den Abstand zwischen den reinjected Tröpfchen. Der Barcode Reinjektion Kammer und seine Abstandhalter Öl befinden sich auf der kürzeren 25 µm Schicht blau schattiert. Alle anderen Gerätefunktionen gehören zu den dickeren Schicht mit 45 µm Gesamthöhe. <a href="/files/ftp_upload/57598/57598fig5large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/57598/57598fig6.jpg"> Abbildung 6 : Barcode Gruppe Metriken für ein 10-Zelle synthetische mikrobiellen Gemeinschaft. (A) dieses Panel zeigt die Verteilung des Barcodes Gruppengrößen. Die Anzahl der Gruppen einer bestimmten Größe sinkt exponentiell steigender Größe Gruppe. Eine Mindestgrenze von 7,5 kbit/s pro Gruppe begrenzt die Analyse zu Gruppen mit einer ausreichenden Menge an Informationen und entfernt die PCR mutiert Sequenz "Waisen." (B) dieses Panel zeigt die Verteilung der Barcode Gruppe Reinheiten. Die überwiegende Mehrheit (> 90 %) der Gruppen sind von sehr hoher Reinheit (> 95 %). (C) dieser Bereich zeigt die relative Häufigkeit von 10 Arten berechnet auf Konzernebene Lese- und Barcode. Die 2 zählen Methoden produzieren ähnliche Ergebnisse, darauf hinweist, dass der Barcode Gruppengrößen über Artgrenzen konsistent sind. <a href="/files/ftp_upload/57598/57598fig6large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/57598/57598fig7.jpg"> Abbildung 7 : Aggregieren genomischen Abdeckung der Bacillus subtilis Barcode Gruppen. Das liest der Barcode Gruppen zuordnen, das Bakterium B. Subtilis (N = 9.398) gebündelt werden und in ihrer Gesamtheit analysiert. Eine kreisförmige Versorgungskarte zeigt die Abdeckung Einheitlichkeit des SiC-Seq lautet, mit keine beobachtbaren Dropout-Regionen. Eine gestrichelte Linie um den Umfang zeigt die durchschnittliche Reichweite (5.55 X). Der Einschub-Histogramm der relative Abdeckung Frequenzen zeigt, dass ein Großteil der Basen fallen in eine Tiefe in der Nähe der Genom-weiten Durchschnitt durch die gestrichelte Linie dargestellt. <a href="/files/ftp_upload/57598/57598fig7large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Gerät</td>
			<td>1. Layerhöhe (µm)</td>
			<td>1. Schicht Spin Drehzahl (u/min)</td>
			<td>2. Layerhöhe (µm)</td>
			<td>2. Schicht Spin Drehzahl (u/min)</td>
		</tr>
<tr>
<td>Co-Flow dropmaker</td>
			<td>25</td>
			<td>4000</td>
			<td>N/A</td>
			<td>N/A</td>
		</tr>
<tr>
<td>Re Gel encapsulator</td>
			<td>25</td>
			<td>4000</td>
			<td>N/A</td>
			<td>N/A</td>
		</tr>
<tr>
<td>Doppelte Fusion</td>
			<td>25</td>
			<td>4000</td>
			<td>20</td>
			<td>5000</td>
		</tr>
</tbody></table>Tabelle 1: Herstellung Geräteparameter mikrofluidischen. Diese Tabelle zeigt eine Auflistung der mikrofluidischen Geräte in der SiC-Seq-Workflow mit ihren erforderlichen Geschwindigkeiten für Fotolack Spin coating (basierend auf den Angaben des Herstellers für SU-8 3025) verwendet.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Label</td>
			<td colspan="5">Sequenz (5' > 3')</td>
		</tr>
<tr>
<td>BAR</td>
			<td colspan="5">GCAGCTGGCGTAATAGCGAGTACAATCTGCTCTGATGCCGCATAGNNNNNNNNNNNNNNNTAAGCCAGCCCCGACACT</td>
		</tr>
<tr>
<td>DNA_BAR</td>
			<td colspan="5">CTGTCTCTTATACACATCTCCGAGCCCACGAGACGTGTCGGGGCTGGCTTA</td>
		</tr>
<tr>
<td>P7_BAR</td>
			<td colspan="5">CAAGCAGAAGACGGCATACGAGATCAGCTGGCGTAATAGCG</td>
		</tr>
<tr>
<td>P5_DNA</td>
			<td colspan="5">AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC</td>
		</tr>
<tr>
<td>I7_READ</td>
			<td colspan="5">GCCCACGAGACGTGTCGGGGCTGGCTTA</td>
		</tr>
</tbody></table>Tabelle 2: Primer Sequenzen.
Ergänzende Datei 1: <a href="/files/ftp_upload/57598/Suppl_File_1-SiC-seq_device_masks.dwg" target="_blank">Bitte klicken Sie hier, um diese Datei herunterladen.</a>
Ergänzende Datei 2: <a href="/files/ftp_upload/57598/Suppl_File_2-centrifuge_syringe_holder_1mL.dwg" target="_blank">Bitte klicken Sie hier, um diese Datei herunterladen.</a>

Watch this Scientific Journal Video about An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing at JoVE.com

An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing

Eine höchste Durchsatz mikrofluidischen Plattform für einzellige Genom-Sequenzierung

Einzellige Sequenzierung zeigt genotypischen Heterogenität in biologischen Systemen, aber aktuelle Technologien fehlen des Durchsatzes für die Tiefe Profilierung der Zusammensetzung und Funktion notwendig. Hier beschreiben wir einen mikrofluidischen Workflow für die Sequenzierung > 50.000 einzellige Genome aus verschiedenen Zell-Populationen.

Sequencing technologies have undergone a paradigm shift from bulk to single-cell resolution in response to an evolving understanding of the role of ...

an-ultrahigh-throughput-microfluidic-platform-for-single-cell-genome

Research

JoVE Journal

Bioengineering

17.5K Aufrufe.  University of California, San Francisco. Einzellige Sequenzierung zeigt genotypischen Heterogenität in biologischen Systemen, aber aktuelle Technologien fehlen des Durchsatzes für die Tiefe Profilierung der Zusammensetzung und Funktion notwendig. Hier beschreiben wir einen mikrofluidischen Workflow für die Sequenzierung > 50.000 einzellige Genome aus verschiedenen Zell-Populationen.

Serie: An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing

High Throughput MicroRNA Profiling: Optimized Multiplex qRT-PCR at Nanoliter Scale on the Fluidigm Dynamic ArrayTM IFCs

The broad involvement of miRNAs in critical processes underlying development, tissue homoeostasis and disease has led to a surging interest among the research and pharmaceutical communities. To study miRNAs, it is essential that the quantification of microRNA levels is accurate and robust. By comparing wild-type to small RNA deficient mouse embryonic stem cells (mESC), we revealed a lack of accuracy and robustness in previous published multiplex qRT-PCR techniques. Here, we describe an optimized method, including purifying away excessive primers from previous multiplex steps before singleplex real time detection, which dramatically increases the accuracy and robustness of the technique. Furthermore, we explain how performing the technique on a microfluidic chip at nanoliter volumes significantly reduces reagent costs and permits time effective high throughput miRNA expression profiling.

Here we describe an optimized multiplex reverse transcriptase quantitative PCR (qRT-PCR) protocol in combination with a microfluidic platform as a cost and time effective high-throughput screening tool for microRNA (miRNA) expression levels, especially when working with limited amounts of sample.

High Throughput MicroRNA Profiling: Optimierte Multiplex qRT-PCR in Nanoliter-Maßstab auf dem Fluidigm Dynamische ArrayTM IFCs

The broad involvement of miRNAs in critical processes underlying development, tissue homoeostasis and disease has led to a surging interest among the ...

Forschung

Biotechnik

High-throughput Protein Expression Generator Using a Microfluidic Platform

Rapidly increasing fields, such as systems biology, require the development and implementation of new technologies, enabling high-throughput and high-fidelity measurements of large systems. Microfluidics promises to fulfill many of these requirements, such as performing high-throughput screening experiments on-chip, encompassing biochemical, biophysical, and cell-based assays1. Since the early days of microfluidics devices, this field has drastically evolved, leading to the development of microfluidic large-scale integration2,3. This technology allows for the integration of thousands of micromechanical valves on a single device with a postage-sized footprint (Figure 1). We have developed a high-throughput microfluidic platform for generating in vitro expression of protein arrays (Figure 2) named PING (Protein Interaction Network Generator). These arrays can serve as a template for many experiments such as protein-protein 4, protein-RNA5 or protein-DNA6 interactions.
The device consist of thousands of reaction chambers, which are individually programmed using a microarrayer. Aligning of these printed microarrays to microfluidics devices programs each chamber with a single spot eliminating potential contamination or cross-reactivity Moreover, generating microarrays using standard microarray spotting techniques is also very modular, allowing for the arraying of proteins7, DNA8, small molecules, and even colloidal suspensions. The potential impact of microfluidics on biological sciences is significant. A number of microfluidics based assays have already provided novel insights into the structure and function of biological systems, and the field of microfluidics will continue to impact biology.

We present a microfluidic approach for the expression of protein arrays. The device consists of thousands of reaction chambers controlled by micro-mechanical valves. The microfluidic device is mated to a microarray-printed gene library. These genes are then transcribed and translated on-chip, resulting in a protein array ready for experimental use.

High-throughput Protein Expression Generator mit einem mikrofluidischen Plattform

Rapidly increasing fields, such as systems biology, require the development and implementation of new technologies, enabling high-throughput and ...

High Throughput Single-cell and Multiple-cell Micro-encapsulation

Microfluidic encapsulation methods have been previously utilized to capture cells in picoliter-scale aqueous, monodisperse drops, providing confinement from a bulk fluid environment with applications in high throughput screening, cytometry, and mass spectrometry. We describe a method to not only encapsulate single cells, but to repeatedly capture a set number of cells (here we demonstrate one- and two-cell encapsulation) to study both isolation and the interactions between cells in groups of controlled sizes. By combining drop generation techniques with cell and particle ordering, we demonstrate controlled encapsulation of cell-sized particles for efficient, continuous encapsulation. Using an aqueous particle suspension and immiscible fluorocarbon oil, we generate aqueous drops in oil with a flow focusing nozzle. The aqueous flow rate is sufficiently high to create ordering of particles which reach the nozzle at integer multiple frequencies of the drop generation frequency, encapsulating a controlled number of cells in each drop. For representative results, 9.9 &mu;m polystyrene particles are used as cell surrogates. This study shows a single-particle encapsulation efficiency Pk=1 of 83.7% and a double-particle encapsulation efficiency Pk=2 of 79.5% as compared to their respective Poisson efficiencies of 39.3% and 33.3%, respectively. The effect of consistent cell and particle concentration is demonstrated to be of major importance for efficient encapsulation, and dripping to jetting transitions are also addressed. 
Introduction 
Continuous media aqueous cell suspensions share a common fluid environment which allows cells to interact in parallel and also homogenizes the effects of specific cells in measurements from the media. High-throughput encapsulation of cells into picoliter-scale drops confines the samples to protect drops from cross-contamination, enable a measure of cellular diversity within samples, prevent dilution of reagents and expressed biomarkers, and amplify signals from bioreactor products. Drops also provide the ability to re-merge drops into larger aqueous samples or with other drops for intercellular signaling studies.1,2 The reduction in dilution implies stronger detection signals for higher accuracy measurements as well as the ability to reduce potentially costly sample and reagent volumes.3 Encapsulation of cells in drops has been utilized to improve detection of protein expression,4 antibodies,5,6 enzymes,7 and metabolic activity8 for high throughput screening, and could be used to improve high throughput cytometry.9 Additional studies present applications in bio-electrospraying of cell containing drops for mass spectrometry10 and targeted surface cell coatings.11 Some applications, however, have been limited by the lack of ability to control the number of cells encapsulated in drops. Here we present a method of ordered encapsulation12 which increases the demonstrated encapsulation efficiencies for one and two cells and may be extrapolated for encapsulation of a larger number of cells.
To achieve monodisperse drop generation, microfluidic "flow focusing" enables the creation of controllable-size drops of one fluid (an aqueous cell mixture) within another (a continuous oil phase) by using a nozzle at which the streams converge.13 For a given nozzle geometry, the drop generation frequency f and drop size can be altered by adjusting oil and aqueous flow rates Qoil and Qaq. As the flow rates increase, the flows may transition from drop generation to unstable jetting of aqueous fluid from the nozzle.14 
When the aqueous solution contains suspended particles, particles become encapsulated and isolated from one another at the nozzle. For drop generation using a randomly distributed aqueous cell suspension, the average fraction of drops Dk containing k cells is dictated by Poisson statistics, where Dk = &lambda;k exp(-&lambda;)/(k!) and &lambda; is the average number of cells per drop. The fraction of cells which end up in the "correctly" encapsulated drops is calculated using Pk = (k x Dk)/&Sigma;(k' x Dk'). The subtle difference between the two metrics is that Dk relates to the utilization of aqueous fluid and the amount of drop sorting that must be completed following encapsulation, and Pk relates to the utilization of the cell sample. As an example, one could use a dilute cell suspension (low &lambda;) to encapsulate drops where most drops containing cells would contain just one cell. While the efficiency metric Pk would be high, the majority of drops would be empty (low Dk), thus requiring a sorting mechanism to remove empty drops, also reducing throughput.15
Combining drop generation with inertial ordering provides the ability to encapsulate drops with more predictable numbers of cells per drop and higher throughputs than random encapsulation. Inertial focusing was first discovered by Segre and Silberberg16 and refers to the tendency of finite-sized particles to migrate to lateral equilibrium positions in channel flow. Inertial ordering refers to the tendency of the particles and cells to passively organize into equally spaced, staggered, constant velocity trains. Both focusing and ordering require sufficiently high flow rates (high Reynolds number) and particle sizes (high Particle Reynolds number).17,18 Here, the Reynolds number Re =uDh/&nu; and particle Reynolds number Rep =Re(a/Dh)2, where u is a characteristic flow velocity, Dh [=2wh/(w+h)] is the hydraulic diameter, &nu; is the kinematic viscosity, a is the particle diameter, w is the channel width, and h is the channel height. Empirically, the length required to achieve fully ordered trains decreases as Re and Rep increase. Note that the high Re and Rep requirements (for this study on the order of 5 and 0.5, respectively) may conflict with the need to keep aqueous flow rates low to avoid jetting at the drop generation nozzle. Additionally, high flow rates lead to higher shear stresses on cells, which are not addressed in this protocol. The previous ordered encapsulation study demonstrated that over 90% of singly encapsulated HL60 cells under similar flow conditions to those in this study maintained cell membrane integrity.12 However, the effect of the magnitude and time scales of shear stresses will need to be carefully considered when extrapolating to different cell types and flow parameters. The overlapping of the cell ordering, drop generation, and cell viability aqueous flow rate constraints provides an ideal operational regime for controlled encapsulation of single and multiple cells.
Because very few studies address inter-particle train spacing,19,20 determining the spacing is most easily done empirically and will depend on channel geometry, flow rate, particle size, and particle concentration. Nonetheless, the equal lateral spacing between trains implies that cells arrive at predictable, consistent time intervals. When drop generation occurs at the same rate at which ordered cells arrive at the nozzle, the cells become encapsulated within the drop in a controlled manner. This technique has been utilized to encapsulate single cells with throughputs on the order of 15 kHz,12 a significant improvement over previous studies reporting encapsulation rates on the order of 60-160 Hz.4,15 In the controlled encapsulation work, over 80% of drops contained one and only one cell, a significant efficiency improvement over Poisson (random) statistics, which predicts less than 40% efficiency on average.12
In previous controlled encapsulation work,12 the average number of particles per drop &lambda; was tuned to provide single-cell encapsulation. We hypothesize that through tuning of flow rates, we can efficiently encapsulate any number of cells per drop when &lambda; is equal or close to the number of desired cells per drop. While single-cell encapsulation is valuable in determining individual cell responses from stimuli, multiple-cell encapsulation provides information relating to the interaction of controlled numbers and types of cells. Here we present a protocol, representative results using polystyrene microspheres, and discussion for controlled encapsulation of multiple cells using a passive inertial ordering channel and drop generation nozzle.

Combining monodisperse drop generation with inertial ordering of cells and particles, we describe a method to encapsulate a desired number of cells or particles in a single drop at kHz rates. We demonstrate efficiencies twice exceeding those of unordered encapsulation for single- and double-particle drops.

High-Throughput-Einzel-Zell-und Multiple-Zelle Mikroverkapselung

Microfluidic encapsulation methods have been previously utilized to capture cells in picoliter-scale aqueous, monodisperse drops, providing confinement ...

A Versatile Automated Platform for Micro-scale Cell Stimulation Experiments

Study of cells in culture (in vitro analysis) has provided important insight into complex biological systems. Conventional methods and equipment for in vitro analysis are well suited to study of large numbers of cells (&ge;105) in milliliter-scale volumes (&ge;0.1 ml). However, there are many instances in which it is necessary or desirable to scale down culture size to reduce consumption of the cells of interest and/or reagents required for their culture, stimulation, or processing. Unfortunately, conventional approaches do not support precise and reproducible manipulation of micro-scale cultures, and the microfluidics-based automated systems currently available are too complex and specialized for routine use by most laboratories. To address this problem, we have developed a simple and versatile technology platform for automated culture, stimulation, and recovery of small populations of cells (100 - 2,000 cells) in micro-scale volumes (1 - 20 &mu;l). The platform consists of a set of fibronectin-coated microcapillaries ("cell perfusion chambers"), within which micro-scale cultures are established, maintained, and stimulated; a digital microfluidics (DMF) device outfitted with "transfer" microcapillaries ("central hub"), which routes cells and reagents to and from the perfusion chambers; a high-precision syringe pump, which powers transport of materials between the perfusion chambers and the central hub; and an electronic interface that provides control over transport of materials, which is coordinated and automated via pre-determined scripts. As an example, we used the platform to facilitate study of transcriptional responses elicited in immune cells upon challenge with bacteria. Use of the platform enabled us to reduce consumption of cells and reagents, minimize experiment-to-experiment variability, and re-direct hands-on labor. Given the advantages that it confers, as well as its accessibility and versatility, our platform should find use in a wide variety of laboratories and applications, and prove especially useful in facilitating analysis of cells and stimuli that are available in only limited quantities.

We have developed an automated cell culture and interrogation platform for micro-scale cell stimulation experiments. The platform offers simple, versatile, and precise control in cultivating and stimulating small populations of cells, and recovering lysates for molecular analyses. The platform is well suited to studies that use precious cells and/or reagents.

Eine vielseitige automatisierte Plattform für Mikro-Skala Handy Stimulation Experimente

Study of cells in culture (in vitro analysis) has provided important insight into complex biological systems. Conventional methods and equipment for in ...

A Microfluidic Chip for the Versatile Chemical Analysis of Single Cells

We present a microfluidic device that enables the quantitative determination of intracellular biomolecules in multiple single cells in parallel. For this purpose, the cells are passively trapped in the middle of a microchamber. Upon activation of the control layer, the cell is isolated from the surrounding volume in a small chamber. The surrounding volume can then be exchanged without affecting the isolated cell. However, upon short opening and closing of the chamber, the solution in the chamber can be replaced within a few hundred milliseconds. Due to the reversibility of the chambers, the cells can be exposed to different solutions sequentially in a highly controllable fashion, e.g. for incubation, washing, and finally, cell lysis. The tightly sealed microchambers enable the retention of the lysate, minimize and control the dilution after cell lysis. Since lysis and analysis occur at the same location, high sensitivity is retained because no further dilution or loss of the analytes occurs during transport. The microchamber design therefore enables the reliable and reproducible analysis of very small copy numbers of intracellular molecules (attomoles, zeptomoles) released from individual cells. Furthermore, many microchambers can be arranged in an array format, allowing the analysis of many cells at once, given that suitable optical instruments are used for monitoring. We have already used the platform for proof-of-concept studies to analyze intracellular proteins, enzymes, cofactors and second messengers in either relative or absolute quantifiable manner.

In this article we present a microfluidic chip for single cell analysis. It allows the quantification of intracellular proteins, enzymes, cofactors, and second messengers by means of fluorescent assays or immunoassays.&#160;

Eine mikrofluidische Chip für die vielseitige chemische Analyse von Einzelzellen

We present a microfluidic device that enables the quantitative determination of intracellular biomolecules in multiple single cells in parallel. For this ...

Sequencing of mRNA from Whole Blood using Nanopore Sequencing

Sequencing in remote locations and resource-poor settings presents unique challenges. Nanopore sequencing can be successfully used under such conditions, and was deployed to West Africa during the recent Ebola virus epidemic, highlighting this possibility. In addition to its practical advantages (low cost, ease of equipment transport and use), this technology also provides fundamental advantages over second-generation sequencing approaches, particularly the very long read length, ability to directly sequence RNA, and real-time availability of data. Raw read accuracy is lower than with other sequencing platforms, which represents the main limitation of this technology; however, this can be partially mitigated by the high read depth generated. Here, we present a field-compatible protocol for sequencing of the mRNAs encoding for Niemann-Pick C1, which is the cellular receptor for ebolaviruses. This protocol encompasses extraction of RNA from animal blood samples, followed by RT-PCR for target enrichment, barcoding, library preparation, and the sequencing run itself, and can be easily adapted for use with other DNA or RNA targets.

Nanopore sequencing is a novel technology that allows cost-effective sequencing in remote locations and resource-poor settings. Here, we present a protocol for sequencing of mRNAs from whole blood that is compatible with such conditions.

Sequenzierung von mRNA aus Vollblut mit Nanopore-Sequenzierung

Sequencing in remote locations and resource-poor settings presents unique challenges. Nanopore sequencing can be successfully used under such conditions, ...

Genetik

High-Throughput Quantitative RT-PCR in Single and Bulk C. elegans Samples Using Nanofluidic Technology

This paper presents a high-throughput reverse transcription quantitative PCR (RT-qPCR) assay for Caenorhabditis elegans that is fast, robust, and highly sensitive. This protocol obtains precise measurements of gene expression from single worms or from bulk samples. The protocol presented here provides a novel adaptation of existing methods for complementary DNA (cDNA) preparation coupled to a nanofluidic RT-qPCR platform. The first part of this protocol, named &#8216;Worm-to-CT&#8217;, allows cDNA production directly from nematodes without the need for prior mRNA isolation. It increases experimental throughput by allowing the preparation of cDNA from 96 worms in 3.5 h. The second part of the protocol uses existing nanofluidic technology to run high-throughput RT-qPCR on the cDNA. This paper evaluates two different nanofluidic chips: the first runs 96 samples and 96 targets, resulting in 9,216 reactions in approximately 1.5 days of benchwork. The second chip type consists of six 12 x 12 arrays, resulting in 864 reactions. Here, the Worm-to-CT method is demonstrated by quantifying mRNA levels of genes encoding heat shock proteins from single worms and from bulk samples. Provided is an extensive list of primers designed to amplify processed RNA for the majority of coding genes within the C. elegans genome.

High-Throughput Quantitative RT-PCR in Single and Bulk C. elegans Samples Using Nanofluidic Technology

In this article a high-throughput protocol for fast and reliable determination of gene expression levels in single or bulk C. elegans samples is described. This protocol does not require RNA isolation and produces cDNA directly from samples. It can be used together with high-throughput multiplexed nanofluidic real-time qPCR platforms.

Quantitative RT-PCR mit hohem Durchsatz in Einzel- und Bulk-C. elegans Proben mit Nanofluidic-Technologie

This paper presents a high-throughput reverse transcription quantitative PCR (RT-qPCR) assay for Caenorhabditis elegans that is fast, robust, and highly ...

A Microfluidic Platform for High-throughput Single-cell Isolation and Culture

Studying the heterogeneity of single cells is crucial for many biological questions, but is technically difficult. Thus, there is a need for a simple, yet high-throughput, method to perform single-cell culture experiments. Here, we report a microfluidic chip-based strategy for high-efficiency single-cell isolation (~77%) and demonstrate its capability of performing long-term single-cell culture (up to 7 d) and cellular heterogeneity analysis using clonogenic assay. These applications were demonstrated with KT98 mouse neural stem cells, and A549 and MDA-MB-435 human cancer cells. High single-cell isolation efficiency and long-term culture capability are achieved by using different sizes of microwells on the top and bottom of the microfluidic channel. The small microwell array is designed for precisely isolating single-cells, and the large microwell array is used for single-cell clonal culture in the microfluidic chip. This microfluidic platform constitutes an attractive approach for single-cell culture applications, due to its flexibility of adjustable cell culture spaces for different culture strategies, without decreasing isolation efficiency.

Here, we present a protocol for isolating and culturing single cells with a microfluidic platform, which utilizes a new microwell design concept to allow for high-efficiency single cell isolation and long-term clonal culture.

Ein Mikrofluidik-Plattform für Hochdurchsatz-Einzelzell-Isolierung und Kultur

Studying the heterogeneity of single cells is crucial for many biological questions, but is technically difficult. Thus, there is a need for a simple, yet ...

Ultra-long Read Sequencing for Whole Genomic DNA Analysis

Third generation single-molecule DNA sequencing technologies offer significantly longer read length that can facilitate the assembly of complex genomes and analysis of complex structural variants. Nanopore platforms perform single-molecule sequencing by directly measuring the current changes mediated by DNA passage through the pores and can generate hundreds of kilobase (kb) reads with minimal capital cost. This platform has been adopted by many researchers for a variety of applications. Achieving longer sequencing read lengths is the most critical factor to leverage the value of nanopore sequencing platforms. To generate ultra-long reads, special consideration is required to avoid DNA breakages and gain efficiency to generate productive sequencing templates. Here, we provide the detailed protocol of ultra-long DNA sequencing including high molecular weight (HMW) DNA extraction from fresh or frozen cells, library construction by mechanical shearing or transposase fragmentation, and sequencing on a nanopore device. From 20-25 &#181;g of HMW DNA, the method can achieve N50 read length of 50-70 kb with mechanical shearing and N50 of 90-100 kb read length with transposase mediated fragmentation. The protocol can be applied to DNA extracted from mammalian cells to perform whole genome sequencing for the detection of structural variants and genome assembly. Additional improvements on the DNA extraction and enzymatic reactions will further increase the read length and expand its utility.

Long-read sequences greatly facilitate the assembly of complex genomes and characterization of structural variation. We describe a method to generate ultra-long sequences by nanopore-based sequencing platforms. The approach adopts an optimized DNA extraction followed by modified library preparations to generate hundreds of kilobase reads with moderate coverage from human cells.

Ultra-lange lesen Sequenzierung für ganze genomische DNA-Analysen

Third generation single-molecule DNA sequencing technologies offer significantly longer read length that can facilitate the assembly of complex genomes ...

A Multilayer Microfluidic Platform for the Conduction of Prolonged Cell-Free Gene Expression

The limitations of cell-based synthetic biology are becoming increasingly apparent as researchers aim to develop larger and more complex synthetic genetic regulatory circuits. The analysis of synthetic genetic regulatory networks in vivo is time consuming and suffers from a lack of environmental control, with exogenous synthetic components interacting with host processes resulting in undesired behavior. To overcome these issues, cell-free characterization of novel circuitry is becoming more prevalent. In vitro transcription and translation (IVTT) mixtures allow the regulation of the experimental environment and can be optimized for each unique system. The protocols presented here detail the fabrication of a multilayer microfluidic device that can be utilized to sustain IVTT reactions for prolonged durations. In contrast to batch reactions, where resources are depleted over time and (by-) products accumulate, the use of microfluidic devices allows the replenishment of resources as well as the removal of reaction products. In this manner, the cellular environment is emulated by maintaining an out-of-equilibrium environment in which the dynamic behavior of gene circuits can be investigated over extended periods of time. To fully exploit the multilayer microfluidic device, hardware and software have been integrated to automate the IVTT reactions. By combining IVTT reactions with the microfluidic platform presented here, it becomes possible to comprehensively analyze complex network behaviors, furthering our understanding of the mechanisms that regulate cellular processes.

The fabrication process of a PDMS-based, multilayer, microfluidic device that allows in vitro transcription and translation (IVTT) reactions to be performed over prolonged periods is described. Furthermore, a comprehensive overview of the hardware and software required to automate and maintain these reactions for prolonged durations is provided.

Eine multilayer mikrofluidische Plattform für die Leitung einer längeren zellfreien Genexpression

The limitations of cell-based synthetic biology are becoming increasingly apparent as researchers aim to develop larger and more complex synthetic genetic ...